This disclosure was made with the support of the Ministry of Science and ICT, Republic of Korea, under Project No. 1711079098, which was conducted by the Institute for Basic Science in the research project named “Regulatory RNAs in Cell Fate Decision” under management of the Institute for Basic Science for the project named “Support for research and operation expenses of the Institute of Basic Science”, from Jan. 1, 2018 to Dec. 31, 2018.
This application claims priority to and the benefits of Korean Patent Application No. 10-2019-0064129 filed on May 30, 2019 in the Korean Intellectual Property Office, the contents of which are incorporated herein in their entireties by reference.
The present disclosure relates to a technology for preventing or treating viral infections and infection symptoms by inducing mixed tailing to viral RNA.
Hepatitis B is a viral disease transmitted by parenteral exposure to infectious matters such as blood, blood products, contaminated needles, etc., by sexual contact with infected carriers, and by vertical transmission from mother to child during childbirth. According to the World Health Organization, more than 2 billion people have been infected worldwide while about 4 million cases of acute hepatitis B occurred each year, with one million people dying every year due to the infection. An estimated 350-400 million people are chronic media (World Health Organization: Geographic Prevalence of Hepatitis B Prevalence, 2004. www.who.int/vaccines-surveillance/graphics/htmls/hepbprev.htm).
Hepatitis B virus (HBV) is hepatotropic virus with double-stranded DNA and infects only humans and non-human primates. Viral replication occurs mainly in the liver, and to lesser extents in the kidney, pancreas, bone marrow, and spleen (Hepatitis B virus biology. Microbiol Mol Biol Rev. 64: 2000; 51-68.). Viral and immune markers can be detected in blood, and characteristic antigen-antibody patterns evolve with time. The first detectable viral marker is HBsAg, followed by hepatitis B e antigen (HBeAg) and HBV DNA. During the incubation period, the titer may be high, but HBV DNA and HBeAg levels begin to decline at the onset of the disease and may be undetectable at the clinical peak of the disease (Hepatitis B virus infection natural history and clinical consequences. N Engl J Med. 350: 2004; 1118-1129). HBeAg is a viral marker detectable in blood and is associated with active viral replication, and thus, the viral load and infectivity are high (Hepatitis B virus e antigen the dangerous end game of hepatitis B virus. N Engl J Med. 347: 2002; 208-210). The presence of anti-HBsAb and anti-HBcAb (IgG) accounts for the recovery and immunity in already infected individuals.
At present, for adults with chronic HBV infection, the American Association for the Study of Liver Diseases (AASLD) and the European Association for the Study of the Liver (EASL) recommend as the first-line therapy interferon alpha (IFNα), pegylated interferon alpha-2a (Peg-IFN2a), entecavir, and tenofovir. Nucleoside and nucleotide therapies, entecavir, and tenofovir succeed in reducing viral loads, but exhibit seroconversion and HBsAg loss at much lower levels, compared to IFNα therapy. Other similar therapies including lamivudine (3TC), telbivudine (LdT), and adefovir are also utilized, but as for nucleoside/nucleotide therapies, their therapeutic effects are generally limited by the resistance generation.
Therefore, there is a need for finding and developing a novel anti-viral therapy in the field.
Human cytomegalovirus, a member of the viral family Herpesviridae, is a widespread pathogen. The virus consists of a capsid containing linear double-stranded deoxyribonucleic acid (DNA), surrounded by tegument and enclosed by envelop consisting of a lipid bilayer with glycoproteins spiked thereon. Like other members of the family, HCMV possesses the feature of latency and reactivation. HCMV has the ability to infect many cells and remain latent therein.
In immunocompetent hosts, most HCMV infections are asymptomatic or very mild with a little non-specific symptom, for example, slight increases in fatigue, boredom, moderate fever, lymphadenopathy, hepatomegaly, or liver enzymes. However, heterophile-negative mononucleosis is observed in approximately 10% of individuals healthy previously.
For the therapy of HCMV, a new strategy is also required.
Leading to the present disclosure, inventive and thorough research conducted by the present inventors resulted in the finding that TENT4A/B are responsible for mixed tailing of viral RNA, more specifically, mRNA and are helpful for inhibiting mRNA degradation in host cells and that downregulation of the expression and activity of TENT4A/B in host cells of a subject inhibits the mixed tailing to promote the deadenylation of viral RNA, with the consequent rapid degradation of viral RNA.
Therefore, an aspect of the present disclosure is to provide a pharmaceutical composition for prevention of viral infection or treatment of viral infection symptoms.
Another aspect of the present disclosure is to provide a method for screening a pharmaceutical composition for prevention of viral infection or treatment of viral infection symptoms.
Another aspect of the present disclosure is to provide a method for preparation of a virus-resistant cell.
Another aspect of the present disclosure is to provide a method for stabilization of RNA sequences.
According to an aspect thereof, the present disclosure provides a pharmaceutical composition for prevention of viral infection or treatment of viral infection symptoms, the composition comprising an inhibitor against at least one of TENT4A and TENT4B, both responsible for mixed tailing of viral RNA, wherein the inhibitor is siRNA or shRNA inhibiting expression of at least one of TENT4A and TENT4B, or an antibody or antigen binding fragment thereof inhibiting activity of at least one of TENT4A and TENT4B.
The present inventors discovered that TENT4A/B are involved in mixed tailing of viral RNA, especially mRNA, to help inhibit the degradation of mRNA in host cells and found that downregulation of the expression and activity of TENT4A/B in host cells of a subject inhibits the mixed tailing to promote the deadenylation of viral RNA, with the consequent rapid degradation of viral RNA.
RNA tailing (non-templated nucleotide addition to the 3′ end) is the most widespread and conserved type of RNA modification. Noncanonical poly(A) polymerases, also known as terminal nucleotidyltransferases (TENTs), post-transcriptionally incorporate nucleotides to the 3′ end of RNAs to regulate their maturation, stability and activity. Previously, the present inventors developed a method called TAIL-seq to explore the RNA 3′ extremity and measure the poly(A) tail length. From TAIL-seq experiments, noncanonical tailing events such as uridylation and guanylation on vertebrate mRNAs were found. Terminal uridylyltransferases (TUT4 and TUT7) uridylate deadenylated poly(A) tails (shorter than ˜25 nucleotides) after PABPC is removed. U tails, especially oligo-U tails, facilitate mRNA decay. In contrast, guanylation occurs on long poly(A) tails and protects mRNAs from rapid deadenylation. Two related enzymes TENT4A (also known as PAPD7 or TUT5) and TENT4B (also known as PAPD5 or TUT3) extend mRNA poly(A) tails with intermittent nonadenosine residues (most commonly guanosine) to generate “mixed tails”. This non-pure poly(A) tail impedes deadenylation by the CCR4-NOT (CNOT) complex and enhances the stability of the mRNA. Mixed tailing was proposed to serve as a new type of post-transcriptional regulation.
As used herein, the term “mixed tailing” refers to substitution of guanine or uridine for at least one residue on the poly(A) tail of viral RNA, more specifically viral mRNA by guanylation or uridylation. Herein, the term “mixed tailing” may be simply written as “mix tailing”, “tailing”, etc. When guanylation or uridylation occurs thereon, the poly(A) tail sequence of viral RNA is protected from deadenylation, with the resultant delay of mRNA decay.
It was first discovered in the present disclosure that TENT4A and TENT4B, which are noncanonical poly(A) polymerases belonging to a family of terminal nucleotidyltransferases, are involved in mixed tailing of the poly(A) tail of viral mRNA.
In an embodiment of the present disclosure, TENT4A and TENT4B of the present disclosure is derived from a subject which is at risk of viral infection or has been infected with virus. The present inventors investigated that after infecting a subject, the viral mRNA can be induced to undergo mixed tailing by the TENT4A and TENT4B derived from the subject.
In an embodiment of the present disclosure, the virus of the present disclosure is a virus which undergoes the RNA tailing induced by at least one of TENT4A and TENT4B. In greater detail, the present inventors founds that the post-transcriptional regulatory element (PRE), specifically the CNGGN-type pentaloop, is critical for TENT4A/B-dependent regulation. In addition, the present inventors revealed that both HBV and HCMV act in similar manners of using pentaloop to recruit TENT4A/B which in turn induces mixed tailing. The two distinct viruses HBV and HCMV (one belonging to Hepadnaviridae and the other to Herpesviridae) with very different life cycles and tissue specificity employ an identical strategy for the benefit of their gene expression, and this convergent evolution and the simplicity of this cis-acting element intimate that this mechanism may be used by other viruses as well.
In an embodiment of the present disclosure, the virus of the present disclosure is a virus belonging to the family Hepadnaviridae or Herpesviridae.
In an embodiment of the present disclosure, the virus belonging to the family Hepadnaviridae according to the present disclosure is any one selected from the group consisting of hepatitis B virus, ground squirrel hepatitis B virus, woodchuck hepatitis B virus, duck hepatitis B virus, and heron hepatitis B virus.
In an embodiment of the present disclosure, the virus belonging to the family Herpesviridae is any one selected from the group consisting of Iltovirus, Mardivirus, Scutavirus, Simplexvirus, Varicellovirus, Cytomegalovirus, Muromegalovirus, Proboscivirus, Roseolovirus, Lymphocryptovirus, Macavirus, Percavirus, and Rhadinovirus.
As used herein, the term “siRNA” refers to a short double-stranded RNA capable of inducing the RNAi (RNA interference) phenomenon by cleaving a specific mRNA. It may consist of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto. Because the siRNA can inhibit the expression of the target gene, it can be provided as an effective tool for gene knockdown or gene therapy.
The double-stranded RNA portions of siRNAs in which two RNA strands pair up are not limited to the completely paired ones, and may contain nonpairing portions due to mismatch (the corresponding nucleotides are not complementary), bulge (lacking in the corresponding complementary nucleotide on one strand), and the like. siRNA is 10 to 100 base pairs, particularly 15 to 80 base pairs, and more particularly 20 to 70 base pairs in total length. The terminal structure of siRNA may be either blunt or cohesive as long as siRNA enables to silence the target gene expression due to its RNAi effect. As the cohesive terminal structure, both 3′ overhang and 5′ overhang structures are possible, with no limitations imparted to the number of overhang nucleotides. In addition, so long as siRNA is able to maintain its gene silencing effect on the target gene, siRNA may contain a low molecular weight RNA (which may be a natural RNA molecule such as tRNA, rRNA or viral RNA, or an artificial RNA molecule), for example, in the overhanging portion at its one end. The terminal structure of the siRNA is not necessarily a cut off structure at both ends and may have a stem-loop structure in which ends of one side of double-stranded RNA are connected by a linker RNA.
The siRNA may be a complete form having a polynucleotide pairing, i.e., a form in which siRNA is synthesized directly in vitro and then introduced into cells through a transformation process, or a form in which a single-chain polynucleotide and its reverse complement can be induced from a single-chain oligonucleotide fragment separated by a spacer after being administered in vivo, for example, a form in which a siRNA expression vector or a PCR-induced siRNA expression cassette is transformed or transfected into cells so that the siRNA is expressed in the cells. The determination of methods for preparing siRNA and introducing siRNA into cells or animals may be dependent on cell biological functions of object or target gene products.
The term “shRNA”, as used herein, is intended to overcome the disadvantages of the siRNA, i.e., high cost of biosynthesis, short-term maintenance of RNA interference effect due to low cell transfection efficiency, etc. It may be expressed after being introduced into cells from a promoter of RNA polymerase III using an adenovirus, lentivirus or plasmid expression vector system. The shRNA may induce silencing of a target gene after being converted to a siRNA with an accurate structure by a siRNA-processing enzyme (Dicer or RNase III) existing in cells.
In an embodiment of the present disclosure, the siRNA of the present disclosure is exemplarily given in Table 1, but is not limited thereto.
The antibody of the present disclosure, which inhibits the activity of at least one of TENT4A and TENT4B, is intended to encompass a monoclonal antibody and a chimeric antibody thereof, a humanized antibody, and a human antibody and may include antibodies already known in the art as well as novel antibodies. The antibody may be in an intact full-length antibody having two heavy chains and two light chains or a functional fragment of the antibody molecule, as long as it binds specifically to TENT4A and/or TENT4B. The functional fragment of the antibody molecule refers to a fragment possessing at least an antigen-binding function, and may be Fab, F(ab′), F(ab′)2, or Fv.
In the following Examples of the present disclosure, the following antibodies were employed, but with no limitations thereto:
Anti-TENT4A antibody (Invitrogen, PA5-61302), anti-TENT4A antibody (Atlas Antibodies, HPA045487), anti-TENT4A mouse antibody (labmade), anti-TENT4B antibody (invitrogen, PA5-60177), anti-TENT4B antibody (Atlas Antibodies, HPA042968), anti-TENT4B mouse antibody (labmade).
When the composition of the present disclosure is used as a pharmaceutical composition, the content of the active ingredient in the composition may be appropriately adjusted depending on symptoms of the disease, progression of the symptoms, conditions of the patient, etc. For example, it may be contained in an amount of 0.0001 to 99.9% by weight, based on the total weight of the composition, but with no limitations thereto. The content ratio is on the basis of the dry mass resulting from solvent removal.
The pharmaceutical composition may contain a suitable carrier, excipient, and diluent typically used for preparing adequate administration formulations. According to typical methods, the pharmaceutical composition may be prepared into a formulation for oral administration such as a powder, a granule, a tablet, a capsule, a suspension, an emulsion, a syrup, an aerosol, etc., a formulation for external use, a suppository or a sterilized injectable solution.
For formulating the pharmaceutical composition, typical diluents or excipients such as fillers, thickeners, binders, humectants, disintegrants, surfactants, etc. may be employed. Solid formulations for oral administration include a tablet, a pill, a pulvis, a granule, a capsule, etc. These solid formulations may contain at least one excipient and/or lubricant. Liquid formulations for oral administration include a suspension, a solution for internal use, an emulsion, a syrup, etc. In addition to a simple diluent such as water and liquid paraffin, various excipients, e.g., a humectant, a sweetener, an aromatic, a preservative, etc. may be included. As formulations for parenteral administration, a sterilized aqueous solution, a non-aqueous solution, a suspension, an emulsion, a lyophilized formulation or a suppository may be used.
The preferable dose of the pharmaceutical composition may vary depending on the state and body weight of the patient, the severity of disease, drug forms, administration routes and duration and may be suitably selected by a person skilled in the art. For more preferable effects, the composition of the present disclosure may be administered at a dose of 0.1 mg/kg to 100 mg/kg a day for the active ingredient, but with no limitations thereto. Administration may be conducted once a day or in divided doses multiple times a day. The composition of the present disclosure may be administered to mammals including humans through various routes. All modes of administration can be contemplated, for example, oral administration, intravenous, intramuscular, subcutaneous injections, etc. may be taken. For a pharmaceutical dosage form thereof, the composition according to the present disclosure may be accounted for entirely by the form of a pharmaceutically acceptable salt of the active ingredient. The composition may be used alone or in combination with another pharmaceutically active compound or in a suitable cluster.
Another aspect of the present disclosure provides a method for screening a pharmaceutical composition for prevention of viral infection or treatment of viral infection symptoms, the method comprising the steps of:
(a) transfecting a virus into host cells;
(b) treating the host cells with a drug candidate material; and
(c) analyzing an RNA tailing level of a test group treated with the drug candidate material and comparing the RNA tailing level with that of a control treated without the drug candidate material, wherein the drug candidate material is selected as an effective candidate when the RNA tailing level of the test group is relatively reduced compared to the non-treated control.
The RNA tailing level is determined in terms of the number of substitution of other nucleosides such as guanines or uridines for adenines on the poly(A) tail through guanylation or uridylation.
In the present disclosure, steps (a) and (b) may be conducted in the forward or reverse order.
When the mixed tailing in virus-infected host cells is inhibited by treatment with a sample, selection may be made of the sample as an effective drug candidate material.
The drug screening method of the present disclosure utilizes the mixed tailing operation by TENT4A/B in common with pharmaceutical composition according to another aspect of the present disclosure and invokes the description of the pharmaceutical composition, and the description of overlapping contents therebetween will be omitted to avoid excessive complexity of the present specification.
According to another aspect thereof, the present disclosure provides a method for preparing a virus-resistant cell, the method comprising a step of knocking out expression of at least one of TANT4A and TENT4B in a cell isolated from a living body.
For the knockout, various genome editing techniques can be carried out as described previously. In the Examples of the present specification, CRISPR-Cas genome editing was utilized (see Example 6), but without limitations thereto.
According to another aspect thereof, the present disclosure provides a method for stabilizing an RNA sequence, the method comprising a step of inserting a stem-loop sequence including a pentaloop structure consisting of the amino acid sequence represented by the following general formula into a target RNA sequence:
5′-CNGGN-3′, [General Formula]
wherein N's are each independently selected from adenosine (A) and uracil (U).
As used herein, the term “stem-loop structure” is an intramolecular base pairing that can occur in single stranded DNA or RNA if sequences of two regions of the same strand are complementary to each other. This structure is also known as a hairpin or hairpin structure. Examples of stem-loop structures are illustrated in
As used herein, the term “pentaloop” refers to a single-stranded sequence region of 5 bases located at a linker that has no base pairing interactions on a stem-loop structure. The stem-loop structure of the present disclosure includes a pentaloop structure as illustrated in
In an embodiment of the present disclosure, the stem-loop structure of the present disclosure includes 2-15 base pair bonds, more specifically, for example, 2-14 base pair bonds, 2-13 base pair bonds, 2-12 base pair bonds, 2-11 base pair bonds, 2-10 base pair bonds, 3-10 base pair bonds, and 3-9 base pair bonds, but without limitations thereto. The base pair bonds may be adenine-uracil bonds or cytosine-guanine bonds, but without limitations thereto.
Insertion of the stem-loop structure of the present disclosure into a target RNA sequence increases the frequency of inducing mixed tailing with TENT4A/B in the target RNA sequence, resulting in stabilizing the RNA sequence.
An exemplary embodiment of the present disclosure is illustrated in
Features and advantages of the present disclosure are as follows:
(a) The present disclosure provides a pharmaceutical composition for prevention of viral infection and treatment of viral infection symptoms.
(b) The present disclosure provides a method for screening a pharmaceutical composition for prevention of viral infection and treatment of viral infection symptoms.
(c) The present disclosure provides a method for preparing a virus-resistant cell.
(d) The present disclosure provides a method for stabilizing an RNA sequence by incorporating a predetermined stem-loop structural sequence.
(e) When used, the pharmaceutical composition of the present disclosure can effectively prevent and treat viral infection.
(f) The RNA sequence stabilizing method of the present disclosure can induce mixed tailing in a desired RNA sequence to stabilize the sequence.
The insertion of the stem-loop structure of the present disclosure into a target RNA sequence may be performed using conventionally well-known methods without particular limitations.
A better understanding of the present disclosure may be obtained via the following examples which are set forth to illustrate, but are not to be construed as limiting the present disclosure.
TAIL-seq was conducted as previously described [3]. In brief, ˜50 μg of DNasel (Takara, 2270A) treated total RNA (>200 nt) was used to deplete ribosomal RNA twice by Ribo-Zero kit (Epicentre, MRZH11124 (discontinued) for primary HFF library or Illumina, TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat, 20020596 for HepG2.2.15 library). The rRNA-depleted RNAs were ligated to the 3′ adapter and partially fragmented by RNase T1 (Ambion). The fragmented RNAs were pulled-down with streptavidin beads (Invitrogen), 5′ phosphorylated and purified by 6% urea-PAGE gel (500-1,000 nt). The purified RNAs were ligated to the 5′ adapter, reverse-transcribed and amplified by PCR. The libraries were sequenced by paired-end run (51×251 cycles) on the Illumina platform (MiSeq) with PhiX control library v.3 (Illumina) and spike-in mixture. TAIL-seq sequencing data have been deposited to the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database with accession number GSE146600. TAIL-seq analysis was carried out using Tailseeker v.3.1.5 [9]. Briefly, read 1 was used for gene identification, and read 2 was used to detect 3′ end modifications and measure the length of the poly(A) tail. For each TAIL-seq library, read 1 was mapped to human genome GRCh38 with STAR 2.5.2b [50] and either HBV genome NCBI U95551.1 or HCMV genome NCBI GU937742.2 with bowtie2.2.6 [51]. Only TAIL-seq fragments with poly(A) tail length of at least 25 nt were used as done previously[6]. Of read 2, 3′ end 10-mer sequences with terminal or internal mono-guanylation (or -cytidylation, -uridylation) were examined to estimate the fraction of nonadenosine incorporation of the poly(A) tail.
fCLIP-seq was performed as previously described with minor modifications [16,52]. In brief, HepG2.2.15 cells on two 150 mm dishes were crosslinked with 0.1% paraformaldehyde (Pierce, 28906), collected and lysed. Fifteen μg of each antibody (NMG, Santa Cruz, sc-2025; TENT4A, laboratory made; TENT4B, laboratory made) was conjugated to protein A and G Sepharose beads (1:1 mix, total 20 μl, GE Healthcare, 17-5138-01 and 17-0618-01, respectively). Lysates were incubated with antibody-conjugated beads, and RNAs were purified from the eluates followed by DNasel treatment and washing. Then, 1 μμg of input RNAs or RNAs from each sample were prepared for the libraries. rRNAs were depleted twice by Ribo-Zero kit (Illumina, TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat, 20020596). The rRNA-depleted RNAs were ligated to the 3′ adapter and purified by 6% urea-PAGE gel (80-500 nt, corresponding to 50-470 nt RNAs that were fragmented by sonication) followed by 5′ phosphorylation, 5′ adapter ligation, reverse-transcription, and PCR amplification. The fCLIP-seq libraries were sequenced by paired-end run (151×151 cycles) on Illumina platform (MiSeq) with PhiX control library v.3 (Illumina). fCLIP-seq sequencing data have been deposited to the NCBI GEO database with accession number GSE146597.
For each fCLIP-seq library, pair-end reads were assembled with pear v.0.9.10[53], and aligned to human genome GRCh38 with STAR 2.5.2b[50] and HBV genome NCBI U95551.1 with bowtie2.2.6[51]. Raw read coverage of fCLIP-seq libraries were computed with bedtools v.2.26.0. fCLIP-seq peak clusters of cellular mRNAs were estimated using Piranha v1.2.1 [54] with a cluster size of 200 nt (−z 200), internal normalization (−n), log transformation (−l), and the NMG library as the covariate. Of note, HBV PRE spans approximately 400 nt. Enrichment scores of peak clusters were calculated by the log 2 ratio of the reads of the TENT4 fCLIP-seq library and of the NMG library. The input library was used as a negative control of this analysis[55]. To account for technical background of the read coverage, the Hodges-Lehmann estimator over the HBV genome was used. Specifically, given the HBV genome of length n, the median of the following set is computed:
where Xi and Xj are the raw read coverages at positions i and j, respectively. The raw read coverages were then normalized by this Hodges-Lehmann estimator and visualized using the ggplot2 R package.
All cell lines used in this study were tested negative for mycoplasma. HeLaT was derived from HeLa (gift from C.-H. Chung at Seoul National University) with a null mutation in the TUT4 gene. HeLaT and HEK293T (gift from S. Kim at Seoul National University) cells were authenticated by ATCC (STR profiling). HepG2.2.15, HeLaT and HEK293T cells were grown in DMEM (Welgene, LM 001-05) containing 10% FBS (Welgene, S001-01). Primary HFF (ATCC SCRC-1041) cells were grown in DMEM (HyClone) containing 10% FBS (HyClone), GlutaMAX-I (Gibco), and penicillin-streptomycin (Gibco). Before transfection, primary HFF were grown in antibiotics-free media.
For combinatorial knockdown, equal amounts of small-interfering RNAs or GAPmer against target genes were mixed to have a final concentration denoted as discussed in the following. For TENT4A and TENT4B knockdown, HepG2.2.15 cells were transfected with 100 nM siRNAs by Lipofectamine RNAiMAX (Invitrogen) at days 0, 2 and 4 and collected on day 6. For ZCCHC14, SAMD4A and SAMD4B knockdown, HepG2.2.15 cells were transfected with 100 nM siRNAs or GAPmer by Lipofectamine RNAiMAX (Invitrogen) at days 0 and 2, and collected on day 4. HEK293T cells were transfected with the RNA2.7-expressing pCK vector for RNA immunoprecipitation by Lipofectamine 3000 at day 0 and collected on day 2. Primary HFF cells were transfected with 20 nM siRNAs by DharmaFECT 1 (Dharmacon) at days 0 and 2 and collected on day 5. The sequence information of siRNAs is shown in Table 1.
The present inventors purchased siRNAs against TENT4A from ON-TARGETplus SMARTpool (Dharmacon) and GAPmer against SAMD4A from Antisense LNA GapmeR Standard (Qiagen, 339511 LG00236046-DDA) for better knockdown efficiency in HepG2.2.15. Actinomycin D (Sigma, A9415, 4 μg ml-1) was added to HepG2.2.15 cells to block transcription and cells were gathered at the denoted time.
Infectious HCMV particles were generated by transfecting HCMV Toledo BAC DNAs (received from T. Shenk, Princeton University) into primary HFF cells by electroporation (Invitrogen, Neon). When a 100% cytopathic effect was observed, cell culture supernatants were gathered, centrifuged to remove cell debris, and stored at −80° C. in 1 ml aliquots. To titrate the viral stocks, primary HFFs grown on cover glass were inoculated with diluted virus stocks for 1 hour and fixed with 3.7% formaldehyde at 24 hours post inoculation. Cells were permeabilized using 0.1% Triton X-100, incubated with blocking buffer (2% bovine serum albumin in phosphate-buffered saline), stained with HCMV 1E1 antibody (MAB810R; Millipore) followed by FITC-conjugated anti-mouse antibody (115-095-146; Jackson Laboratories), and mounted with DAPI-containing solution (H-1200; Vector Laboratory). The number of HCMV IE1-positive cells were counted and the multiplicity of infection (MOI) was determined by calculating the ratio of IE1-positive cells to total cells. For HCMV infection, primary HFF cells were incubated with HCMV (MOI, 2) diluted in serum-free DMEM for 1 hour, washed with PBS, and incubated in DMEM for further culture.
Previously described wild-type TENT4A and TENT4B isoforms (792 and 666 aa, respectively)[6] except the FLAG tag were used. A point mutation for catalytic dead mutant was introduced (D352A for TENT4A, D326A for TENT4B, respectively). For PRE reporter constructs, PRE (1,154-1,687 bp), PREα (1,154-1,351 bp), PRE (1,352-1,687 bp), αΔ1 (1,276-1,351 bp), and αΔ2 (1,154-1,275 bp) were amplified from HepG2.2.15 complementary DNA and introduced into the 3′ UTR region of firefly luciferase mRNA sequence in pmirGLO-3XmiR-1 vector[6]. Point mutations for the La-binding motif and stem-loop a were the same as the previously described mutants[30]. α mutt, α mut2, and a mut3 were generated by PCR-directed mutagenesis. For WPRE reporter constructs, WPRE (1,095-1,670 bp), Wγ+Wα (1,095-1,507 bp), Wα+Wβ (1,300-1,670 bp), Wγ (1,093-1,299 bp), Wα (1,300-1,507 bp), and Wβ (1,508-1,670 bp) were amplified from pLenti-CMV vector (Addgene, 17492) and introduced into 3′ UTR of firefly luciferase in pmirGLO-3Xmir-1 vector. Point mutations for the CNGGN pentaloops of WPREα were designed in a similar manner to the PRE mutants. For RNA2.7 construct, FRG1 (1-513 bp), FRG2 (414-913 bp), FRG3 (814-1,313 bp), FRG4 (1,214-1,713 bp), FRG5 (1,614-2,113 bp), FRG6 (2,014-2,513 bp), 1ΔA (1-513 bp, Δ1-100 bp), 1ΔB (1-513 bp, Δ101-200 bp), 1ΔC (1-513 bp, Δ201-300 bp), 1ΔD (1-513 bp, Δ301-400 bp), 1ΔE (1-513 bp, Δ401-513 bp), 1D (301-400 bp), 1E (401-513 bp), and SL2.7 (414-463 bp) were amplified from HCMV-infected primary HFF cDNA and introduced into the 3′ UTR region in pmirGLO-3Xmir-1 vector. The 1E and SL2.7 mutant constructs were generated in the same way as the PRE mutants. For RNA immunoprecipitation, RNA2.7 (1-2,513 bp) were amplified from pmirGLO-3Xmir-1 vector and subcloned into a pCK vector.
For ablation of TENT4A and TENT4B, CRISPR-Cas genome editing was carried out as previously described[56] with minor adaptations that T7 Endonuclease l (NEB, M0302) was used instead of Surveyor nuclease. The 6E4 HeLaT cells on 24-well plate were transfected by using Metafectene (Biontex, T020) with 300 ng pSpCas9(BB)-2A-GFP-px458 plasmid (Addgene no. 48138) with single-guide RNA (agccacgttgtgcttccgcg, PAM sequence is GGG) against TENT4A first. This HeLaT parental cell was derived from HeLa and contained a null mutation in the TUT4 gene. After single cell screening and Sanger sequencing to confirm knockout, parental and changed genomic sequences are listed in Table 2, and inserted sequences are marked in bold and underlined.
Using TENT4A knockout cells, TENT4B was further ablated with sgRNA (gacatcgacctagtggtgtt, PAM sequence is TGG) against TENT4B. Changed genomic sequences are also listed in Table 2, and inserted and deleted sequences are marked in red and dashes, respectively.
Mice were immunized with TENT4A antigen (126-571 aa from 792 aa isoform, NCBI NP_008930.2) or TENT4B antigen (106-533 aa from 666 aa isoform, NCBI XP 006721308.1) and killed. Collected splenocytes were fused with Sp2/O myeloma, and hybridoma cells producing high affinity antibodies were selected. Ascites was obtained after intraperitoneal injection of hybridoma cells to mice (Youngin Frontier Inc.), and used for the immunoprecipitation experiment.
HepG2.2.15 cells were lysed in RIPA buffer (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 10% NP-40 (Sigma, 74385), 1% sodium deoxycholate (Sigma, D6750), 1% SDS (Ambion, AM9823)). Other cells were lysed in Buffer D (200 mM KCl, 10 mM Tris-HCl (pH 8.0), 0.2 mM EDTA, 0.1% Triton X-100 (Promega, H5142)). Roughly 60 μg of lysate was loaded on 10% or 8-16% (Novex) SDS-PAGE gel with the ladder (Thermo, 26616 and 26619). After transferring to a methanol-activated polyvinylidene difluoride membrane (Millipore), the membrane was blocked in PBS-T containing 5% skim milk, probed with primary antibodies and washed three times with PBS-T. Anti-mouse or anti-rabbit HRP-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories) were incubated and washed three times with PBS-T. Chemiluminescence was conducted with West Pico or Femto Luminol reagents (Thermo), and the signals were detected by ChemiDoc XRS+ System (BioRad). Anti-TENT4A (1:500, Invitrogen, PA5-61302; 1:250-500, Atlas Antibodies, HPA045487), anti-TENT4B (1:500, Invitrogen, PA5-60177; 1:500, Atlas Antibodies, HPA042968; 1:500, laboratory made), anti-ZCCHC14 (1:1,000-2,000, Bethyl Laboratories, A303-096A), anti-GAPDH (1:1,000-2,000, Santa Cruz, sc-32233), anti-SAMD4B (1:500, Invitrogen, PA5-53490), anti-GM130 (1:500, BD Bioscience, 610822) and anti-Histone H3 (1:2,000, Cell signaling, 4499) were used as the primary antibodies.
Total RNA was extracted using Trizol reagent (Invitrogen, 15596018) or Maxwell 16 LEV simplyRNA Tissue kit (Promega, AS1280), treated with DNasel, purified with RNeasy MinElute Cleanup Kit (Qiagen), and reverse-transcribed with RevertAid reverse transcriptase (Thermo) and oligo dT for luciferase assay samples or random hexamer (Invitrogen) for other samples. mRNA levels were measured with SYBR Green assays (Thermo) and StepOnePlus Real-Time PCR System (Applied Biosystems) or QuantStudio 3 (Applied Biosystems). The list of RT-qPCR primers is given in Table 3.
For TENT4A and TENT4B immunoprecipitation with HepG2.2.15 cells, cells from one 150 mm dish were gathered, lysed with lysis buffer (20 mM HEPES (pH 7.0-7.6) (Sigma, H0887), 4% NP-40, 100 mM KCl, 0.1 mM EDTA, 10% glycerol, 1 mM DTT, 20 U ml-1 RNase inhibitor (Ambion, AM2696), 1× protease inhibitor (Calbiochem, 535140)) on ice and then centrifuged. 0.375 μg of each antibody (NMG, Santa Cruz, sc-2025; anti-TENT4A, laboratory made; anti-TENT4B, laboratory made) was conjugated to protein A and G sepharose beads (1:1 mix, total 10 μl). Lysates were incubated with antibody-conjugated beads and then washed with wash buffer (the same lysis buffer but with 2% NP-40). After adding 10 ng of firefly luciferase mRNA to the sample as a spike-in used for normalization, RNAs were purified by TRIzol reagent, treated with DNasel and used for RT-qPCR. A similar method was used for ZCCHC14 immunoprecipitation with HepG2.2.15 cells but also with Turbo DNasel (Ambion, AM2239) treatment during lysis and each 10 μg of antibody (Normal rabbit IgG (Cell signaling, 2729S) and anti-ZCCHC14 (Bethyl Laboratories, A303-096A)). For TENT4A immunoprecipitation with HEK293T cells (one 100 mm dish), a similar method was used with each 6 μg of antibody (NMG and anti-TENT4A) and the cells were also crosslinked (0.1% paraformaldehyde) before collection.
Similar steps were used as in RNA immunoprecipitation but with the addition of Turbo DNasel and RNase A (Thermo, EN0531). Briefly, HepG2.2.15 cells from five 150 mm dishes were lysed and used for immunoprecipitation with 17.5 μg of each antibody (NMG, anti-TENT4A, anti-TENT4B), which was conjugated to protein A and G sepharose beads (1:1 mix, total 25 μl). Primary HFF cells from two 150 mm dishes were lysed and used for immunoprecipitation with each 6 μg of antibody (NMG, anti-TENT4A, anti-TENT4B), which was conjugated to protein A and G sepharose beads (1:1 mix, total 20 μl). RNase A was added to lysates to have 0.2-0.3 μg/μl final concentration. For the coimmunoprecipitation experiment, cytosol extracts from 1 and 1/3 150 mm dishes of HeLaT cells were obtained by subcellular fractionation as described in the following, and then used for immunoprecipitation with 18 μg of each antibody (NMG, anti-TENT4A, anti-TENT4B).
The 1E5 HeLaT cells on 24-well plate were transfected with 200 ng pmirGLO plasmids for luciferase reporter assay by Lipofectamine 3000 at day 0 and collected on day 2. For the rescue experiment, 1.5E5 HeLaT parental and TENT4 KO cells on a 24-well plate were transfected with 50 ng of pmirGLO plasmids along with 20 ng of null vector or TENT4A/B (1:1 mix) plasmids by Lipofectamine 3000 at day 0 and collected on day 2. HEK293T cells were transfected with 100 nM siRNAs at Day 0 and 1.5E5 cells on 24-well plate were further transfected with 100 nM siRNAs at day 2 along with 100 or 200 ng of pmirGLO plasmids by Lipofectamine 3000. HEK293T cells were collected on day 4. For luciferase assay, cells were lysed and analyzed with the dual-luciferase reporter assay system (Promega) according to the manufacturer's instructions.
The 2E6 HeLaT cells were collected and washed with cold PBS. To obtain cytosolic fraction, cells were lysed with 200 μl of cytosol lysis buffer (0.2 μg/μl digitonin (Sigma, D141), 150 mM NaCl, 50 mM HEPES (pH 7.0-7.6), 0.1 mM EDTA, 1 mM DTT, 20 U/ml RNase inhibitor, 1× protease inhibitor, 1× phosphatase inhibitor). After centrifugation at 2,000 relative centrifugal force at 4° C. for 5 min, supernatant was collected and used as a cytosol fraction. For the membrane and nucleus fractions, subcellular protein fractionation kit (Thermo Scientific, 78840) was used according to the manufacturer's instructions.
Hire-PAT assay and signal processing of capillary electrophoresis data were conducted as previously described[3,57] with minor adaptations that total RNAs were G/I tailed by yeast poly(A) polymerase (Thermo Scientific, 74225Z25KU). Poly(A) site of firefly luciferase gene was confirmed by Sanger sequencing, and the forward PCR primer is listed in Table 4.
To identify putative stem-loop binding proteins, homologs of the RNA-binding SAM domain of Drosophila Smaug (UniProtKB Q23972) and human SAMD4A/B (UniProtKB Q9UPU9 and Q5PRF9) were searched using UniProt BLAST with an E value threshold of ten and not gapped[58]. Protein sequences used for the analysis: UniProtKB Q08831 (S. cerevisiae), UniProtKB Q9P6R7 (S. pombe), UniProtKB Q5AI80 (C. albicans), UniProtKB O76699 (C. elegans), UniProtKB Q23972 (D. melanogaster), UniProtKB E7F857, E7FBA1, A0A0R4IUM4 (D. rerio), UniProtKB Q6GLT9, Q5FWP2, A0A1L8GL36 (X. laevis), UniProtKB Q8CBY1, Q80XS6, Q8VIGO (M. musculus) and UniProtKB Q9UPU9, Q5PRF9, Q8WYQ9 (H. sapiens). MUSCLE v.3.8.31[59) with default parameters was used for multiple sequence alignment of the resulting 17 protein sequences. The phylogenetic tree was reconstructed using PhyML v.3.1/3.0 aLRT60 and visualized using TreeDyn v.198.3 [61) on the Phylogeny.fr platform[62]. The edge and leaves of the reconstructed phylogenetic tree were reordered and rooted manually for visualization.
The 3′ TEG (tetraethylene glycol spacer)-biotinylated RNAs of RNA2.7 stem-loop (SL2.7) and stem-loop mutant (SL2.7 mut) were synthesized (Bioneer Inc.), and the sequences are listed in Table 5.
Streptavidin M-270 beads (Thermo Scientific, 65305) for set 1 and streptavidin magnetic beads (NEB, S1420S) for set 2 were washed twice with pulldown buffer (50 mM Tris (pH 8.0), 150 mM NaCl, 5% glycerol, 1 mM DTT, 100 U/ml RNase inhibitor, 1× Protease inhibitor). Next, 10 μg of oligonucleotides of SL2.7 or its mutant were conjugated to streptavidin beads in pulldown buffer overnight at 4° C. and then washed with pulldown buffer. HEK293T cells from four 150 mm dishes were gathered and then lysed with 1.5 ml pulldown buffer followed by sonication. After centrifugation, supernatant was incubated with beads and washed with wash buffer no. 1 (50 mM Tris (pH 8.0), 300 mM NaCl, 5% glycerol), wash buffer no. 2 (50 mM Tris (pH 8.0), 150 mM NaCl, 5% glycerol, 0.1% triton X-100) and pulldown buffer. For elution, the beads were incubated with 60 μl of elution buffer (100 mM (pH 7.5), 4% SDS, 100 mM DTT) at 1,600 r.p.m. in thermomixer for 10 min at 65° C. Then, 10 and 50 μl of eluates were used for western blotting and mass spectrometry, respectively.
The immunoprecipitated protein samples containing SDS were subjected to filter-aided sample preparation digestion. Briefly, protein samples were first reduced and alkylated with denaturing ABC buffer (8 M urea in 50 mM ammonium bicarbonate (ABC)). The alkylated samples were placed on preconditioned 30 kDa MWCO Amicon filter (Millipore, UFC5030) and centrifuged for 30 min at 14,000 g. Serial washing was carried out with 200 μl of 8 M urea or 50 mM ABC buffer and centrifuging for 15 min at 14,000 g to remove SDS in the filter unit. Then, protein samples were digested with 2% (w/w) trypsin at 37° C. for overnight. The resulting peptide samples were subject to C18 ziptip clean-up (Millipore, Z720070) and LC-MS/MS analysis. In-house packed long capillary columns (100 cm×75 μm inside diameter) and trap columns (3 cm×150 μm inside diameter) with 3-μm Jupiter C18 particles (Phenomenex) were used for peptide separation. A flow rate of 300 nl/min and a linear gradient ranging from 95% solvent A (water with 0.1% formic acid) to 40% of solvent B (acetonitrile with 0.1% formic acid) for 100 min were applied on nanoACQUITY UPLC (Waters) coupled with Orbitrap Fusion Lumos mass spectrometer (Thermo Scientific), which was operated using the following parameters: m/z 300-1,800 of precursor scan range, 1.4 Th of precursor isolation window, 30% of normalized collision energy for higher-energy collisional dissociation (HCD), 30 s of dynamic exclusion duration and a 60,000 or 75,000 resolution at m/z 200 for full MS or MS/MS scan, respectively.
Mass spectrometric raw data files were processed with MaxQuant (v.1.5.3.30) searched using the built-in Andromeda search engine[65] in MaxQuant against the human Uniprot database[58] (v.12/5/2018) at default settings (20 or 6 ppm of precursor ion mass tolerances for initial or main search, respectively, and 0.5 Da for fragment ion masses). Enzyme specificity was set to trypsin/P, and a maximum of two missed cleavages were allowed. Cysteine carbamidomethylation and methionine oxidation were selected as fixed and variable modifications, respectively. A 1% FDR was required at both the protein and the peptide level. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE[66] partner repository with the dataset identifier PXD018061 and 10.6019/PXD018061. To account for spurious or nonspecific binding to the SL2.7 construct, the results from the “bead only” and the mutant construct were considered as technical background and designed a customized statistical test for protein spectra count enrichment. Let Np be the number of identified spectra count for protein p from the SL2.7 construct, and Mp be the count number from the background construct. For each protein p with Np 1, the statistical significance (or P value) of enrichment was computed:
where N=ΣPNP is the total spectra count, ρ=(Mp+1)/ΣP(MP+1) is the background probability, and B(k; n, p) is the binomial distribution of getting k successes in n trials with success probability of P. Finally, P values were adjusted via the Benjamini-Hochberg method. Proteins with an adjusted P<0.01 when using a technical background (‘bead only’ or mutant) were considered statistically significant. Statistically significant proteins in either set 1 or set 2 datasets were considered for subsequent protein intensity analysis. To handle missing values, the minimum nonzero intensity value of the dataset was imputed. Protein enrichment score was then calculated as the log 2 fold change of the protein intensity of the SL2.7 over the mutant data.
Results
1. HBV and HCMV Turn the Mixed Tailing Machinery to their Own Advantage.
To investigate and characterize viral RNA tailing, TAIL-seq was first applied to two viral infection models: HepG2.2.15 cells incorporated with HBV DNA and primary human foreskin fibroblast (HFF) infected with HCMV. HepG2.2.15 cells were derived from the hepatoblastoma cell line HepG2 and used to study the life cycle of HBV as they sup-port the production and assembly of HBV particles. TAIL-seq data on HepG2.2.15 cells showed exceptionally high guanylation frequency on viral RNAs (
To examine if the viral mixed tailing is mediated by the same enzymes as the host counterparts, the present inventors depleted TENT4A and TENT4B. Guanylation and mixed tailing frequency of HBV mRNAs and HCMV RNA2.7 were reduced in TENT4A- and TENT4B-depleted cells (
2. HBV RNAs are Major Substrates of TENT4 in HepG2.2.15 Cells.
To elucidate the mechanism of TENT4 recruitment, formaldehyde-mediated crosslinking and immunoprecipitation sequencing (fCLIP-seq) were carried out on HepG2.2.15 cells (
HBV RNAs are generated from a circular DNA genome of 3.2 kilobases. Five overlapping viral transcripts share a common 3′ end sequence (˜700 basepairs) and a single polyadenylation site (
3. Stem-Loop a of HBV RNAs is Necessary for TENT4-Dependent Tail Regulation.
To identify the cis-acting RNA element recognized by TENT4, the present inventors generated reporters with different subregions of PRE in the 3′ untranslated region (UTR) (
Luciferase protein and RNA levels were significantly upregulated in a TENT4-dependent manner only when the reporter was equipped with either the full PRE or PREα (
This result indicates that TENT4 acts directly through tail modification in a PREα-dependent manner. Moreover, in the knockout cells, the PRE and PREα reporter expressions at both protein and RNA levels were rescued by ectopically expressed TENT4 (
To examine the mechanistic conservation of PRE, use was made of the woodchuck hepatitis virus (WHV) segment (WPRE) that is homologous to the PRE of HBV (
The combination of WPREγ (Wγ) and WPREα (Wα) resulted in a synergistic effect (
Further point mutations were introduced to specify the core motif in PREα (
4. HCMV RNA2.7 Harbors a Similar Stem-Loop for TENT4-Dependent Regulation.
In addition to HBV mRNAs, HCMV RNA2.7 (VRNA2.7) also undergoes mixed tailing (
Altogether, the data of present disclosure demonstrate the functional importance of the SLα-like structure in TENT4-dependent regulation.
5. Cytoplasmic ZCCHC14 Binds to the Stem-Loop Structure and Interacts with TENT4.
The CNGGN pentaloop was first characterized as the Smaug recognition element, which binds to the sterile alpha motif (SAM) domain of yeast Vts1p and Drosophila Smaug mediates post-transcriptional repression[32-36]. Based on the structural resemblance, Schwalbe and colleagues had proposed that the HBV SLα pentaloop may serve as a binding site for a protein with the SAM domain. However, TENT4 does not contain a SAM domain[31], and the present inventor's tailing assays with recombinant TENT4 failed to detect a notable affinity to PRE in vitro, indicating an RNA-interacting cofactor.
To find the potential cofactor that recognizes SLα and SL2.7, RNA pulldown was conducted with biotinylated synthetic SL2.7 and HEK293T cell extract (
To understand the action mechanism of ZCCHC14, TAIL-seq experiments were performed in ZCCHC14-depleted HepG2.2.15 cells. Guanylation frequency of HBV mRNAs was reduced (
RNA immunoprecipitation using ZCCHC14 antibody confirmed an interaction between ZCCHC14 and HBV transcripts in HepG2.2.15 cells (
The present inventors revealed the mechanism of targeted mixed tailing in viral gene expression (
Other than mixed tailing machinery, TENT4B works as a component of nucleolar TRAMP complex (Trf4-Air1/2-Mtr4 in yeast and TENT4B-ZCCHC7-hMTR4 in human), and is involved in the degradation of aberrant transcripts or the trimming and maturation of small noncoding RNAs in the nucleus[5, 39-43]. The present inventors previously showed that mixed tailing contributes to mRNA stability as a module distinct from TRAMP complex. Given that the knockdown of hMTR4 and ZCCHC7 does not affect the HBV protein and mRNA levels, TENT4 seems to act independently of the TRAMP complex in HBV regulation. Cytoplasmic localization of ZCCHC14 also suggests that the TENT4-ZCCHC14 complex operates in a separate subcellular compartment from the nucleolar TRAMP complex although exclusion is not made of the possibility that a minor fraction of the TENT4-ZCCHC14 complex may act in the nucleus.
Mixed tailing seems to be particularly important for HBV gene expression. Four out of five mRNA species (pgRNA, Precore, PreS1 and PreS2/S except X) contain the SLα stem-loop, and their half-lives are substantially reduced when TENT4 enzymes are depleted. Current treatment options include nucleos(t)ide analogs and interferon alpha, but they are not curative and often ineffective, leaving HBV infection as the major global medical burden causing almost 80 million deaths per year. Functional cure can be achieved by blocking the production of viral proteins, especially viral S antigen (HBsAg) that induces immune evasion. The discovery of viral mixed tailing and the involvement of TENT4 and ZCCHC14 in viral gene expression may provide mechanistic insights for the development of a new class of anti-HBV drugs. To avoid any potential side effects of targeting the TENT4 machinery, it will be important to understand the endogenous functions and action mechanisms of the TENT4 proteins and their partners.
The physical interaction between the CNGGN pentaloop and RNA-binding SAM proteins appears to be a highly conserved and widely used functional module. In fruit fly, Smaug recognizes the hairpin with a CUGGC loop of nanos mRNA to induce timely mRNA degradation, which is essential for the establishment of the anterior-posterior axis. In yeast, Vts1p binds to mRNA with the CNGG(N) pentaloop for targeted mRNA degradation. Vertebrates have three RNA-binding SAM proteins and seem to have expanded the use of this interaction module. SAMD4B, one of the vertebrate orthologs of Smaug, targets nanos1 mRNA and is essential during mammalian neural development. SAMD4A, the other vertebrate ortholog of Smaug, suppresses the translation of pentaloop-containing reporters and is associated with the formation of cytoplasmic foci. Here, the present inventors show that the same mechanism could be used for the opposite purpose via a vertebrate-specific protein ZCCHC14, in particular for the benefit of viral RNAs.
| Number | Date | Country | Kind |
|---|---|---|---|
| 10-2019-0064129 | May 2019 | KR | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/KR2020/007100 | 6/1/2020 | WO | 00 |