Patent Application
20240067974
The present invention concerns a method for the treatment of autosomal dominant Catecholaminergic Polymorphic Ventricular Tachycardia, associated with mutations in the cardiac ryanodine receptor type 2 (RYR2) gene, by the use of an AAV mediated RNA interference approach to induce allele specific silencing of mutant mRNA.
Catecholaminergic Polymorphic Ventricular Tachycardia (CPVT) is an inherited channelopathy characterized by high susceptibility to life threatening arrhythmias. Two forms of the disease have been described: the autosomal dominant and the autosomal recessive variant. The first is associated with mutations in the cardiac ryanodine receptor type 2 (RYR2) gene (Priori S G et al., 2001), while the autosomal recessive variant is associated with mutations in the cardiac calsequestrin 2 (CASQ2) gene (Lahat H et al., 2001). Clinical observations have shown that patients with the dominant form of CPVT develop bidirectional and polymorphic ventricular tachycardia in response to sympathetic activation, whereas their resting ECGs are unremarkable and heart structure is preserved. The response to current therapy is unable to effectively reduce sudden death in affected individual and therefore there is need for an innovative treatment able to correct all aspects of the functional derangements observed in the dominant form of CPVT.
The pathology is linked to an abnormal function of the physiologic mechanism called ‘calcium-induced calcium release’ (CICR) that is the fundamental for the excitation-contraction coupling in the heart.
The highly coordinated opening and closing of voltage-dependent ion channels located in the membrane of cardiac myocytes generates the cardiac action potential. During the plateau phase of the action potential, opening of voltage-dependent L-type Ca2+ channels allows the influx of Ca2+ in the plasmalemma. This process triggers the calcium transient and induces opening of sarcoplasmic reticulum (SR) Ca2+ release channels: the ryanodine receptor 2 (RyR2) (Bers D M, 2002). These local releases occur at specialized structures called the calcium release units (CRUs). The CRUs are preferentially localized at the level of the transverse tubules (T-tubules), where the membrane of the SR is juxtaposed to the cellular membrane. One CRU is formed by clusters of RyR2 (spanning the SR membrane) that are in close proximity to the L-type Ca2+ channels (on the cell membrane) (Franzini-Armstrong et al., 2005). The Ca2+ released from the SR binds to troponin C and induces a series of allosteric changes in the myosin filaments leading to muscle fiber contraction. The subsequent removal of Ca2+ is mediated by the concomitant closing of the RyR2 and the action of SR Ca2+ ATPase (SERCA) that pumps Ca2+ back into the SR stores.
Another component of Ca2+-transient termination is the Na+-Ca2+ exchanger (NCX). The NCX extrudes one Ca2+ ion (two positive charges) for every three Na+ ions (three positive charges) taken into the cell. Thus, the NCX removes Ca2+ by generating a net inward depolarizing current: the transient inward current (Iti) (Pieske B et al., 1999). The NCX becomes very important for the removal of Ca2+ in conditions characterized by calcium overload, for example in case of RYR2 genetic mutations.
Arrhythmias in CPVT are elicited by Ca2+ release events that are not triggered by an action potential and are, therefore, called ‘spontaneous calcium releases’ (SCRs). SCR begins as a localized event involving a single CRU, but can also diffuse to neighboring CRUs triggering more Ca2+ release to produce a cell-wide calcium wave. The probability that SCR will lead to a calcium wave is influenced by the balance between SR Ca2+ content and the concentration of Ca2+ that induces Ca2+ release from the SR, the so-called SR calcium threshold. RyR2 function has a pivotal role in controlling the threshold. Several RYR2 mutations associated with CPVT decrease the SR threshold for the release of calcium from the SR and therefore they facilitate the occurrence of Spontaneous Calcium Release (Venetucci L et al., 2012).
When abnormal Ca2+ release occurs, cytosolic Ca2+ concentration transliently increases and the cell must activate mechanisms to prevent disruption of Ca2+ homeostasis and re-establish the physiological diastolic level of Ca2+. Extrusion of Ca2+ through the NCX is the preferred modality to reduce cytosolic Ca2+ however to extrude 1 Ca2+ the NCX brings inside the cell 3 Na+ thus creating a net inward current called Transient Inward Current or Iti. This current produces a transient membrane depolarizations known as delayed afterdepolarization (DAD). When a DAD's amplitude reaches the voltage threshold for the opening of the voltage dependent Na+ channel, a ‘triggered’ action potential is generated. Propagation of an action potential to the entire heart generates an extrasystolic beat. When this chain of events becomes repetitive and several DADs reach the threshold for the generation of propagating action potentials, triggered arrhythmic activity is elicited and it generates complex and life threatening arrhythmias. Mutations of RYR2 have been shown to facilitate the occurrence of Spontaneous Calcium Releases during β-adrenergic stimulation and, in turn, elicit DADs and triggered activity leading to severe ventricular arrhythmias (Liu N et al., 2006).
The generation and characterization of RyR2 R4496C/+ knock-in mouse model for autosomal dominant CPVT (Cerrone M et al., 2005; U.S. Pat. No. 7,741,529 B1) has provided great insight into the pathogenic mechanisms underlying this disease. RyR2 R4496C/+ heterozygous mice recapitulate human CPVT and develop adrenergically induced bidirectional and polymorphic ventricular arrhythmias. R4496C mutation increases the sensitivity of RyR2 channel to luminal calcium thus facilitating the spontaneous release of calcium from the Sarcoplasmic Reticulum. Spontaneous calcium release begins as a localized event involving a single CRU, however it may also propagate to neighboring CRUs triggering more Ca2+ release to produce a cell-wide calcium wave. The probability that SCR will lead to a calcium wave is influenced by the balance between SR Ca2+ content and the concentration of Ca2+ that induces Ca2+ release from the SR, the so-called SR calcium threshold. RyR2 function has a pivotal role in controlling the threshold.
The present invention concerns a method for the treatment of autosomal dominant Catecholaminergic Polymorphic Ventricular Tachycardia through silencing sequences that allow to differentiate the normal allele from the diseased allele of the RyR2 gene.
The method for the treatment of autosomal dominant atecholaminergic Polymorphic Ventricular Tachycardia according to the invention comprises the exploitation of therapeutic post-transcriptional gene-silencing. The inventors have found that, taking advantage of the endogenous RNA interference (RNAi) pathway (Elbashir et al., 2001), through the delivery of an artificial miRNA expressing vector into a cardiac cell, it is possible to selectively suppress the expression of mutant RyR2 mRNA leaving almost unaltered the expression of the wild type RyR2 transcript in order to correct functional derangements observed in RyR2 R4496C/+ heterozygous subjects.
The development of an RNAi approach involves some risk such as the supraphysiologic expression of interfering RNAs species and the possibility to cause haploinsufficiency of vital genes, as it is precisely RYR2. Nevertheless, through the accurate selection of interfering RNAs sequences and by using suitable AAV serotype, promoter, as well as vector dose, it is possible to achieve an extent of mutated allele gene silencing that is sufficient to elicit the desired effect, i.e. protecting cardiomyocytes against developing adrenergically triggered activity, but not to affect normal cardiac function. In order to achieve this goal, only strong efficient and strictly specific molecules, derived from the initial in vitro screening, are provided for the use in the in vivo experiments.
The present invention concerns a method for the treatment of autosomal dominant Catecholaminergic Polymorphic Ventricular Tachycardia associated with RYR2 (NM_023868.2, NM_001035.2) mutations in mouse models or in human patients.
In one embodiment, the invention provides a method of performing allele-specific gene silencing in mouse models or in human individuals affected by dominantly inherited CPVT, by administering to the subject in need thereof a vector carrying an expression cassette containing a promoter operably linked to sequences encoding a double stranded short interfering nucleic acid (siNA), wherein said siNA targets the RYR2 region containing the nucleotide mutation(s) and it is optimized to obtain a high knockdown rate of the mutant mRNA by sequence complementarity, leaving almost unaltered the expression of the wild type RYR2 transcript.
As used herein, siNA molecule denotes a short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA) or a circular RNA molecule.
The targeted RYR2 gene sequences may be murine-specific or human-specific. In human CPVT patients, the gene is the human RYR2 (NM_001035.2; coding sequence: SEQ ID NO:1).
In general, the alleles of the RYR2 gene will differ by one up to seven base pairs to be targeted by allele specific silencing.
In addition to using siNA molecules targeting the RYR2 regions, which contain the nucleotide change/s, the inventors have found that common SNPs can be exploited to generate interfering nucleic acids that selectively silence the mutant RYR2 expression. This alternative approach to RYR2 mutant allele-specific silencing is particularly convenient given the large number of different patient-specific disease causing mutations.
Common disease causing mutations in human RYR2 gene include, but are not limited to, R2474S, R4497C, R176Q, P2328S, Q4201R, V4653F, R176Q, T2504M, C2277R, E1724K, A2254V, A2394G, F4020L, E4076K, N4104I, H4108N, H4108Q, G4662S, H4762P, V4771I, P4902S, N4014K, and N4895D.
Common single nucleotide polymorphisms comprise most of the genetic diversity between humans and the RYR2 gene contains single nucleotide polymorphisms that can be separately targeted in one allele or in the other.
In another embodiment, the invention provides a method of performing allele-specific gene silencing in mouse models or in human individuals affected by dominantly inherited CPVT, by administering to the subject in need thereof a vector carrying an expression cassette containing a promoter operably linked to sequences encoding a double stranded short interfering nucleic acid (siNA), wherein said siNA targets common single nucleotide polymorphisms (SNPs) in the coding region of the RYR2 gene and said SNPs co-segregate with the mutations in the same allele or in the opposite, whereby the RYR2 allele in which the mutation is present is silenced, leaving almost unaltered the expression of the wild type RYR2 transcript.
SNPs typing and linkage analysis between the SNPs and the mutation may easily be assessed at the time of genetic screening that is routine in CPVT patients or at the time in which a patient has been advised to be treated with a gene therapy approach.
A bioinformatic assessment of the frequency and distribution of SNPs has been made using the available databases (Exome Variant Server) and a cohort of CPVT patients, to identify SNPs that have a minor allele frequency (MAF) between 30% and 40% and which thereby are relatively common but not too common to result in a high proportion of homozygous carriers of the minor allele, as of course they are not suitable to act as surrogate targets for the mutation as the same sequence at the SNPs site is present on both alleles.
By performing bioinformatics research, three main SNPs have been identified: rs3765097 (c.1359C>T; p.S453S), rs684923 (c.7806C>T; p.H2602H) and rs34967813 (c.8873A>G; p.Q2958R). The MAF for these SNPs according to different data bases is reported in Table 1.
It has been estimated that using the three SNPs there would be 70% of heterozygous carriers with at least one of the three SNPs.
To test this estimate, we have performed a targeted analysis in a cohort of 176 patients, genotyped for RYR2 mutation-linked CPVT to quantify the percentage of carriers of these three SNPs. We observed that 138 individuals have at least one of the three variant in heterozygosity while only 38 patients have none of the polymorphisms in heterozygosity.
Therefore, by creating just six specific siNAs—e.g. miRNA—it would be possible to treat patients thereby enabling the allele specific silencing treatment for the vast majority of CPVT patients with RyR2 mutations.
Based on this approach, the following series of siRNA duplexes targeting the specific human nucleotide variants and its wild type counterpart have been designed. The 21-mer oligonucleotides are derived from siRNA duplex sequence that has demonstrated the best silencing potency and selectivity for the specific nucleotide change/s in the in vitro screening.
SNP: rs3765097 p. (S453S)
siRNA duplexes to test if causative mutation is in cis with rs3765097
CGUAAGUCUAAGUCUGCAGGA
SiRNA duplexes to test if causative mutation is in trans with rs3765097
SNP: rs684923 p.(H2602H)
siRNA duplexes to test if causative mutation is in cis with rs684923
siRNA duplexes to test if causative mutation is in trans with rs684923
SNP: rs34967813 p.(Q2958R)
siRNA duplexes to test if causative mutation is in cis with rs34967813
siRNA duplexes to test if causative mutation is in trans with rs34967813
The flow chart depicting the steps that in the clinics will be used to choose the suitable siRNA to silence the allele containing the RYR2 mutation is shown in
The therapy will be available in six different products to target the WT or the Mutant variant of each of the 3 SNPs, and siNAs will be developed to target the RNA regions containing the sequences of interest: 1359C; 1359T; 7806C; 7806T; 8873A; 8873G.
Each CPVT patient carrier of a pathogenic mutation in the RYR2 gene who is a candidate for gene therapy through allele specific silencing will be genotyped to determine the co-segregation of the disease causing mutation and the three SNPs.
Once the variant(s) that co-segregate with the mutation is (are) identified, the patient may be suitable to be treated with 1 or 2 or 3 products. The selection of the product to be used will be based on the sequence with the highest selectivity between mutant and WT allele.
In human patients the double-stranded short interfering nucleic acid is targeted to common SNPs including, but not limited to, rs3765097 (c.1359C>T), rs684923 (c.7806C>T) and rs34967813 (c.8873A>G), when they are in heterozygosity, so that they can be used to discriminate the allele carrying the disease causing mutation from the wild-type. This makes possible to generate few siNA sequences that can silence different patient-specific mutations in the RYR2 gene.
In a preferred aspect the engineered pre-siNA (e.g. pre-miRNA) expression cassette is inserted in a vector, preferably into a viral vector. The pre-siNA coding sequence is operably linked to a promoter, which could be CMV, or cardiac specific promoters such as: cTnT, TnC, α-MHC, MLC-2 and other tissue specific promoters.
The engineered pre-siNA expression cassette may be advantageously inserted in the serotype 9 adeno-associated viral (AAV2/9) vector. Alternatively, the engineered pre-siNA expression cassette may be advantageously inserted in the serotype 6 adeno-associated viral (AAV2/6) vector or serotype 8 adeno-associated viral (AAV2/8) vector.
Once the engineered pre-miRNA expression cassette is introduced into the cardiac cells for expression, the pre-miRNA forms an intramolecular stem loop structure similar to the structure of endogenous pre-miRNA that is then processed by the endogenous Dicer enzyme into a mature miRNA (Cullen et al., 2004).
The method according to the present invention allows the correction of the bidirectional and polymorphic arrhythmias in animal models with autosomal dominant CPVT by a viral gene therapy method by which mutant Ryanodine receptor type 2 mRNA is selectively knocked down by an artificially expressed miRNA.
Artificial miRNA expressing vector should be delivered preferably to the cardiac myocytes and expressed, whereby the normal and anti-arrhythmic contractile function of the heart is restored.
In another embodiment, the invention provides a method of in vitro screening of multiple allele-specific siRNA duplexes under heterozygous conditions, comprising co-transfection of two reporter alleles and siRNAs duplexes with known sequence into cultured HEK-293 cells and determining if the mutant allele is substantially silenced while the wild-type allele retains substantially normal expression.
Specifically, the invention provides a method for identifying an siNA capable of selectively silencing a mutant allele of the RYR2 gene compared to the wild-type allele of the RYR2 gene, comprising:
In another preferred aspect, the siNA molecule according to the present invention advantageously allows to prevent or revert structural abnormalities of the CRUs and in the mitochondria that are associated with the R4496C mutation in the RyR2 gene.
In this study, the gene is the murine RyR2 (NM_023868.2) and the targeted nucleotide variant is the C13483T on the protein coding mRNA leading to the R4496C amino acid change in the murine RyR2 protein.
Allele specific targeting study to silence the allele that includes the R4496C mutation in the RYR2 gene.
1) Screening Multiple siRNAs in a Transient Expression System Using Reporter Alleles
Cellular models were used to test whether it is possible to target mutant allele in a transient expression system. We performed a series of in vitro mRNA and protein based assays to screen multiple potential siRNAs in order to identify siRNAs that would both recognize and efficiently silence the mutated allele preferentially over the wild-type allele.
Using this system, the effects of a series of siRNA duplexes on mutant alleles in allele-specific silencing, as well as off-target silencing against WT alleles, can be examined under heterozygous conditions generated by co-transfecting two reporter alleles and siRNA duplexes into cultured HEK-293 cells (
Protein, GFP) in-frame linked with the murine cDNA sequence, corresponding to the R4496C-mRYR2 (exons 91 to 96), and to a tag sequence (3xFLAG) (
To induce such allele specific-RNAi, we designed siRNAs that carry nucleotide variations characterizing target disease allele in order to discriminate it from corresponding wild-type allele. Nucleotide sequences of wild-type and mutant RYR2 mRNAs and designed siRNAs are represented below (Table 8) and are based on the sequence of the 5→3′ sense-strand (passenger) siRNA element; mutant recognition site (MRS) is underlined (Table 8).
2) Assessment of Wild Type and Mutant Allele Expression by RealTime PCR, Fluorescence Microscopy and Western Blot in Transiently Transfected Hek293 Cells
The effects of the designed siRNA duplexes on suppression of both the mutant and wild-type alleles have been subsequently examined by RealTime PCR, amplifying with specific primers GFP and RFP gene, to quantify the wild type and mutated allele mRNA respectively (Expression data have been analyzed using the 2−ΔΔCt method, normalized on GAPDH expression and relative to the cells treated with scramble siRNA) (
Most of siRNA duplexes have demonstrated a strong effect in suppressing RYR2 mRNA expression. Moreover, some of them were quite selective for the mutant allele.
Therefore, we choose five siRNAs from this first screening (siRyR-U8, U9, U10, U14 and U16) and deeply analyzed their effect by confocal microscopy, to visualize green and red fluorescence (
3) Cloning and Validation of the Candidate siRNA into an Artificial miRNA-Expressing AAV Backbone Plasmid
From the previous step we selected siRyR-U10 as the candidate to be cloned into an artificial miRNA expression vector that allows the continuous and long term expression of the silencing molecule.
This siRNA was promising since it induces a weak suppression on the Wild Type allele but a strong silencing on the mutant one.
As an intermediate vector we used the BLOCK-iT™ Pol II miR RNAi Expression Vector (Life Technologies). This vector has a triple advantage over the conventionale Pol III-shRNA expression plasmids:
Subsequently, a fragment consisting in CMV promoter, EmGFP, pre-miRNA sequence and TKpolyA was amplified from the BLOCK-iT™ Pol II miR RNAi Expression Vector (Life Technologies) and sub-cloned into the adeno associated viral backbone vector pAAV2.1 provided by the Adeno-Associated Virus (AAV) vector Core facility (Tigem, Napoli, Italy) (
The resulting plasmid has been validated by RealTime (
4) In Vivo Infection of Cardiac Murine Myocytes Using the AAV2/9 Vector for Efficient miRYR2-U10 Transfer
We infected, by intraperitoneal (I.P.) injection, neonates (P8/P9 after birth) RyR2 R4496C/+ heterozygous mice using 100 μl of serotype 9 adeno-associated viral (AAV2/9) vector containing miRYR2-U10 expressing cassette (
5) AAV2/9-miRYR2-U10 Infection Restores the Functional Phenotype of RyR2 R4496C/+ Heterozygous Cardiac Cells
From our previous investigation we knew that CPVT arrhythmias are caused by delayed after depolarizations (DADs) and triggered activity (TA) at the level of a single cardiomyocyte. Using patch clamp techniques (in current clamp mode) we analyzed the development of the DADs and/or TA in basal condition and after adrenergic stimulation.
Epifluorescence signal (from the EmGFP present in our viral construct) was used to differentiate between non-infected (i.e. non-fluorescent) and infected (i.e. green fluorescent) cells and to perform comparative assay of DAD and TA occurrence. Isolated myocytes were paced at 5 Hz frequency at 1.5-fold the diastolic threshold and action potential was continuously recorded. An average of 67% of GFP negative (non-fluorescent) cells presented TA after ISO (30 nM) stimulation, while in the same experimental condition, only 6% of the GFP positive infected cells did (
6) In Vivo Correction of the Dysfunctional Properties Observed in the RyR2 R4496C/+ Mice
We used subcutaneous ECG telemeters to monitor and compare the incidence of arrhythmias in resting conditions and during adrenergic stress induced by epinephrine and caffeine injection.
We know from the previous characterization of our autosomal dominant CPVT mouse model that at least 50%-60% of RyR2 R4496C/+ heterozygous mice present bidirectional ventricular tachycardia during adrenergic stress induced by epinephrine and caffeine injection (Cerrone M et al., 2005). Conversely, when we performed in vivo characterization of the arrhythmogenic substrate in our RyR2 R4496C/+ heterozygous CPVT mouse model infected with AAV9-miRYR2-U10 we observed that on 10 treated mice only one developed ventricular arrhythmias (10%).
We performed experiments to assess whether administration of the therapeutic construct tested in neonatal mice would also be able to revert the arrhythmic substrate in adult mice. We therefore studied a new set of animals comparing arrhythmic events occurring in 8-week old RyR2 R4496C/+ heterozygous mice (Het) versus those observed AAV9-miRYR2-U10 (Het-U10) and AAV9-miRNA-Scamble (Het-SCR) infected RyR2 R4496C/+ heterozygous mice two months after infection (
7) Morphological Alterations of CRUs in RYR2 R4497C/WT Hearts are Rescued by the AAV2/9-miRYR2-U10 Viral Infection.
We performed electron microscopy on cardiac tissue of WT and RyR2 R4496C/+ heterozygous mice to investigate whether in analogy with mice with recessive CPVT (Denegri M et al., 2014) also mice with the dominant form of CPVT present ultrastructural abnormalities and we observed abnormalities in the structure of the calcium release units (CRUs) (
8) In Vitro Identification of Allele Specific Silencing Molecules Able to Suppress Expression of Transcripts Containing the rs3765097 (c.1359C>T; p.S4535) or its WT counterpart in the human RYR2 gene.
To transfer the method above described also to the human RYR2 gene and common SNPs that co-segregate with the mutations in the same allele or in the opposite, in a way that the hRYR2 allele in which the mutation is present is silenced, leaving almost unaltered the expression of the wild type RYR2 transcript, we performed a series of in vitro mRNA- and protein-based assays to screen multiple potential siRNAs in order to identify molecules that would both recognize and efficiently silence the SNP containing allele preferentially over the wild-type allele (mimicking the situation in which the SNP is in cis with the mutation) and viceversa (mimicking the situation in which the SNP is in trans with the mutation). The siRNA tested are sequences from SEQ ID NO:4 to SEQ ID NO:18 to target the T-containing allele and from SEQ ID NO:21 to SEQ ID NO:35 to target the C-containing allele.
The effects of tested siRNA duplexes in allele-specific silencing, as well as off-target effects, have been examined under heterozygous conditions generated by co-transfecting two reporter alleles and siRNA duplexes into cultured HEK-293 cells. As reporter alleles, two plasmids were generated containing:
Animal Use
Animals were maintained and bred at the Charles River Laboratories in Calco, Italy, and transferred to the Maugeri Foundation for characterization of the phenotype. Animals were maintained and studied according to the protocols approved by the Animal Care and Use facility at the Maugeri Foundation. The adeno-associated virus delivery was via intra-caudal vein and/or intraperitoneal injection of 100-200 μl of purified virus in adult mice (8 weeks old) and/or neonatal mice (before the 9th day after birth, P9) with a gauge syringe.
Quantitative Real-Time PCR
Real-time PCR was performed using the Bio-Rad CFX96 Real-Time PCR Detection System and analyzed using the Bio-Rad CFX Manager software package (Bio-Rad Laboratories, Inc., USA). Briefly, total RNA was purified with Rneasy mini kit (Qiagen) from Hek293 cells transiently transfected with reporter alleles and siRNA duplexes or with reporter alleles and pAAV2.1-miRyRU10 or pAAV2.1-miRNAscramble. Absorbance at 260 nm (A260) was measured for each RNA sample using the NanoDrop (ND-1000) spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). A total amount of 1 μg template RNA was used for retrotranscription performed with iScript cDNA Synthesis kit (Bio-Rad Laboratories, Inc., USA). Quantitative real-time PCR analysis was performed in optical 96-well plates using CFX96 detection module (Bio-Rad Laboratories, Inc.) in triplicate with SsoFast EvaGreen Supermix using specific primer mix to selectively amplify GFP or RFP sequence
to quantify mutated allele or wild type mRNA respectively, and 20 ng of cDNA template. Values for threshold cycle (Ct) determination were generated automatically by the Bio-Rad CFX Manager software 1.5. GAPDH was used as internal reference using the following primers:
Florescence Microscopy
Hek293 cells transiently transfected with reporter alleles and siRNA duplexes were fixed on coverslips in 3,7% paraformaldehyde for 10 minutes at room temperature. Coverslips were then washed in PBS with gentle shaking. The cells were washed several times in PBS and mounted on slides with mounting medium (Dako Fluorescent Mounting Medium, Dako North America, Inc, CA). Confocal microscopy was performed with a Leica TCS-SP2 digital scanning confocal microscope equipped with a HCX PL APO 40×/numerical aperture=1.25 oil immersion objective. We used the 488-nm Argon laser line for excitation of EmGFP and 594 nm He/Ne laser line for excitation of RFP. The pinhole diameter was kept at Airy 1. Images were exported to Adobe Photoshop CS3 (Adobe Systems, Mountain View, CA).
Immunoblotting
Hek293 cells transiently transfected with reporter alleles and siRNA duplexes or with reporter alleles and pAAV2.1-miRyRU10 or pAAV2.1-miRNAscramble have been lysated in RIPA buffer and total proteins extracted. Total proteins (30 μg/sample, quantified by the BCA assay) were resolved by SDS-gel electrophoresis, Mini PROTEAN TGX Stain-Free 4-15% gradient Gels (BIORAD) using 10× Tris/Glycine/SDS buffer (BIORAD), and blotted on 0,2 μm nitrocellulose using Trans Blot Turbo Transfer System (BIORAD). The membranes were probed with different antibodies: anti-FLAG (F3165, SIGMA), anti-HA (H3663, SIGMA) and anti-Actin (A1978, SIGMA) as reference protein. Secondary antibodies were conjugated with HRP (1:5000, Promega). Specific signals were developed using the Clarity Western ECL substrate (BIORAD) and detected using ChemiDoc MP Imaging System (BIORAD).
ECG Monitoring and Drug Testing
ECG radiotelemetry monitors (Data Sciences International) were implanted subcutaneously under general anaesthesia (Avertin 0.025 mg/kg). Body temperature was maintained at 37° C. by use of a thermally controlled heating pad (Harvard Apparatus). After 72 hours of recovery from surgery, phenotype characterization was performed. First, basal ECG was recorded for 10 minutes looking for the presence of arrhythmias. Subsequently, mice were injected with epinephrine and caffeine (2 and 120 mg/kg, respectively, by I.P.) to induce ventricular arrhythmias under a controlled stimulus. All animal were freely moving while ECG recordings were performed.
Isolation of Adult Mice Ventricular Myocytes
Ventricular myocytes were isolated using an established enzymatic digestion protocol (Hilal-Dandan et al., 2000) from RyR2 R4496C/+ heterozygous mice, RyR2 R4496C/+ heterozygous mice infected with AAV9-miRyR2-U10 and wild-type (WT) mice (8 weeks) of either sex.
Electrophysiological Recordings in Isolated Ventricular Myocytes
Cardiomyocytes were seeded on a glass bottom perfusion chamber mounted on the stage of an inverted microscope. After 5 minutes, the myocytes were bathed with the solution containing (in mmol/L): 140 NaCl, 4 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, and 5 glucose, pH 7.4, with NaOH. A thermostatically controlled heating ring surrounding the dish was used to maintain the bath solution at 35° C. Transmembrane potentials were recorded in whole cell current clamp mode using a MultiClamp 700B amplifier (Axon Instruments). Patch electrodes were pulled from borosilicate glass (WPI, Inc.) on a P-97 horizontal puller (Sutter Instruments). The electrodes had a resistance of 2 to 3 MΩ when filled with patch electrode solutions containing (in mmol/L): 120 potassium aspartate, 20 KCl, 1 MgCl2, 4 Na2 ATP, 0.1 GTP, 10 HEPES, 10 glucose, pH 7.2, with NaOH. All signals were acquired at 10 kHz (Digidata 1322A, Axon Instruments) and analyzed with the use of personal computer running pCLAMP version 9.2 software (Axon Instruments). Only quiescent, calcium-tolerant, rod-shaped cells with clear cross striations and a resting potential of less than or equal to −80 mV were used for electrophysiological recordings. Myocytes were electrically stimulated by intracellular current injection through patch electrodes using depolarizing pulses with duration of 3 ms and amplitude of 1.5 times the minimal current needed to evoke and action potential. The liquid junction potential between pipette and bath solution was calculated with pCLAMP software and corrected after experiments.
Vector Design and Production
The siRYR2-U10 siRNA duplex sequence, designed to target RYR2 mRNA (NM_023868.2) containing the R4496C mutation, was cloned into an artificial miRNA expression vector, BLOCK-iT™ Pol II miR RNAi Expression vector (Life Technologies, Cat. No: K4936-00), that allows continuous and long term expression of the silencing molecule. The cloning procedure was based on ligation of annealed oligonucleotides (5′TGCTGTAAAAGTTGCAAGCAAAATAGTTTTG 3′ (SEQ ID NO:129), 5′GCCACTGACTGACTATTTTGCGCAACTTTTAC 3′ (SEQ ID NO:130), 5′CCTGGTAAAAGTTGCGCAAAATAGTCAGTCA 3′ (SEQ ID NO:131), 5′GTGGCCAAAACTATTTTGCTTGCAACTTTTAC 3′ (SEQ ID NO:132) with the linearized vector (pcDNA™6.2-GW/EmGFPmiR-(Life Technologies, Cat. No: K4936-00)).
From the obtained plasmid, a fragment consisting in CMV promoter, EmGFP, premiRNA sequence and TKpolyA was amplified by PCR with specific primers (Forward: 5′ TAGCTAGCTGCTTCGCGATGTACGG 3′ (SEQ ID NO:133) and Reverse 5′ GTGAATTCGAACAAACGACCCAACACCCG 3′ (SEQ ID NO:134) including the NheI (Forward) and Eco RI (Reverse) cloning site and inserted into the pre-digested Nhe I-Eco RI sites adeno associated viral backbone vector pAAV-2.1 provided by the Adeno-Associated Virus (AAV) vector Core facility (Tigem, Napoli, Italy). All the used plasmids were sequenced.
The AAV production was done in collaboration with the Tigem core facility (http://www.tigem.it/core-facilities/adeno-associated-virus-aav-vector-core). The AAV vectors were produced using a transient transfection of 3 plasmids in 293 cells: pAd helper, pAAV rep-cap (packaging), pAAV Cis (including our insert, miRYR2, cloned in the pAAV2.1-CMV-eGFP plasmid MCS). The vectors were purified by CsCl centrifugation and undergo quality control such as Real Time PCR and Dot Blot analysis for physical titer, or Comassie staining of SDS PAGE to evaluate the presence and purity of capsid proteins, the infectivity (eGFP+ cells/ml, only for CMV-eGFP preps) and the sterility (for preps to be used in large animals). The service returned with a viral preparation in PBS with a total yield>1×1012 genome copies. All AAV stocks were frozen at −80° C. in single vial and thawed during the surgical procedure.
Electron Microscopy
Hearts isolated from WT, heterozygous RyR2 R4496C/+ and infected heterozygous RyR2R4496C/+ mice, were fixed by retrograde aortic perfusion with 3.5% glutaraldehyde in 0.1 mol/L NaCaCo buffer (pH 7.2) and analyzed. Small bundles of papillary muscles were post-fixed in 2% OsO4 in NaCaCo buffer for 2 hours and then block-stained in saturated uranyl acetate. After dehydration, specimens were embedded in an epoxy resin (Epon 812). Ultrathin sections were cut in a Leica Ultracut R microtome (Leica Micro system, Austria) using a Diatome diamond knife (Diatome Ltd. CH-2501 Biel, Switzerland) and double stained with uranyl acetate and lead citrate. All sections were examined with an FP 505 Morgagni Series 268D electron microscope (FEI Company, Brno, Czech Republic), equipped with Megaview III digital camera and Soft Imaging System (Munster, Germany). The percentage of cardiac cells exhibiting severe structural alterations was quantified. Cells considered severely damaged are characterized by severe structural abnormalities affecting mitochondria in the majority of the interior. In most cases cardiac cells with severely altered mitochondria also present large area of apparently empty cytoplasmic spaces and alterations affecting contractile elements.
The following abbreviations have been used in the present specification: CASQ2, calsequestrin 2; CPVT, Catecholaminergic Polymorphic Ventricular Tachycardia; CICR, Calcium Induced Calcium Release; CRU, calcium release unit; DAD, Delayed afterdepolarization; EC coupling, excitation-contraction coupling; ECG, electrocardiogram; CMV, Citomegalovirus; GFP, green fluorescent protein; RFP, red fluorescent protein; AAV, Adeno Associated Virus; EP, electrophysiology; I.P., intraperitoneal; ISO, isoproterenol; RYR2, ryanodine receptor type 2; WT, Wild type; siRNA, small interfering RNA; miRNA, microRNA; SNP, Single Nucleotide Polimorphisms; HA, Human influenza hemagglutinin; MRS, Mutant Recognition Site; RNAi, RNA interference; TK polyA, HSV thymidine kinase (TK) polyadenylation signal sequence.
| Number | Date | Country | |
|---|---|---|---|
| 62295168 | Feb 2016 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 16077835 | Aug 2018 | US |
| Child | 18175401 | US |
