DNA origami is a method through which single-stranded DNA can be systematically folded into complex and molecularly defined two- and three-dimensional nanostructures using oligonucleotide hybridization and inter-strand cross-overs to dictate the final shape. In the last 10 years, this technique has proven utility in applications including cellular imaging, drug delivery, bio-sensing and nano-mechanics through proper functionalization of DNA origami with aptamers, antibodies, enzymes, and fluorescent dyes. Important biological properties of DNA origami nanostructures include defined dimensions and shape which can be established through the programmed routing of oligonucleotide staples within the single-stranded scaffold DNA, as well as the biocompatible nature of DNA material. The use of DNA origami nanostructures in drug delivery has already proven effective for specific and tunable release or killing of cancer cells.
Intracellular delivery of small interfering RNA (siRNA) for gene silencing, which can be used to manipulate cellular phenotypes and as a therapy, is a challenging task. Current methods are often mediated by micelle type structures composed of synthetic and semi-synthetic polymers with cationic properties to encapsulate the siRNA for cellular internalization, which have two inherent disadvantages in the methods used to transport negatively charged RNA across the lipid bilayer: increased membrane permeability and immunotoxicity. The optimal delivery system needs to encompass highly efficient cell uptake, low cytotoxicity and immunotoxicity, high biocompatibility, include targeting moieties for in vivo spatiotemporal delivery and exhibit low off-target effects.
Methods to enhance the delivery of therapeutics have incorporated ligands for cell-specific receptor-mediated entry and cell penetrating peptides for improved, but generally non-specific, entry. Receptor targeted drug delivery takes advantage of receptors for small molecules and proteins such as vitamins, antibodies, transferrin, growth factors and aptamers which may be present only on a subset of cell types. Tailoring the targeting ligand for the disease of interest is an important step in cell-specific receptor-mediated delivery. In cancer targeted therapies, folic acid and HER2 are two well established ligands for cell uptake. Cell penetrating peptides (CPP) are emerging as an alternative to ligand mediated entry because CPPs generally enter in a noninvasive manner and do not compromise the integrity of cell membranes. Hundreds of CPPs have been described composed of both naturally occurring and synthetic sequences. The sequence identity of each CPP appears to be what dictates its method and efficiency of entry with peptides entering both endocytic and direct penetration pathways. Delivery of siRNA duplexes by reductive release from carriers such as dendrimers, poly-D-arginine, folate-PEG, copolymers, CPPs and DNA has been demonstrated previously.
A functionalized 24 helix bundle DNA origami nanostructure (CPP-DON) can be efficiently assembled in a one-pot reaction with cell penetrating peptides and subsequently conjugated with siRNAs as an effective transfection reagent. In one example, a CPP-DON-siRNA nanostructure is internalized by HeLa cells and siRNA duplexes attached by disulfide bonds are released following cellular uptake in the reductive intracellular milieu to silence gene expression in human cells. One targeting approach has used folic acid because its specific receptor is not expressed on healthy cells, but is abundant on the surface of cancer cells. In addition to folic acid, three other widely used CPPs (Penetratin, MAP, Hph-1) were used to study the efficiency of DNA origami internalization by human cells. Findings demonstrate that CPP-DON-siRNA nanostructures can penetrate HeLa cells and silence gene expression at a level to commercially available lipid-based transfection reagents. Furthermore, this CPP-DON-siRNA delivery approach is bio-compatible and elicits no detectable cytotoxicity while maintaining stability in serum and low Mg2+ environments important for in vitro and in vivo human studies. The present disclosure describes the utility of DNA and RNA origami as a RNA transfection reagent and provides a basis for exploration of its application as a therapeutic reagent both in vivo and in vitro for diagnostic, treatment, and/or research purposes for cancer and other genetically-related conditions.
Before the present methods, implementations and systems are disclosed and described, it is to be understood that this invention is not limited to specific methods, specific components, implementation, or to particular compositions, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular implementations only and is not intended to be limiting. Neither are explanations that have been provided to assist in understanding the disclosure meant to be limiting.
As used in the specification and the claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed in ways including from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another implementation may include from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, for example by use of the antecedent “about,” it will be understood that the particular value forms another implementation. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.
“Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. Similarly, “typical” or “typically” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
A 24 helix bundle DON to deliver siRNA molecules into human cells was created. The CPP-DON-siRNA structure of the present disclosure was designed to be approximately 100 nm by 14 nm without any functionalization using the DNA origami design software caDNAno built upon the M13mp18 (7249 nt) scaffold. By routing staples to maximize 3′ termini overhanging the structure, one example design included 158 extruding single-stranded overhangs for annealing of functionalized oligonucleotides and attachment of siRNA duplexes and cell penetrating moieties.
The complete caDNAno design schematic and oligonucleotide sequences are provided in
Successful application of the disclosed CPP-DON-siRNA nanostructure as a transfection reagent relies upon its stability in culture media. Stability was assessed under culture conditions including nuclease rich serum and weak cationic solutions. It was recently described that unmodified DNA nanostructures have varied levels of stability under conditions of Mg′ depletion and in the presence of fetal bovine serum, a nuclease rich environment. To address the stability of the present CPP-DON-siRNA nanostructures in these environments, assembled nanostructures were incubated in DMEM supplemented with EDTA to chelate away existing metals or supplemented with MgSO4, and also in DMEM supplemented with 10% FBS for 24 h. Even when all Mg2+ was chelated away from the media, the disclosed CPP-DON-siRNA nanostructure remained stable (
To be used as either a transfection reagent or in disease therapy CPP-DON-siRNA nanostructures must enter cells and deliver siRNA duplexes to act in siRNA pathways. The combination of CPPs conjugated directly to siRNA duplexes or other anti-sense technologies has been well established using a range of CPPs attached to anti-sense molecules by thiol linkage for cytoplasmic release. To demonstrate the disclosed nanostructures will function as desired CPP-DON-siRNA nanostructures were incubated with HeLa cells overnight to mimic typical siRNA delivery and knockdown experiments. In order to track the entry of nanostructures and the fate of siRNAs we used siRNA duplexes labeled at the 5′ end of the sense strand with Cyanine-5 (Cy5) dye which enabled detection under with 640 nm wavelength laser excitation. Using an automated Nikon TiE microscope HeLa cells were imaged by differential interference contrast (DIC) microscopy and Cy5 fluorescence. Each CPP-siRNA nanostructure was internalized by HeLa cells, with each CPP exhibiting different levels and patterns of internalized signal (
One example of in vitro gene silencing by CPP-DON-siRNA that attached with specific siRNA to fLuc mRNA for HeLa Luc-2A-GFP stable cells is presented in
The production of a cytotoxic response following CPP-DON-siRNA treatment was tested using a lactate dehydrogenase (LDH) assay kit (Pierce). This cytotoxicity assay measures the release of LDH into cellular media following treatment from cells which experienced membrane perturbations. Cells were treated with CPP-DON-siRNA nanostructures at 670 pM for 1 h at 37° C. before being mixed with an equal volume of reaction mixture. LDH activity was assessed by the difference between A490 and A680 measurements and total lysis controls were performed using supplied lysis buffer. No differences were observed between the CPP-DON-siRNA treatment and addition of buffer alone. As shown in
The need for safe and effective methods for siRNA drug delivery, both in vitro and in vivo, led us to investigate the use of DNA origami as a cell transfection reagent. Delivery of siRNAs to numerous human cell types has been investigated using a broad array of methods including viral vectors, electroporation, and transfection reagents. Transfection reagents are widely used in research and provide advantages of high efficiency and reproducibility in many cell types, but do not perform well in primary and non-dividing cells or in vivo applications. Some of the largest hurdles for successful delivery of any RNA molecule are cell entry, RNA stability and cytotoxicity. Efficient delivery necessitates the use of a nano-carrier to transport strongly negatively charged RNA across cell membranes. Carriers such as dendrimers, polymers, lipids, gold and iron oxide nanoparticles and carbon nanotubes elicit varied toxicity and immune responses. Nanoparticle systems such as dendrimer type bio-reducible polymers (PAM-ABP), polymerized siRNA/polyethylenimine complexes, poly(oligo-D-arginine) and hydrogels have been reported as siRNA delivery vehicles and have shown varied gene silencing efficiency and cytotoxicity. A tetrahedral DNA oligonucleotide/siRNA nanoparticle with ˜28.6 nm diameter was recently demonstrated to provide higher than 50% reduction in GFP expression in vitro. When applied in vivo this method showed dose-dependent accumulation of nanoparticles and tumor targeting ability while accomplishing a significant reduction of reporter gene expression in a mouse model.
The present disclosure demonstrates that a functionalized 24 helix bundle scaffolded DNA origami nanostructure of 100 nm×14 nm is capable of penetrating HeLa cell membranes, transporting siRNA cargo inside cells, and effectively silencing gene expression. Importantly, this approach elicits no cytotoxic response and is stable for at least 24 h in cell culture. The implementation of scaffolded nanostructures allows for attachment of up to 158 siRNA duplexes per structure whereas the previously reported oligonucleotide nanostructure was limited to only 6 siRNA duplexes attached to one structure. Thus, the disclosed scaffolded design provides a 26-fold improvement over current DNA nanoparticle-based siRNA approaches at an equal concentration. The present disclosure demonstrates siRNA mediated gene silencing after 24 h equivocal to commercially available Lipofectamine RNAiMax and Xfect transfection reagents using DNA origami nanostructures synthesized in a simple one-pot reaction with reducible siRNAs and widely used cell penetrating peptides or folic acid functionalized on their surface. Extension of this technique to other cell types and adjustments to the identity or density of CPPs on the nanostructure may be able to further enhance its' silencing efficacy.
The denaturation of nucleic acid nanostructures due to depletion of divalent cations and nuclease digestion in biological environments are two major challenges to successful in vitro and in vivo applications. Previous studies have reported contradictory results on the stabilities of DNA nanostructures produced via the origami method in cell culture medium. DNA origami nanostructures exposed to cell lysate were found to remain largely intact, and it has been observed that the sensitivity of nanostructures to cation depletion is design and time dependent. The present disclosure's experimental results demonstrate that the 24 helix bundle DNA origami nanostructure retains its nanostructure integrity and functions in Mg′ depleted media and FBS medium (a blood product known to contain a variety of nucleases), as well as in in vitro cell culture process.
Cellular internalization of foreign materials is commonly accomplished through endocytic pathways which potentially leads to the destruction of the internalized material following fusion with nuclease rich lysosomes. Unmodified DNA origami nanostructures are known to be internalized through these same endocytic pathways which raise the risk of degradation following uptake. To accomplish effective siRNA silencing, siRNA duplexes must evade this nuclease degradation and remain in the cytoplasm to act in silencing pathways. Fortuitously, the fate of assembled DNA origami nanostructures or CPPs following internalization is not important for the effective siRNA delivery. By decorating the DNA origami nanostructures with positively charged CPPs we believe we can introduce, and perhaps favor, non-endocytic direct penetration pathways in addition to the typical endocytic pathway for uptake. At the same time, the presence of strong positively charged peptides on the surface of CPP-DON-siRNA nanostructures can assist in neutralizing the negative charges of the DNA/RNA composition and further promote migration across the cellular membrane into the cytoplasm. Hph-1 and Penetratin conjugated CPP-DON-siRNA structures yielded more internalized fluorescence than MAP conjugated structures which appear be stuck at the cell membrane (As seen in
In a first example nanostructures were prepared by combining 10 nM single-stranded M13mp18 scaffold, 50 nM of each staple oligonucleotide and folding buffer (5 mM Tris pH 8, 1 mM EDTA, 12 mM MgCl2). Complementary functionalized oligonucleotides were included for hybridization with overhanging staple oligos. This allowed for a one-pot assembly of CPP containing structures and provides the ability to control the ratio of CPP/siRNA by controlling the overall ratio of excess functionalized pool. In these experiments, 10 non-conjugated Amino-C6 overhang complements were included for every 1 CPP-conjugated Amino-C6 overhanging complement. One-pot assembly was carried out by rapid heat denaturation to 65° C. followed by slow cooling to 25° C. over 12 h using a thermocycler. To remove free staple oligonucleotides samples were precipitated with an equal volume of 20% (w/v) PEG 8000, 1 M NaCl, 5 mM Tris and 1 mM EDTA followed by conjugation of siRNA duplexes. Assembled structures were suspended in TE pH 8 and analyzed by electrophoresis on a 2% agarose gels (0.5×TBE, 11 mM MgCl2) at 80 V for 3-4 h in an ice-water bath.
The attachment of three independent cell penetrating peptides (Table 1), folic acid and siRNA duplexes was accomplished using crosslinker chemistry to attach each to the 5′ terminus of Amino-C6 modified oligonucleotides. For CPP linkages, Amino-C6 oligonucleotides were incubated in deionized water with 50× Sulfo-SMCC for 30 min at 25° C. and buffer exchanged to remove unreacted Sulfo-SMCC using buffer exchange columns. The column eluate was then mixed in a 1:1 ratio with C-terminal cysteine containing CPPs and reacted overnight at 25° C. resulting in covalently linked CPP-oligonucleotides. For coupling folic acid to linker oligonucleotides, carboxyl containing folic acid was incubated with 10× molar excess EDC and Sulfo-NHS was added at 5 mM final concentration for NHS activation. The reaction was mixed and incubated at 25° C. for 30 min before the pH was raised to pH 7.4 with 2×PBS. Equimolar Amino-C6 linker oligo was added to NHS activated folic acid and reacted overnight at 25° C. Finally, the reaction was quenched with 10 mM hydroxylamine.
siRNA Linkage to CPP-DONs.
Assembled DNA nanostructures were purified by PEG/NaCl precipitation as described above. After removal of excess staple oligonucleotides the assembled nanostructures were incubated with 0.5 mM Sulfo-LC-SPDP for 30 min at 25° C. to activate the Amino-C6 terminated oligo staples. Structures were buffer exchanged through buffer exchange columns into PBS-EDTA and 2× excess siRNA duplexes containing reduced thiol termini were added and incubated overnight at 25° C. for conjugation. The resulting linkage was: oligonucleotide-C6-S-S-siRNA duplex.
For cation depletion experiments DMEM medium containing 0.8 mM Mg2+ was supplemented with 10% FBS and modified to 1 mM, 2 mM, 4 mM, 6 mM, 8 mM and 10 mM Mg2+ by addition of MgCl2 from 1 M stock solution. Each nanostructure was mixed 1:3 with adjusted media and incubated 24 h at 37° C. For serum stability experiments FBS was inactivated at 75° C. for 15 s, 30 s, 60 s, 120 s, 300 s and 600 s. DMEM was supplemented with each inactivated FBS and mixed with nanostructures in a 1:3 ratio and incubated 24 h at 37° C. Analysis of nanostructures after exposure to either cation depletion or inactivated serum was performed by agarose gel electrophoresis through a 2% agarose gel with 11 mM MgCl2 and 0.5×TBE.
To evaluate the relative toxicity of CPP-DON-siRNA mediated delivery to cells we performed a LDH Cytotoxicity Assay. Wells containing 10,000, 20,000, 40,000 and 70,000 HeLa cells were incubated overnight at 37° C., 5% CO2. The following day CPP-DON-siRNA was added at 670 pM. As controls, cells were treated with DNA origami buffer (10 mM Tris pH 8, 1 mM EDTA, 12 mM MgCl2) or assay kit lysis reagent to assess spontaneous and maximum LDH activity, respectively. All assays were performed in triplicate.
All experiments were performed using HeLa Luc-2A-GFP stable cells grown in DMEM complete medium at 37° C. with 5% CO2. Cells between passage 3 and 10 were plated in 24-well tissue culture plates and incubated overnight before treatment. Lipofectamine RNAiMax and siRNA delivery systems were used as commercially available siRNA delivery comparisons following manufacturer's instructions. Assembled CPP-DON-siRNA nanostructures were added to 40,000 cells at 20 nM nanostructure concentration and 2.4 μM siRNA concentration. siRNA duplexes (sense: 5′-AUGCCAAAAACAUUAAGAAdTdT-3′, antisense: 5′-UUCUUAAUGUUUUUGGCAUdTdT-3′) specific to fLuc mRNA were used in silencing studies. All siRNAs were attached to Sulfo-LC-SPDP activated DONs at pyridyl disulfides using a S-SC3 terminal modified sense strand siRNA. 24 h after siRNA delivery, cells were lysed and the fLuc activity was assessed using Firefly Luciferase Glow Assay Kit. Luminescence was normalized for each cell lysate using GFP signal expressed independently of fLuc.
In the preceding examples the disclosed DNA origami nanostructures were used to deliver siRNA for illustrative purposes only. In other examples, other substances may be attached to nucleic acid nanostructures for delivery into cells. Such attached substances may include miRNA, shRNA, asRNA, mRNA, crRNA, tracrRNA and RNA vaccines.
Table 2. List of staple sequences used to fold the 7249 bp long M13mp18 bacteriophage scaffold into the 24 helix bundle nanostructure in some examples. The 158 staples containing overhang sequence (5′-CTCTGGTTAACGTGTCT-3′) for incorporation of CPP and siRNA are shown in bold.
AAAAGAAATCGCCTGATAAATAAAGAATCTCTGGTTAACGTGTCT
AAAAGAGAAAATACTGAGCTACAGGCGAAAAGATTCTCTGGTTAACGTGTCT
AAACGAAGAGAAGTATATCCACCTCAAACATCAATCTCTGGTTAACGTGTCT
AAACGCATACGGTGTCTGGAAGTCAGGACTCTGGTTAACGTGTCT
AAAGCGCCCGCCAGCTCTGGTTAACGTGTCT
AAATTAAGGAAGTTCGTTGCGGTCCACGTAGGAATCTCTGGTTAACGTGTCT
AACATTTACGAGCATACCATTACTTCAAACTCTGGTTAACGTGTCT
AACCAAGTACCGCAATAGCCCGGAATAGTCCTCATTGAGGCACTCTGGTTAACGTGTCT
AACGGGTTCTGTCCATCACGCCTCTGGTTAACGTGTCT
AACTGACGTATTAAACGGGGTCCTCCCTCTCTGGTTAACGTGTCT
AAGCCTGGGTGGTTGAACAACCTCTGGTTAACGTGTCT
AAGTATTTAGTTATAGCTTCTCTGGTTAACGTGTCT
AATCAAACAAAAAGATAACCTCGGAATAAGTAAGCCTCTGGTTAACGTGTCT
ACAAACATACATAATCATAATAAGAAACACGAGCGCTCTGGTTAACGTGTCT
ACAACTAAACAGCTTGATACCCCCACGCCTCTGGTTAACGTGTCT
ACACCGCGCTCAATCGTCTGACTCGTTACTCTGGTTAACGTGTCT
ACACTAAGGAACGGCCAGCCACTAAAGCTTGGATTCTCTGGTTAACGTGTCT
ACCACCATCAAAAATAATTCGAAAGGCTCTCTGGTTAACGTGTCT
ACCCCCACGATTAAACGCTCAAGCCAGCTGGAAGGCTCTGGTTAACGTGTCT
ACCGTTCATGTGTATACCAAATAAGAAACCCAAAACTCTGGTTAACGTGTCT
ACGAGGCGGGGGTAATAGTAAAACAGTTCTCTGGTTAACGTGTCT
ACGTTGTAGCTGGCTCGCCTGAATTACCCTCTGGTTAACGTGTCT
AGATAGCAGCTAAATCGGTTGGGTAAAGCTCTGGTTAACGTGTCT
AGATGATGGCAATTTATCAAACTCTGGTTAACGTGTCT
AGATTAACAATCATTTAATATTGATTGTATCACCTCTCTGGTTAACGTGTCT
AGCATGTGACGCTGTTTTTCACCTGAACCACAATCCTCTGGTTAACGTGTCT
AGCGGGCCTTTGACGATTCACCAGAAGAGTAGATTCTCTGGTTAACGTGTCT
AGGAGGCGCGATTATACCAAACTCTGGTTAACGTGTCT
AGGGCTTACCGGAAATCAATACTCTGGTTAACGTGTCT
AGGGTAGATATATTTTTCTTAATAGATTTATTAATCTCTGGTTAACGTGTCT
AGGTGAACGGTCGCCTCTGGTTAACGTGTCT
AGTAAATTCTATCACTCTGGTTAACGTGTCT
AGTAGATTCGCAGTATGAAATACTCTGGTTAACGTGTCT
ATAAAGCAAAAGCCTTTAATGCTCTGGTTAACGTGTCT
ATAACCGCAACGGCGCCAGCTATTGCCCAGGAATTCTCTGGTTAACGTGTCT
ATCAATTAGGGATAACAAACTAGAGGCGCTCAGCACTCTGGTTAACGTGTCT
ATCAGGTCCTCCGGCTTAGAGCTCTGGTTAACGTGTCT
ATCATGGAAACCAAAATTCGTAAAACTCTCTGGTTAACGTGTCT
ATGGTCAATTAAGACTCTGGTTAACGTGTCT
ATGGTTGGCTAGGGCCGTAAAAAAACCGTGGGCTTCTCTGGTTAACGTGTCT
ATTAATTTTCCCTTTTTAATGAAAAACACAAAAGGCTCTGGTTAACGTGTCT
ATTCAAACAATATGATTCTCCACTCGTAATTTGAGCTCTGGTTAACGTGTCT
ATTGCATAATCAGGAGGCTTTTAACCCTGTTTTTCCTCTGGTTAACGTGTCT
CAACATCAGCTTTCCGGCACTAAATCAAGAATCGCTCTGGTTAACGTGTCT
CAACTTTCCCGATTCGAGAAACTCTGGTTAACGTGTCT
CACAAACTGAGATTCTGGTTTCTCTGGTTAACGTGTCT
CACCACCAATCAGTTCACCGAGGTAAATAATGAAACTCTGGTTAACGTGTCT
CACCACCGATAAGATCAACATATTTTGTAAAGTCACTCTGGTTAACGTGTCT
CACCCTCAGAGCCAATTCCACTGAATCGCGGAACGCTCTGGTTAACGTGTCT
CACTACGTGAGGCCAAACTATTCAATATGATTATCCTCTGGTTAACGTGTCT
CAGAAAACGAAAGAGATACATCATGATTACCGAAGCTCTGGTTAACGTGTCT
CAGAGCCGCCACCCGGTAATATTAAGAACAGTTTGCTCTGGTTAACGTGTCT
CATATATAGAGGGTGCTTTCAGTTTGAGAGCACTACTCTGGTTAACGTGTCT
CATTGACGTACCTTACTAAAGAAGACACGCTAATACTCTGGTTAACGTGTCT
CCAATCAAACAAGAGGAGAAGGAACCCTCTCTGGTTAACGTGTCT
CCACCAGCAGTCACACGACCAGCGTACTCTCTGGTTAACGTGTCT
CCACCCTGAAGTTTGACCATACTCTGGTTAACGTGTCT
CCCAAAAACTCGCGCAGAGGCCTCTGGTTAACGTGTCT
CCGGTTGCATAGCGAATTTCAACGGGAGATGGTTTCTCTGGTTAACGTGTCT
CCTCAAATTTTAATTCGAGCTCTCTGGTTAACGTGTCT
CCTCAGAATGGCTTAGAGCCACTCTGGTTAACGTGTCT
CCTGACTCAGAAGCTCATTTGACCGAGGAGTTACCCTCTGGTTAACGTGTCT
CCTGGCCGGGAAACCTGTCGTTACAGAGCTCTGGTTAACGTGTCT
CCTTTAAAGTATTCAAACAACTCTGGTTAACGTGTCT
CGAACCTTCGGAACGAACGGTATCGGAACGAAAGGCTCTGGTTAACGTGTCT
CGACGGCGGATCCGTTCCCCAGAACCTCTGGTTAACGTGTCT
CGCAACTTCTAGAGAGGAAAAAGGGATTCTCTGGTTAACGTGTCT
CGCCACCGGCCGGACCAGTAGCCAAAGAGGGAAGCCTCTGGTTAACGTGTCT
CGCTGAGTGGAAATACCTACAGCTAAACCTCTGGTTAACGTGTCT
CGGATATATTCAGTTTATTAGCTCTGGTTAACGTGTCT
CGGCAAAATCCCTTCGTTAATCTCTGGTTAACGTGTCT
CGGTCAATCAAGAGGTGTACTTCAGAACCTCTGGTTAACGTGTCT
CGTTTGCGTAGCGCTTTATCCAGAGCCTATCCCAACTCTGGTTAACGTGTCT
CTATTATACAGTGCCCAGAGCCTCTGGTTAACGTGTCT
CTGAGTATAGCTGAGAGCGAGCGAACGTAGAGCCGCTCTGGTTAACGTGTCT
CTGGAGCTCTGAGAGCTGATGGATAACCATAAAAGCTCTGGTTAACGTGTCT
CTTATCCTAATTTAATACCGAGCTATTACTCTGGTTAACGTGTCT
CTTGCCTAATCAACCGGAATTCTCTGGTTAACGTGTCT
CTTTAATACAGTAAAACAAAACTCTGGTTAACGTGTCT
GAAACAGTCAAGAACAGTACCTTAACGTGAACGAACTCTGGTTAACGTGTCT
GAAATTATTCATTAGATTTTTCTCTGGTTAACGTGTCT
GAACAAGTGACGGGGAAGCGCGAAACAAGTTGTTCCTGGCTCCTCTGGTTAACGTGTCT
GAATCAAACCGGAACCGTATATTTAATTACGTCAACTCTGGTTAACGTGTCT
GAATCAGAACGTGGTAGAGCTAGTCCACTACCTTACTCTGGTTAACGTGTCT
GAATTATAATCGTCCCGTGTGCCTTTACATTGAGGCTCTGGTTAACGTGTCT
GACAACAGGACTAATCCAGTCCTGAGAGATGCAGACTCTGGTTAACGTGTCT
GAGAATACTAAAGTCCCTCAGATAGCGTGAATCCCCTCTGGTTAACGTGTCT
GAGGGTAGAACGCGAGAAAACAGAAGAGCTCTGGTTAACGTGTCT
GAGGTGATATTTACATTGGCAGAGCACGCTCTGGTTAACGTGTCT
GATAAAAGATCTACCGTCTGGTGCGGAAGTTATCTCTCTGGTTAACGTGTCT
GATAGGTCCGTCGGATATTCACTCTGGTTAACGTGTCT
GATTCCCGAAAATAAATAATACTCTGGTTAACGTGTCT
GCAAGCGCTCACTGCCCGCTTAGACTTTCTCTGGTTAACGTGTCT
GCAATAGCTATCTTAAGACTCCTCTGGTTAACGTGTCT
GCATTAGTCTTCTGACCTAAAAGAATCCCTCTGGTTAACGTGTCT
GCCCCAGACTCACATTAATTGTCCATTACTCTGGTTAACGTGTCT
GCCGGCGAGCGGGATTTTGACCTGCAACTATCAAACTCTGGTTAACGTGTCT
GCGAAAGTGCAGGGTCAGCTTATAATACTTAAATCCTCTGGTTAACGTGTCT
GCGACATTCAACCGAGAGAGACTCTGGTTAACGTGTCT
GCGAGGCATATTTAAGGCGTTACCTTGCCTCTGGTTAACGTGTCT
GCGGTCAAAGTTTTGGCCCACACACCAGCTCTGGTTAACGTGTCT
GCTAAAGGTGAATTATCACCGAGCGACACTCTGGTTAACGTGTCT
GCTGAAAAAATTAAGCCTCAGGAAAGGCCTCTGGTTAACGTGTCT
GCTTTGAACCATCGGATAGTTCTTTAGGTAACATTCTCTGGTTAACGTGTCT
GGAAGCCCGAGAATTGCCAGAATAGTAAACGGGCACTCTGGTTAACGTGTCT
GGAAGGGTGCTTTCAATGGATGGCGGTCAAACAGACTCTGGTTAACGTGTCT
GGGTACCCGCCATTGTAAACGATGTACCCTCTGGTTAACGTGTCT
GGTATTCCATTTGGGATAGCACTCTGGTTAACGTGTCT
GGTCAGACCAACAGGTTTCATGCAACATCACAAGACTCTGGTTAACGTGTCT
GGTCGACGTTGGGAGTATAAGGAAAAGCCTCTGGTTAACGTGTCT
GTAATGGATCTCCACGGTTTAAGTTAAACTCTGGTTAACGTGTCT
GTTAGAACCTACCAAGTGCCACTCTGGTTAACGTGTCT
GTTGAGTAGTACAACGGAGATATCTTTGCTCTGGTTAACGTGTCT
GTTGGCAGAGTAGAAGAACTCACCGAGTCTCTGGTTAACGTGTCT
TAACGATGAAAGGATCTGCCAGTAGCCAAGCTATTCTCTGGTTAACGTGTCT
TAAGCCCCATACATCTCTGGTTAACGTGTCT
TAAGTTTGTTTTAAATATGCATAATTGCCTCTGGTTAACGTGTCT
TAATCAGAAGGCACCAACCTACTCTGGTTAACGTGTCT
TAATCATTGTGAATTATTAAACTCTGGTTAACGTGTCT
TAATGCATGTAAATGACTACCCTCTGGTTAACGTGTCT
TACATAACGCCAAATTCACCGCTCTGGTTAACGTGTCT
TAGGCCGAGGTGCGCTGGCCTCTGGTTAACGTGTCT
TATAACGAAGAAAGCCCTAAAGACTCCATCAACTTCTCTGGTTAACGTGTCT
TATATTTAAAGCGGCTCTGGTTAACGTGTCT
TATCCCATCCTAATTGACCCTGCAATGCCTCTGGTTAACGTGTCT
TATGTGAAAGAAGAAAACAATAAATTGCTAAAACACTCTGGTTAACGTGTCT
TCAAAGCATTCATTCCAATACTCAACTAAGTTGCACTCTGGTTAACGTGTCT
TCAATAGTGAATTTAGACAAAATTGAGCCACGGAACTCTGGTTAACGTGTCT
TCAGAGACAAATCCAATCGCAATCAAAACTCTGGTTAACGTGTCT
TCATAGGAAACAAGGCTCATTTATTCCTCTGGTCACTCTGGTTAACGTGTCT
TCATTCCAACAGTTACCGGAACTCTGGTTAACGTGTCT
TCCTTTTAGAGCCGAGTCTCTACTAACGCCGAAATCTCTGGTTAACGTGTCT
TCTTTGATGAGGAAGCAAAGAACTCTGGTTAACGTGTCT
TGAGCAAGTGAATAAAATAAGCGTCAAAATTGACGCTCTGGTTAACGTGTCT
TGAGGCTACAGCATGCCAACGCAGTGAGGAGCAACCTCTGGTTAACGTGTCT
TGCTGAAGAACAATATTACCGTACGCCACTCTGGTTAACGTGTCT
TGTCCAGGTGCCGGTCATAGGCTGGTAGTTTTTACTCTGGTTAACGTGTCT
TTAATTATACCTTTTGTTTAGATTATTTAATTTGCCTCTGGTTAACGTGTCT
TTAGACAAACACTCTTGTATCTAGCCCGGACGTTGCTCTGGTTAACGTGTCT
TTAGAGAAGGAGGTTAAAGCCCAGGTAGAAATCCTCTCTGGTTAACGTGTCT
TTAGCAACTCAGAGTTGATGACAGTCAGAGATAGGCTCTGGTTAACGTGTCT
TTAGCCGGCGGGGTATGGCTTCCACCACCTCTGGTTAACGTGTCT
TTCAGGTTTTTACATCGGGAGTGATGAACTCTGGTTAACGTGTCT
TTCATGACCGTTGTAGCAAATCTCTGGTTAACGTGTCT
TTCTGTATCATTTCATTGCTTGCACGTAAGTATTACTCTGGTTAACGTGTCT
TTCTGTATCCGCTCACTAATGAGGTAATGCCTCTGGTTAACGTGTCT
TTGAAAAATAATCACAAATATTGAATAAAGCAAATCTCTGGTTAACGTGTCT
TTGCTGAAAATTCATAATTAACCTCTGGTTAACGTGTCT
TTGCTGATCGCACAATAGGTGAGAGTCTCTGGTTAACGTGTCT
TTTAAAATCAACATTAAATGTTAAATTACTCTGGTTAACGTGTCT
TTTGAGAATTTTTACCTTTATGAAACAATGTTAGCCTCTGGTTAACGTGTCT
TTTGCGGGCCGCCAAGTAAGCAAATCTAATAAATCCTCTGGTTAACGTGTCT
TTTTCATCTGTAGCGGTCATTCTCTGGTTAACGTGTCT
TTTTTAACATTGCCAACGCCAGAAGGAGAGTTGAACTCTGGTTAACGTGTCT
While the disclosure has been illustrated and described in detail in the figures and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only selected embodiments have been shown and described, and that all changes, modifications and equivalents that come within the spirit of the disclosures described heretofore and/or defined by the following claims are desired to be protected, including any variations, uses, or adaptations that follow the general principles herein, and such departures as come within known or customary practice within the art to which the present disclosure pertains. In addition, all publications cited herein are indicative of the level of skill in the art, and are hereby incorporated by reference in their entirety as if each had been individually incorporated by reference and fully set forth.
This application claims priority to PCT Patent Application No. PCT/US17/43027, filed Jul. 20, 2017, which claims benefit of U.S. Provisional Patent Application No. 62/364,427, filed Jul. 20, 2016, which are incorporated by reference herein.
This invention was made with government support under NIH Grant Number 1R43GM113569-01, titled “Functionalized DNA origami nanostructures for siRNA delivery”. The U.S. Government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US17/43027 | 7/20/2017 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62364427 | Jul 2016 | US |