Patent Grant
12060569
The present invention relates to host cells comprising a nucleic acid encoding Adeno-associated virus (AAV) Rep proteins Rep78 and Rep68, wherein the internal AAV promoter p19 has been inactivated by one or more mutations that maintain the functionality of said Rep78 and Rep68 proteins. The present invention further relates to respective nucleic acids and vectors comprising the same, as well as respective methods for the production of AAV.
Recently there has been a rapid increase in the number of gene therapy trials and products based on Adeno-associated virus (AAV)-derived vectors. Advantages of AAV vectors in gene therapy are a good safety profile, the fact that such vectors are not pathogenic, i.e., are not associated with any disease, the stable expression of transgenes, and the possibility of transducing dividing as well as non-dividing cells.
The production of recombinant AAV inter alia requires the expression of AAV Rep and Cap proteins, usually encoded by the AAV genome, for production of recombinant virus supplied in trans. Further, helper genes must be used which can be derived from different helper viruses, the most common being helper virus genes taken from Adenovirus (AV), such as E1A, E1B, E2A, E4orf6, or VA RNA. Furthermore, a transfer vector containing the gene of interest (GOI) is needed.
Current production systems for AAV rely mostly on the following techniques which, however, have several drawbacks. Transient transfection of AAV rep genes, e.g. using a three-plasmid system comprising a transfer vector containing the gene of interest, a plasmid with adenoviral helper functions, and a plasmid supplying the capsid and replicase functions, lacks scalability, robustness, reproducibility, and entails high costs of GMP-grade DNA. Producer cell lines which are mostly based on HeLa cells still need infection with helper virus, thus requiring extensive purification and costly proof of the absence of helper viruses. Inducible expression of AAV rep genes by way of insertion of a stop cassette into the rep locus downstream of the p19 promoter requires the insertion of an artificial intron that contains a stop signal (e.g. SV40 Poly(A)) flanked by two IoxP sites. In addition, cells need the Cre recombinase that recognizes the IoxP sites and excises the stop cassette. This has either to be supplied inducibly or by a modified adenoviral vector, requiring the costly proof of the absence of helper virus. Further, Cre-mediated recombination often shows only a low efficiency.
Accordingly, current AAV production systems are limited with respect to scalability, robustness, reproducibility, ease of use and cost efficiency. Thus, a scalable system for the stable production of AAV vectors that does not require transient transfection or helper virus is highly desirable.
Accordingly, the technical problem underlying the present invention is to provide respective host cells, nucleic acids, vectors and methods constituting such a system.
The solution to the above technical problem is achieved by the embodiments characterized in the claims.
In particular, in a first aspect, the present invention relates to a host cell comprising a nucleic acid encoding Adeno-associated virus (AAV) Rep proteins Rep78 and Rep68, wherein the internal AAV promoter p19 has been inactivated by one or more mutations that maintain the functionality of said Rep78 and Rep68 proteins.
In this context, stable producer cell lines for the production of AAV are difficult to generate, as Rep proteins are toxic for cells. The expression of Rep proteins is regulated by E1A that is also necessary for AAV production. In cell lines such as CAP cells, HEK293 cells or Per.C6 cells, E1A is already constitutively expressed. In total, four Rep proteins exist: two long ones (Rep78, Rep68) which are expressed from the p5 promoter, and two short ones (Rep52, Rep40) which are expressed from the internal p19 promoter that is located within the coding region of the long Rep proteins (see
The p5 promoter can be replaced by an inducible promoter but not the internal p19 promoter which is part of the Rep78 and Rep68 coding region. Thus, the generation of packaging/producer cell lines based on cells constitutively expressing E1A is impossible, since this would result in a constitutive expression of toxic levels of Rep52 and Rep40. Other cell lines not constitutively expressing EA1 need inducible E1A or E1A supply, e.g. by infection with Adenovirus, entailing the drawbacks indicated above.
This problem is advantageously solved by the present invention which is based on the inactivation of the internal AAV p19 promoter by mutations which prevent constitutive Rep52 and Rep40 expression while at the same time maintaining the functionality of said Rep78 and Rep68 proteins.
The terms “Adeno-associated virus” and “AAV” as used herein are not limited to particular AAV serotypes. In this context, it should be noted that AAV Rep proteins are highly conserved among the different AAV serotypes. In particular embodiments, the above terms refer to Adeno-associated virus serotype 2 (AAV2).
The term “maintain the functionality of said Rep78 and Rep68 proteins” as used herein refers to the fact that the mutations according to the present invention do not reduce the functional activity of said proteins, or reduce said activity at most by 30%, preferably at most 25%, at most 20%, at most 15%, at most 12.5%, at most 10%, at most 7.5%, at most 5%, at most 4%, at most 3%, at most 2%, or at most 1%.
In preferred embodiments, the one or more mutations according to the present invention are within at least one of the regulatory sites of the p19 promoter, preferably the SP1 −50 region (nucleotides 817 to 829), the TATA −20 region (nucleotides 843 to 849), or the TATA −35 region (nucleotides 830 to 835). Specifically, said one or more mutations can be within the SP1 −50 region, within the TATA −20 region, within the TATA −35 region, within both the SP1 −50 region and the TATA −20 region, within both the SP1 −50 regions and the TATA −35 region, within both the TATA −20 region and the TATA −35 region, or within all three regions, i.e., in the SP1 −50 region, the TATA −20 region, and the TATA −35 region. In particular, it has been shown in the present invention that even mutation of a single nucleotide within one of said regions advantageously leads to significant reduction of Rep52 and Rep40 expression.
In this context, all nucleotide positions as indicated herein refer to the AAV2 complete genome sequence available under GenBank accession number AF043303. The same applies to all amino acid positions. Further, Table 1 below shows an excerpt of the one-letter nucleotide nomenclature according to IUPAC.
In preferred embodiments, the one or more mutations according to the present invention which inactivate the internal p19 promoter are silent mutations, i.e., mutations that do not alter the encoded amino acid.
Preferably, said one or more mutations comprise at least one mutation, selected from the group consisting of mutations 731C>D, 732A>C, 734A>B, 737T>C, 746A>G, 749C>D, 752G>H, 758G>A, 761G>H, 764G>H, 818G>A, 824G>H, 830T>V, 833T>C, 845T>C, 846T>C, 848A>B or 848A>G, 849A>T, 850G>C, and 851C>D.
In cases where said one or more mutations are within the SP1 −50 region of the p19 promoter, said mutations comprise at least one mutation, selected from the group consisting of mutations 818G>A and 824G>H. In cases wherein said one or more mutations are within the TATA −20 region of the p19 promoter, said mutations comprise at least one mutation, selected from the group consisting of mutations 845T>C, 846T>C, 848A>B or 848A>G, and 849A>T. In cases wherein said one or more mutations are within the TATA −35 region of the p19 promoter, said mutations comprise at least one mutation, selected from the group consisting of mutations 830T>V, and 833T>C.
In preferred embodiments, said one or more mutations comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or all 20 of the above mutations. Accordingly, the host cells of the present invention can comprise a nucleic acid comprising any one, any two, and three, any four, any five, any six, any seven, any eight, any nine, any ten, any eleven, any twelve, any 13, any 14, any 15, any 16, any 17, any 18, any 19, or all 20 of the mutations 731C>D, 732A>C, 734A>B, 737T>C, 746A>G, 749C>D, 752G>H, 758G>A, 761G>H, 764G>H, 818G>A, 824G>H, 830T>V, 833T>C, 845T>C, 846T>C, 848A>B or 848A>G, 849A>T, 850G>C, and 851C>D.
The nucleic acid used in the present invention, encoding Adeno-associated virus (AAV) Rep proteins Rep78 and Rep68, wherein the internal AAV promoter p19 has been inactivated by silent mutations, is preferably a nucleic acid comprising at least one nucleotide sequence, selected from the group consisting of the nucleotide sequences according to SEQ ID NO: 1 to 8, 11 to 14, and 34 to 42. In particularly preferred embodiments, said nucleic acid comprises the nucleotide sequence according to SEQ ID NO: 1, 6, 8, 13, 14, 34 to 39, 41, and 42.
In this context, the term “internal promoter” as used herein indicates the fact that the AAV p19 promoter is located within the coding sequence of Rep78 and Rep68, and forms a part of said coding sequence. Further, the term “inactivated” with respect to the AAV p19 promoter indicates the fact that by way of introducing silent mutations into the AAV p19 promoter region, said promoter has abolished or at least strongly reduced (e.g. reduced by at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) promoter activity.
The nucleotide sequences according to SEQ ID NOs: 1 to 8, 11 to 14, and 34 to 42 represent the AAV p19 promoter region (nucleotides 651 to 1053 of the AAV2 genome), wherein the mutation patterns indicated in Table 2 below are present.
In preferred embodiments, the nucleic acid used in the present invention, encoding Adeno-associated virus (AAV) Rep proteins Rep78 and Rep68, wherein the internal AAV promoter p19 has been inactivated by silent mutations, is preferably a nucleic acid comprising a nucleotide sequence, selected from the group consisting of the nucleotide sequences according to SEQ ID NOs: 15 to 22, 25 to 28, and 43 to 51. In particularly preferred embodiments, said nucleic acid comprises the nucleotide sequence according to SEQ ID NO: 15, 20, 22, 27, 28, 43 to 48, 50, and 51.
The nucleotide sequences according to SEQ ID NOs: 15 to 22, 25 to 28, and 43 to 51 represent the AAV coding region for the Rep proteins Rep78, Rep68, Rep52 and Rep40 (nucleotides 321 to 2252 of the AAV2 genome), wherein the p19 promoter region (nucleotides 651 to 1053 of the AAV2 genome) has been replaced by the mutated p19 promoter region containing the mutations indicated in Table 2 below.
In other preferred embodiments, the one or more mutations according to the present invention which inactivate the internal p19 promoter are mutations that result in one or more conservative amino acid exchanges, i.e., amino acid exchanges that change an amino acid to a different amino acid with similar biochemical properties (e.g. regarding charge, hydrophobicity or size). Preferably, said one or more amino acid exchanges are amino acid exchanges occurring within the class of aliphatic amino acids (Gly, Ala, Val, Leu, lie), within the class of hydroxyl- or sulphur/selenium-containing amino acids (Ser, Cys, Sec, Thr, Met), within the class of basic amino acids (His, Lys, Arg), or within the class of acidic amino acids (Asp, Glu, Asn, GIn).
In particular embodiments, said one or more amino acid exchanges comprise the amino acid exchanges Leu176>Ala and/or Ala168>Gly.
In this respect, the nucleic acid used in the present invention, encoding Adeno-associated virus (AAV) Rep proteins Rep78 and Rep68, wherein the internal AAV promoter p19 has been inactivated by mutations resulting in conservative amino acid exchanges, is preferably a nucleic acid comprising at least one nucleotide sequence, selected from the group consisting of the nucleotide sequences according to SEQ ID NOs: 9 and 10.
In this context, the term “inactivated” with respect to the AAV p19 promoter indicates the fact that by way of introducing mutations resulting in conservative amino acid exchanges into the AAV p19 promoter region, said promoter has abolished or at least strongly reduced (e.g. reduced by at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%) promoter activity.
The nucleotide sequences according to SEQ ID NOs: 9 and 10 represent the AAV p19 promoter region (nucleotides 651 to 1053 of the AAV2 genome), wherein the mutation patterns indicated in Table 3 below are present.
In preferred embodiments, the nucleic acid used in the present invention, encoding Adeno-associated virus (AAV) Rep proteins Rep78 and Rep68, wherein the internal AAV promoter p19 has been inactivated by mutations resulting in conservative amino acid exchanges, is a nucleic acid comprising at least one nucleotide sequence, selected from the group consisting of the nucleotide sequences according to SEQ ID NOs: 23 and 24.
The nucleotide sequences according to SEQ ID NOs: 23 and 24 represent the AAV coding region for the Rep proteins Rep78, Rep68, Rep52 and Rep40 (nucleotides 321 to 2252 of the AAV2 genome), wherein the p19 promoter region (nucleotides 651 to 1053 of the AAV2 genome) has been replaced by the mutated p19 promoter region containing the mutations indicated in Table 3 below.
The nucleic acid comprised in the host cell of the present invention can further comprise at least one element, selected from the group consisting of inducible promoters, poly(A) regions, selection markers, IRES sequences and enhancing elements. Suitable inducible promoters are not particularly limited and are known in the art, e.g. Tet-inducible promoters such as the third generation TRE3G-promoter. Suitable poly(A) regions are not particularly limited and are known in the art, e.g. the SV40 poly(A) region. Suitable selection markers are not particularly limited and are known in the art, e.g. antibiotic resistance cassettes such as blasticidin or ampicillin resistance cassettes.
The present invention also relates to host cells comprising a nucleic acid having at least 70% sequence identity to a nucleic acid as defined above, provided that the specific mutations defined above are present. In this context, the term “provided that the specific mutations defined above are present” refers to the following situations (i) to (xxiii):
Preferably, said nucleic acids have at least 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 86%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.2%, 98.4%, 98.6%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity to a nucleic acid as defined above. In particular embodiments, such nucleic acids have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotide deletions, insertions or replacements (exchanges).
Respective nucleic acids having a defined sequence identity to a nucleic acid as defined above or having specific nucleotide deletions, insertions or replacements with respect to a nucleic acid as defined above exclude any nucleic acids having any kind of frameshift mutation, as well as any nucleic acids encoding non-functional Rep78 and Rep68 proteins, i.e., said nucleic acids still encode functional Rep78 and Rep68 proteins.
In preferred embodiments, the nucleic acid comprised in the host cells of the present invention is stably integrated into the host cell genome. In other preferred embodiments, the nucleic acid comprised in the host cells of the present invention is comprised in a vector, i.e., is part of a vector. Said vector is preferably a vector selected from the group consisting of plasmid vectors, viral vectors, cosmid vectors, and artificial chromosome vectors. Preferably said vector is an expression vector.
According to the present invention, the internal AAV p19 promoter is inactivated by introduction of silent mutations or mutations resulting in conservative amino acid exchanges. In this manner, a nucleic acid encoding Rep78 and Rep68 can be placed under the control of an inducible promoter, wherein no constitutive expression of Rep52 and Rep40 occurs. However, since production of AAV requires all four Rep proteins, an additional nucleic acid encoding Rep52 and Rep40 can be placed under the control of the same promoter, an identical promoter or a different promoter. Thus, in specific embodiments, the host cell of the present invention further comprises a nucleic acid encoding AAV Rep proteins Rep52 and Rep40 under the control of an inducible promoter. This nucleic acid can be part of the vector as defined above, or of the nucleic acid encoding Rep78 and Rep68.
Host cells suitable for the present invention are not particularly limited and are known in the art. Preferably, said host cells display constitutive E1A expression. In preferred embodiments, said host cells are CAP cells, HEK293 cells or Per.C6 cells, i.e., are derived from said cell lines.
Methods for generating the host cells of the present invention, i.e., methods for the introduction of the nucleic acids of the present invention into suitable host cells, are not particularly limited and are known in the art. The same applies to methods for the generation of the nucleic acids and vectors of the present invention.
In a second aspect, the present invention relates to the nucleic acids and vectors as defined above.
In a third aspect, the present invention relates to a method for the production of Adeno-associated virus (AAV), comprising the step of recombinantly expressing AAV Rep proteins Rep78 and Rep68 in a host cell according to the present invention.
Respective methods for generating the necessary nucleic acids, vectors, and/or host cells, as well as respective expression methods, are not particularly limited and are known in the art.
Preferably, the method of the present invention further comprises the step of recombinantly expressing AAV Rep proteins Rep52 and Rep40 in said host cells.
As used herein, the term “comprising”/“comprises” expressly includes the terms “consisting essentially of”/“consists essentially of” and “consisting of”/“consists of”, i.e., all of said terms are interchangeable with each other.
According to the present invention, host cells are provided that can express AAV Rep proteins Rep78 and Rep68 without constitutive expression of Rep52 and Rep40. This is achieved by providing nucleic acids wherein the internal AAV p19 promoter region is inactivated by introducing specific mutations.
Promoters are activated by binding of specific transcription factors and basal transcription complex; these factors recognize specific binding sites within the promoter region that have previously been described for the p19 promoter. Mutating these binding sites abolishes activation of the promoter. Since the integrity of the long Rep proteins has to be maintained, mutations are chosen that do alter the nucleotide sequence but within the genetic code encode the same amino acid and, therefore, result in formation of the same protein (silent mutations), or mutations are chosen that alter the nucleotide sequence resulting in conservative amino acid exchanges.
After introducing the above mutations, it is possible to separate the expression units for long and short Rep proteins: The expression cassette for the long Rep proteins contains the mutated p19 promoter with said mutations. The isolated expression unit for the short Rep proteins starts downstream of the p19 promoter with the start codon. Expression of both expression units can then be placed under regulation of an inducible promoter (as e.g. Tet inducible promoters). Based on this, a stable packaging/producer cell line can be generated.
The host cells, nucleic acids, vectors, and methods of the present invention represent a system for the production of AAV that is advantageously characterized by superior reproducibility, ensuring consistent quality, scalability, and cost efficiency, which does not need the use of helper virus.
The figures show:
Schematic overview of the rep locus.
Schematic overview of expression construct for inducible Rep proteins.
Overview of analyzed mutation patterns with SEQ ID NOs. of the corresponding AAV2 Rep proteins coding region (cf. also Table 2). The indication “SEQ-ID” in
Expression of different Rep proteins in CAP cells upon transfection with different constructs containing silent mutations within the regulatory sequences of the p19 promoter (Table 2) and the wildtype construct (wt). Protein levels were detected in cell lysates of transiently transfected CAP-T cells 72 h post transfection using anti-replicase antibody (Progen). As control, cell lysate of non-transfected cells was included (BI). The indication of “ID” numbers in
Quantification of anti-Rep western blots. Rep protein bands were quantified by densitometric analysis using ImageJ. Ratio of long to short Rep protein bands was calculated and wt was set to 1. All other values were normalized to wt. The indication of “ID” numbers in
Inducible expression of the Rep proteins in a stable CAP derived cell line upon induction with 1 μg/mL doxycycline. Rep proteins were detected by immunoblot with anti-Replicase antibody (Progen). As control, cell lysate of non-induced cells was loaded (−Dox). At ˜80 kDa, an unspecific background band is detected.
Induction of Rep proteins by addition of 1 μg/mL doxycycline in single cell clones derived from the stable cell line. Cells were transiently transfected with necessary components for rAAV5 production and induced with 1 μg/mL doxycycline 5 h after transfection. 72 h post transfection, cell lysates were prepared and expression of Rep proteins was detected by immunoblot with anti-Replicase antibody (Progen). The clones 5B6 and 2E3 do express very low levels of the long Rep proteins.
Viral titers of rAAV5 production by inducible Rep expressing clones. Viral genomes/mL were measured by qPCR with a primer/probe combination detecting the CMV-promoter using linearized transfer plasmid as standard. The single cell clones 5B6 and 2E3 do not show clear expression of long and short Rep proteins and therefore, do also only produce very low titers of rAAV5.
(A & B): Expression of different Rep proteins in CAP cells upon transfection with different constructs containing mutations within the regulatory sequences of the p19 promoter (Table 3) resulting in conservative amino acid exchanges and the wildtype construct (wt). Protein levels were detected in cell lysates of transiently transfected CAP-T cells 72 h post transfection using anti-replicase antibody (Progen). As control, cell lysate of non-transfected cells was included (BI).
(C): Viral production upon transfection of CAP cells with the following construct combination: pStbl-Rep-p19mut-ID 47, 48 or 37 or wt, pStbl-TRE3G-Rep50/42, pCMV-Tet3G, pHelper, pStbl-CMV-Cap5, pAAV-GFP. Viral genomes/mL were measured by qPCR with a primer/probe combination detecting the SV40 PolyA using linearized transfer plasmid as standard.
The indication of “ID” numbers in
The present invention will be further illustrated in the following examples without being limited thereto.
Cloning of Expression Constructs.
Synthesis of the rep locus of AAV2 with Hpal restriction sites at each end and regulatory sites within the p19 promoter. The genomic sequence of AAV2 was derived from GenBank: AF043303 (nucleotides 162 to 2332). The sequence of the synthetic locus is shown in SEQ ID NO: 29.
Different constructs for the p19 promoter region (nucleotides 651 to 1053 of the AAV2 genome) were designed containing different numbers of silent mutations within the regulatory sequences (Table 2) and produced synthetically.
Respective expression constructs were produced by standard cloning techniques and verified by sequencing. Components of the final expression constructs pStbl-bsd-Rep, pStbl-bsd-Rep-p19mut-SEQ ID NO: 1-14, 34-42 were the p5 promoter, the Rep locus containing either mutated or wt p19 promoter, a SV40 poly(A), a blasticidin selection cassette under the control of human Ubc promoter, an enhancing element for stable transcription of integrated ORFs, a pUC on for propagation in E. coli, and an ampicillin resistance cassette for selection in E. coli.
A construct placing the Rep proteins under the control of a Tet-inducible promoter of the third generation (TRE3G-promoter) (
Cell Culture.
CAP cells were routinely cultivated in chemically defined, serum-free PEM medium (Thermo Fisher Scientific) supplemented with 4 mM L-alanyl-L-glutamine (Biochrom, Germany) in shake flasks (125 mL; Corning) on a shaking incubator at 185 rpm (5 cm orbit), 5% CO2 and 37° C.
During routine cultivation, cells were diluted with fresh medium to a viable cell density of 1×106 cells/ml every 72 to 96 h. Viable cell density and viability were determined by trypan blue exclusion using a CEDEX XS cell counter (Innovatis, Roche Applied Science). Stable cell line expressing the Tet-on-3G-activator was cultivated in presence of 25 μg/mL G418; upon nucleofection with the pStbl-bsd-TRE3G-Rep50/42-IRES-Rep78/68 5 μg/mL blasticidin were added.
Transient Transfection and Western Blot to Test for Rep Protein Expression.
Transient transfection was performed using PEImax (PolySciences) in FreeStyle 293 medium (Thermo Fisher Scientific). 5 h post transfection, cells were fed with complete PEM medium (Thermo Fisher Scientific). An overview of generated transient transfection pools is found in Table 4, below.
Western Blot analysis was performed with cell lysates from 1×105 transfected cells utilizing mouse-anti-Replicase antibody (Progen, Germany) and horseradish peroxidase labeled anti-mouse antibody (Cell Signaling). Proteins were detected using the Pierce ECL WB Substrate Kit via chemiluminescence detector (INTAS).
Nucleofection and Generation of Stable Pools.
Induction and Transient Transfection to Test for AAV Production.
To test for AAV production by the stable single cell clones with inducible Rep expression, transient transfections were performed as described before. The following three constructs were used to provide the additional components for production of rAAV5 in a ratio of 1:1:0.5 (pAAV-GFP: pHelper: pStbl-CMV-Cap5). 5 h post transfection, a final concentration of 1 μg/mL doxycycline (Clontech) was added to induce expression of the Rep proteins.
72 h post transfection, cell suspension was harvested. Cells were lysed by addition of 0.5% Triton-X and incubation for 30 min at 37° C. with 1300 rpm. After centrifugation, supernatants were diluted 10-fold with buffer (50 mM Tris/HCl, pH 8.0; 2 mM MgCl2) and incubated with 125 U/mL benzonase (Merck Millipore) for 2 h at 37° C. Addition of 2 mM EDTA and incubation at 70° C. for 10 min was used to inactivate the benzonase. Viral DNA was purified via the Pure Link Viral RNA/DNA mini kit (Thermo Fisher Scientific) according to the manufacturer's instructions.
qPCR to Determine Viral Titer.
The following primer/dual-labelled probe combination (ordered at MWG, Eurofins; Table 5) directed against the CMV promoter or the SV40 poly A were used to measure the viral titer:
As standard, linearized transgene plasmid with a defined copy number was used. The qPCR reaction contained the following components: 2×Brilliant Multiplex qPCR Master Mix (Agilent), nuclease-free H2O (Thermo Fisher Scientific), primer/probe mix and sample/standard. qPCR was run on an Agilent Mx3005P according to the manufacturer's instructions.
Effects of Silent Mutations on Expression of REP Proteins.
Introduction
CAP cells are human amniocyte-derived suspension cells, which have been immortalized by stable transfection with a construct encoding E1A/E1 B.
AAV Rep proteins are encoded by the AAV genome. There are in total four Rep proteins: Rep78 and Rep68 (expressed from p5 promoter); as well as Rep52 and Rep40 (expressed from p19 promoter located within coding region of long Rep proteins). These proteins mediate the replication and packaging of the AAV genome. However, said proteins are toxic for cells when stably expressed.
For the inactivation of the internal p19 promoter by introduction of silent mutations, regulatory elements of the p19 promoter were identified and different silent mutations not affecting the final protein sequence were inserted into the nucleotide sequence of these regulatory elements.
Results:
Expression of long and short Rep proteins was successfully separated by introducing silent mutations in the regulatory sequences of the p19 promoter. Most versions with mutations showed significantly reduced expression of the short Rep proteins. The reduction in expression of the short Rep proteins was already visible upon introducing one single mutation becoming more pronounced when introducing up to 20 mutations (
To generate a stable cell line inducibly expressing Rep proteins, the genes for the long Rep proteins carrying the silent mutations and the genes for the short Rep proteins were separated and each put under control of an inducible promoter. For the further experiments, the p19mut construct with the 19 mutations was chosen.
Generation of Stable CAP Clones Inducibly Expressing Rep Proteins of AAV2.
Introduction
For the generation of an inducible expression cassette for AAV2 Rep proteins the p19mut variant with 19 silent mutations was selected.
Tet-inducible promoters of the third generation (TRE3G-promoter) were used to regulate expression of the Rep proteins by doxycycline addition (overview of construct see
Results:
A stable CAP cell pool carrying the Tet-on-3G transactivator and the pStbl-bsd-TRE3G-Rep52/40-IRES-Rep78/68 was analyzed by Western blot for expression of the different rep protein before and after induction with doxycyclin (
From the stable pool, single cell-derived clones were generated by limiting dilution. The single cell-derived clones were analyzed for expression of the Rep proteins after Doxycyclin induction. Out of 5 clones, 3 clones expressed both the long and the short Rep proteins in the expected ratio, whereas 2 of the clones displayed reduced levels of the long Rep proteins (
The data shows that using rep constructs with silent mutations in the p19 promoter, clonal cell populations with inducible expression of both long and short Rep proteins can be generated. Such clones can serve as a basis for the generation of packaging/producer cell lines.
Production of AAV in Stable CAP Clones Inducibly Expressing Rep Proteins of AAV2.
Introduction
To proof that the inducible Rep cell lines are capable of producing AAV vectors, the missing components for AAV production were transiently introduced into cells of the 5 different clones:
Capsid proteins from AAV5, cloned under control of CMV promoter in pStbl vector, the additional helper genes E2A, E4orf6, VA RNA, as well as the transfer vector with gene of interest (GOI): pAAV-GFP.
Results:
Using single cell clones of the stable Rep inducible expressing cell line, AAV production could be shown upon transfecting the cells with the lacking necessary components and doxycycline induction (
AAV Production Using Rep Proteins with Conservative Amino Acid Exchange
For the inactivation of the internal p19 promoter by introduction of mutations in the promoter regions resulting in conservative amino acid exchanges, regulatory elements of the p19 promoter were identified. Three distinct mutations, 846T>G, 847T>C, 848A>B, were inserted into the nucleotide sequence of the TATA −20 region resulting in a conservative Leu176>Ala exchange (ID23). Two distinct mutations, 823C>G, 824G>H, were inserted into the nucleotide sequence of the SP1 −50 region resulting in a conservative Ala168>Gly exchange (ID24). The different constructs were transiently introduced into CAP-T cells and the expression level of the long and short Rep proteins was analyzed and compared to the wt and mut-20 (ID28) (
To proof the functionality of the long rep proteins with conservative amino acid exchanges in the TATA −20 or the SP1 −50 region, AAV was produced by introducing the following construct combination transiently into the CAP-T cells: a construct coding for the long Rep proteins, either pStbl-Rep-p19mut-ID23, or -ID24, or -mut20, or -wt, together with the a construct encoding for the short Rep proteins (pStbl-TRE3G-Rep 50/42), pCMV-Tet3G, and the additional helper genes E2A, E4orf6, VA RNA, as well as the transfer vector with gene of interest (GOI), pAAV-GFP (
Results:
Western blot analysis revealed that the expression of long and short Rep proteins was successfully separated by introducing distinct mutations in the regulatory sequences of the p19 promoter resulting in conservative aa exchanges either in the SP1 −50 or in the TATA −20 region.
As before the mutation in the SP1 −50 region had a more pronounced effect that the introduced mutations in the TATA −20 box, confirming the important role of SP1 −50 (
Importantly the functionality of the long Rep proteins harboring the Leu176>Ala (ID23) or Ala168>Gly (ID24) exchange could be proven by the production of AAV particle via transient production. The titer of the AAV particle produced with the Rep proteins harboring the conservative amino acid exchange are in the same range as the wt or the mut-20 control, with some reduction of the AAV titer in the ID24 sample (
The present invention relates to the following nucleotide sequences.
GT
H
GATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAATGGGCH
TGGACVAACATGGAACAGTACTTGTCDGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAATATGGAACAGTACTTGTCDGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAATATGGAACAGTATTTGAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAATATGGAACAGTATTTATCCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAATATGGAACAGTACTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GT
H
GATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAATGGGCH
TGGACVAACATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GT
H
GATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAATGGGCH
TGGACVAACATGGAACAGTACCTBTCDGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAATATGGAACAGTATGCBAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGGH
TGGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAATATGGAACAGTATCTBAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAATATGGAACAGTATCTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAATATGGAACAGTACCTBTCCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GT
H
GATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAATGGGCH
TGGACVAACATGGAACAGTACCTBTCDGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTTAACTGACGTGAATTACGTCATAGGGTTAGGGAGGTCCTGTATTAGAGGTCACGTGAGTGT
AAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTGGCGCAGCATCTGACGCACGTGTC
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAATGGGCH
TGGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACVAACATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAATGGGCG
TGGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCH
TGGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACVAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACTAACATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAATGGGCH
TGGACVAACATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAATGGGCH
TGGACTAATATGGAACAGTACCTBTCDGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
GTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCG
TGGACVAACATGGAACAGTACCTBTCDGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTG
| Number | Date | Country | Kind |
|---|---|---|---|
| 17001562 | Sep 2017 | EP | regional |
| Number | Name | Date | Kind |
|---|---|---|---|
| 20020127582 | Atkinson et al. | Sep 2002 | A1 |
| 20140242671 | Grieger | Aug 2014 | A1 |
| Number | Date | Country |
|---|---|---|
| WO 03104392 | Dec 2003 | WO |
| WO 2020154607 | Jul 2020 | WO |
| WO 2020223274 | Nov 2020 | WO |
| Entry |
|---|
| Chejanovsky et al., Mutagenesis of an AUG codon in the adeno-associated virus rep gene, effects on viral DNA replication, 1989, Virol. vol. 173, pp. 120-128. |
| Lackner et al., Studies of the mechanism of transactivation of the adeno-associated virus p19 promoter by the Rep protein, 2002, J. Virol. vol. 76, pp. 8225-8235. |
| McCarty et al., Sequences required for coordinate induction of adeno-associated virus P19 and P40 proimoters by Rep protein, 1991, Database Biosis Prev199192028340. |
| Niimi et al., High expression of N-acetylglucosaminetransferase IVa promotes invasion of choriocarcinoma, 2012, Brit. J. Cancer vol. 107, pp. 1969-1977. |
| Zhang et al., Relations of the type and branch of surface N-glycans to cell adhesion, migration, and integrin expression, 2004, Molc Cell Biol vol. 260, pp. 137-146. |
| Korean Office Action from corresponding KR Application No. 10-2020-7006686, mailed Jan. 25, 2024, 15 pages. |
| Sirkka R. M. Kyostio et al., “Analysis of Adeno-Associated Virus (AAV) Wild-Type and Mutant Rep Proteins for Their Abilities To Negatively Regulate AAV P5 and P19 mRNA Levels”, Journal of Virology, May 1994, pp. 2947-2957, 11 pages. |
| Number | Date | Country | |
|---|---|---|---|
| 20230348936 A1 | Nov 2023 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 16646741 | US | |
| Child | 18301818 | US |
