Patent Application
20240011027
Sequence Listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing is HRVY-166-301_ST25.txt. The text file is 28 KB, was created on Sep. 25, 2023, and is being submitted electronically via EFS-Web, concurrent with the filing of the specification.
Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by the selective loss of both upper and lower motor neurons (1). Patients with ALS experience progressive paralysis and develop difficulties in speaking, swallowing, and eventually breathing (2, 3) and usually succumb to the disease after 1-5 years from the time of diagnosis. Aside from two FDA approved drugs which modestly alter disease progression (4), treatment for ALS is limited to supportive care. ALS is now recognized to be on the same clinical and pathological spectrum as frontotemporal dementia (FTD), the most common cause of pre-senile dementia. FTD is characterized by behavioral changes, language impairment, and loss of executive functions (5) for which there is no effective treatment. Although the etiology of most ALS and FTD cases remains unknown, pathological findings and family-based linkage studies have demonstrated that there is overlap in molecular pathways involved in both diseases (1, 6).
TDP-43 is a predominantly nuclear DNA/RNA-binding protein with functional roles in transcriptional regulation, splicing, pre-microRNA processing, stress granule formation, and messenger RNA transport and stability. TDP-43 has been found to be a major constituent of inclusions in many sporadic cases of ALS and FTD. In response to aberrant expression of TDP-43, a decrease in STMN2 levels is seen. STMN2, also known as SCG10, is a regulator of microtubule stability and has been shown to encode a protein necessary for normal human motor neuron outgrowth and repair. Described herein are methods and compositions for restoring or increasing STMN2 levels.
Disclosed herein are antisense oligonucleotides that specifically bind an STMN2 mRNA, pre-mRNA, or nascent RNA sequence, thereby suppressing or preventing inclusion of an abortive or altered STMN2 RNA sequence. In some embodiments the antisense oligonucleotides do not bind to a polyadenylation site of the STMN2 RNA sequence. In some embodiments, the abortive or altered STMN2 RNA sequence occurs and increases in abundance when TDP-43 function declines or TDP-pathology occurs.
Also disclosed herein are antisense oligonucleotides that specifically bind an STMN2 mRNA, pre-mRNA, or nascent RNA sequence coding for a cryptic exon, thereby suppressing or preventing inclusion of a cryptic exon in STMN2 RNA, wherein the antisense oligonucleotide does not bind to a polyadenylation site of the STMN2 mRNA, pre-mRNA, or nascent RNA sequence.
Further disclosed herein are antisense oligonucleotides that specifically bind an STMN2 mRNA, pre-mRNA, or nascent RNA sequence, wherein the antisense oligonucleotide increases STMN2 protein expression.
In some embodiments, the antisense oligonucleotide is designed to target a 5′ splice site, a 3′ splice site, or a normal TDP-43 binding site. In some embodiments, the antisense oligonucleotide targets one or more splice sites. In some embodiments, the antisense oligonucleotide is designed to target a single stranded region located between the TDP-43 binding site and the polyadenylation site.
In some embodiments, the antisense oligonucleotide does not exhibit platelet toxicity.
Also disclosed herein are antisense oligonucleotides comprising a sequence selected from the group consisting of SEQ ID NOS: 37-85. In some aspects, the antisense oligonucleotides comprising a sequence selected from the group consisting of SEQ ID NOS: 37-74. In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of: SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78, or more specifically the antisense oligonucleotide may comprise SEQ ID NO: 52. In certain embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73, or more specifically the antisense oligonucleotide comprises SEQ ID NO: 73 or SEQ ID NO: 53.
Further disclosed herein are pharmaceutical compositions comprising one or more antisense oligonucleotides comprising a sequence selected from the group consisting of SEQ ID NOS: 37-85. In some embodiments, the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOS: 37-74. In some embodiments, the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of: SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78, or more specifically the one or more antisense oligonucleotides may comprise SEQ ID NO: 52. In certain embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73, or more specifically the antisense oligonucleotide comprises SEQ ID NO: 73 or SEQ ID NO: 53.
Disclosed herein are pharmaceutical compositions comprising a multimeric oligonucleotide. The multimeric oligonucleotide comprises one or more sequences selected from the group consisting of SEQ ID NOS: 37-85. In some embodiments, the multimeric oligonucleotide comprises two or more sequences selected from the group consisting of SEQ ID NOS: 37-85. The multimeric oligonucleotide may comprise multiple copies of a sequence, or alternatively may comprise single copies of multiple sequences.
In some embodiments, the antisense oligonucleotide suppresses or prevents inclusion of a cryptic exon in STMN2 RNA. In some embodiments, the antisense oligonucleotide specifically binds an STMN2 RNA, pre-mRNA, or nascent RNA sequence, e.g., coding for a cryptic exon. In some embodiments, the antisense oligonucleotide prevents or retards the degradation of STMN2 protein. In some embodiments, the antisense oligonucleotide increases STMN2 protein. In some embodiments, the antisense oligonucleotide is designed to target a 5′ splice site, a 3′ splice site, or a normal TDP-43 binding site. In some embodiments, the antisense oligonucleotide is designed to target a single stranded region, e.g., a single stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the antisense oligonucleotide is designed to target a site proximal to a cryptic splice site, a site proximal to a premature polyadenylation site, or a site located between a cryptic splice site and a premature polyadenylation site. In some embodiments, the antisense oligonucleotide binds to a target region within the cryptic exon that is unstructured. In some embodiments, the antisense oligonucleotide binds near or adjacent to the 5′ splice site regulated by TDP-43. In some embodiments, the antisense oligonucleotide targets a region proximal to a predicted TDP-43 binding site. In some embodiments, the antisense oligonucleotide targets the TDP-43 normal binding site. In some embodiments, the antisense oligonucleotide targets one or more splice sites. In some embodiments, the antisense oligonucleotide suppresses cryptic splicing.
In some embodiments, a pharmaceutical composition comprises two or more antisense oligonucleotides, and in some aspects comprises three or more antisense oligonucleotides. In some embodiments, the two or more antisense oligonucleotides are covalently linked. In some embodiments, the one or more antisense oligonucleotides increase STMN2 protein expression.
In some embodiments, a pharmaceutical composition further comprises an agent for treating a neurodegenerative disease, an agent for treating a traumatic brain injury, or an agent for treating a proteasome-inhibitor induced neuropathy. In some embodiments, a pharmaceutical composition further comprises STMN2 as a gene therapy. In some embodiments, a pharmaceutical composition further comprises a JNK inhibitor.
Also disclosed herein are methods of treating or reducing the likelihood of a disease or condition associated with a decline in TAR DNA-binding protein 43 (TDP-43) functionality in neuronal cells in a subject in need thereof. The methods may include contacting the neuronal cells with an antisense oligonucleotide that corrects reduced levels of STMN2 protein, wherein the agent does not target a polyadenylation site of a target transcript.
Further disclosed herein are methods of treating or reducing the likelihood of a disease or condition associated with a decline in TAR DNA-binding protein 43 (TDP-43) functionality in neuronal cells in a subject in need thereof. The methods may include contacting the neuronal cells with an antisense oligonucleotide that increases STMN2 protein expression.
In some embodiments, the antisense oligonucleotide specifically binds an STMN2 RNA, pre-RNA, or nascent RNA sequence coding for a cryptic exon. In some embodiments, the antisense oligonucleotide is designed to target a 5′ splice site, a 3′ splice site, or a normal TDP-43 binding site. In some embodiments, the antisense oligonucleotide is designed to target a single stranded region, e.g., a single stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the antisense oligonucleotide is designed to target a site proximal to a cryptic splice site, a site proximal to a premature polyadenylation site, or a site located between a cryptic splice site and a premature polyadenylation site. In some embodiments, the antisense oligonucleotide binds to a target region within the cryptic exon that is unstructured. In some embodiments, the antisense oligonucleotide binds near or adjacent to the 5′ splice site regulated by TDP-43. In some embodiments, the antisense oligonucleotide targets a region proximal to a predicted TDP-43 binding site. In some embodiments, the antisense oligonucleotide is designed to target one or more splice sites. In some embodiments, the antisense oligonucleotide restores normal length or protein coding STMN2 pre-mRNA or mRNA.
In some embodiments, the subject exhibits improved neuronal outgrowth and repair. In some embodiments, the disease or condition is a neurodegenerative disease, e.g., amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), inclusion body myositis (IBM), Parkinson's disease, or Alzheimer's disease. In some embodiments, the disease or condition is a traumatic brain injury. In some embodiments, the disease or condition is a proteasome-inhibitor induced neuropathy. In some embodiments, the disease or condition is associated with mutant or reduced levels of TDP-43 in neuronal cells.
In some embodiments, the methods further comprise administering an effective amount of a second agent to the subject. In some embodiments, a second agent is administered to treat a neurodegenerative disease or a traumatic brain injury. In some embodiments, the second agent is STMN2, e.g., administered as a gene therapy.
Also disclosed herein are methods of treating or reducing the likelihood of a disease or condition associated with a decline in TAR DNA-binding protein 43 (TDP-43) functionality in neuronal cells in a subject in need thereof. The methods may include contacting the neuronal cells with an antisense oligonucleotide that corrects reduced levels of STMN2 protein, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOS: 37-85.
In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOS: 37-74. In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78, or more specifically the antisense oligonucleotide may comprise SEQ ID NO: 52. In certain embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73, or more specifically the antisense oligonucleotide comprises SEQ ID NO: 73 or SEQ ID NO: 53.
Further disclosed herein are methods of reducing the likelihood of a disease or condition associated with a decline in TAR DNA-binding protein 43 (TDP-43) functionality in neuronal cells in a subject in need thereof. The methods may include contacting the neuronal cells with one or more antisense oligonucleotides that suppress or prevents inclusion of a cryptic exon in STMN2 RNA. In some embodiments, the one or more antisense oligonucleotides comprise a sequence selected from the group consisting of SEQ ID NOS: 37-85.
In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of: SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78, or more specifically comprises SEQ ID NO: 52. In certain embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73, or more specifically the antisense oligonucleotide comprises SEQ ID NO: 73 or SEQ ID NO: 53.
In some embodiments, the antisense oligonucleotide specifically binds an STMN2 RNA, pre-RNA, or nascent RNA sequence coding for a cryptic exon. In some embodiments, the antisense oligonucleotide is designed to target a 5′ splice site, a 3′ splice site, or a normal TDP-43 binding site. In some embodiments, the antisense oligonucleotide is designed to target a single stranded region, e.g., a single stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the antisense oligonucleotides are designed to target a site proximal to a cryptic splice site, a site proximal to a premature polyadenylation site, or a site located between a cryptic splice site and a premature polyadenylation site. In some embodiments, the antisense oligonucleotides bind to a target region within the cryptic exon that is unstructured. In some embodiments, the antisense oligonucleotide binds near or adjacent to the 5′ splice site regulated by TDP-43. In some embodiments, the antisense oligonucleotide targets a region proximal to a predicted TDP-43 binding site. In some embodiments, the antisense oligonucleotide targets the TDP-43 normal binding site.
In some embodiments, the disease or condition is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), inclusion body myositis (IBM), Parkinson's disease, and Alzheimer's disease. In some embodiments, the disease or condition is a traumatic brain injury. In some embodiments, the disease or condition is a proteasome-inhibitor induced neuropathy.
In some embodiments, the antisense oligonucleotide suppresses cryptic splicing. In some embodiments, the antisense oligonucleotide prevents or retards the degradation of STMN2 protein. In some embodiments, the subject exhibits improved neuronal outgrowth and repair.
In some embodiments, the methods further include administering an effective amount of a second agent to the subject. In some embodiments, the second agent is administered to treat a neurodegenerative disease or a traumatic brain injury.
Further disclosed herein are methods of treating or reducing the likelihood of a disease or condition associated with a decline in TAR DNA-binding protein 43 (TDP-43) functionality in neuronal cells in a subject in need thereof, comprising contacting the neuronal cells with a multimeric oligonucleotide that corrects reduced levels of STMN2 protein, wherein the multimeric oligonucleotide comprises two or more antisense oligonucleotides selected from the group consisting of SEQ ID NOS: 37-85. In some embodiments, the multimeric oligonucleotide comprises two or more antisense oligonucleotides selected from the group consisting of SEQ ID NOS: 37-74.
Also disclosed herein are antisense oligonucleotides that corrects reduced levels of STMN2 protein, wherein the antisense oligonucleotide is designed to target an unstructured region within a cryptic exon. In some embodiments, the unstructured region within the cryptic exon is located between a cryptic splice site and a premature polyadenylation site.
Also disclosed herein are methods of detecting altered levels of STMN2 or ELAVL3 protein in a subject. The methods comprise obtaining a sample from the subject; and detecting whether the STMN2 or ELAVL3 protein levels are altered. In some embodiments, the subject has amyotrophic lateral sclerosis. In some embodiments, the detection of whether the STMN2 or ELAVL3 levels are altered comprises determining if the STMN2 or ELAVL3 levels are decreased (e.g., using an ELISA). In some embodiments, the sample is a biofluid sample (e.g., a CSF sample).
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
Mislocalization or depletion of the RNA-binding protein TDP-43 results in decreased expression of STMN2, which encodes a microtubule regulator. STMN2 is essential for normal axonal outgrowth and regeneration. Decreased TDP-43 function causes an abortive or altered STMN2 RNA sequence which results in reduced STMN2 protein expression. STMN2 may be a promising therapeutic target and biomarker of disease risk (e.g., neurodegenerative diseases).
Work described herein relates to compositions and methods for suppressing or preventing the inclusion of a cryptic exon in STMN2 mRNA. The inclusion of a cryptic exon in STMN2 mRNA may lead to a truncated transcript and protein. In some aspects the inclusion of the cryptic exon leads to early polyadenylation. STMN2 expression may be restored through suppression of a cryptic splicing form of STMN2 that occurs when TDP-43 becomes sequestered or is reduced in functionality, such as by blocking the occurrence or accumulation of the cryptic form and converting it back to or restoring functional STMN2 RNA (e.g., by administration of an antisense oligonucleotide). In addition, work described herein relates to compositions and methods for increasing protein synthesis of STMN2, i.e., increasing STMN2 protein expression.
The disclosure contemplates agents (e.g., antisense oligonucleotides) that specifically bind an STMN2 mRNA, pre-mRNA, or nascent RNA sequence that occurs and increases in abundance when TDP-43 function declines or TDP-pathology occurs, thereby suppressing or preventing inclusion of an abortive or altered STMN2 RNA sequence. In some aspects, agents prevent degradation of STMN2 protein. In some aspects, agents restore STMN2 protein levels. In some aspects, an agent suppresses or prevents inclusion of a cryptic exon in STMN2 RNA. In certain aspects an agent specifically binds an STMN2 mRNA, pre-mRNA, or nascent RNA sequence coding for a cryptic exon.
In some aspects, the disclosure further contemplates agents (e.g., antisense oligonucleotides) that specifically bind an ELAVL3 mRNA, pre-mRNA, or nascent RNA sequence. ELAVL3 may be downregulated when TDP-43 function declines or TDP-pathology occurs. In some aspects, an agent suppresses or prevents cryptic splicing of ELAVL3.
In some embodiments, the agent (e.g., an antisense oligonucleotide) binds to an STMN2 RNA sequence (e.g., an abortive or altered STMN2 RNA sequence). In some aspects the binding of an agent to a short abortive or altered STMN2 RNA sequence results in continued production by the RNA polymerase. For example, the agent may directly suppress premature transcriptional termination at the polyadenylation site of the cryptic exon or may mimic the activity of TDP-43 binding at its target site, thereby altering transcriptional termination at the cryptic exon. In some aspects, the agent suppresses or prevents inclusion of a cryptic exon in STMN2 RNA. In some aspects the agent prevents degradation of STMN2 protein. In some aspects the agent increases STMN2 levels (e.g., through exon skipping). In some aspects the agent restores normal length or protein coding STMN2 RNA (e.g., pre-mRNA or mRNA). In some aspects the agent increases the amount or activity of STMN2 RNA. In some aspects the agent increases protein expression of STMN2.
The terms “increased” or “increase” are used herein to generally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms “increased”, or “increase” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold, or at least about a 10-fold increase, or any increase between 2-fold and or greater as compared to a reference level.
In some aspects the agent increases the amount or activity of STMN2 RNA by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold. In some aspects the agent increases STMN2 protein expression by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, or at least about 10-fold.
In some embodiments an agent (e.g., an antisense oligonucleotide) targets one or more sites, for example, a 5′ splice site, a 3′ splice site, a normal binding site, and/or a polyadenylation site of the STMN2 transcript. In some aspects an agent targets one or more sites for example a site proximal to a 5′ splice site, a site proximal to a 3′ splice site, a site proximal to a normal binding site, and/or a site proximal to a polyadenylation of the STMN2 transcript. In certain embodiments an agent targets one or more sites including a 5′ splice site regulated by TDP-43, a TDP-43 normal binding site, and/or a cryptic polyadenylation site. In some embodiments, an agent targets a single stranded site. In certain embodiments, an agent targets a single stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the agent targets a site proximal to a cryptic splice site. In some embodiments, the agent targets a site proximal to a premature polyadenylation site. In some embodiments, the agent targets a region located between the cryptic splice site and the premature polyadenylation site. In some embodiments the agent does not target or bind to the polyadenylation site. In some embodiments the agent does not target or bind to the polyadenylation site of the STMN2 transcript. In some embodiments the agent does not target or bind to the cryptic polyadenylation site. In some aspects an agent targets and promotes the splicing of STMN2 Exon 2 to Exon 1.
STMN2 Exon 1 may have a sequence of:
STMN2 Exon 2 may have a sequence of:
A cryptic exon may have a sequence of:
Exemplary types of agents that can be used include small organic or inorganic molecules; saccharines; oligosaccharides; polysaccharides; a biological macromolecule selected from the group consisting of peptides, proteins, peptide analogs and derivatives; peptidomimetics; nucleic acids selected from the group consisting of siRNAs, shRNAs, antisense RNAs, ribozymes, and aptamers; an extract made from biological materials selected from the group consisting of bacteria, plants, fungi, animal cells, and animal tissues; naturally occurring or synthetic compositions; antibodies; and any combination thereof.
In some embodiments the agent is an oligonucleotide, protein, or a small molecule. In some embodiments the agent comprises one or more oligonucleotides. In some aspects the oligonucleotide is a splice-switching oligonucleotide. In certain aspects the oligonucleotide is an antisense oligonucleotide (ASO). In some embodiments the agent is not an antisense oligonucleotide. In some embodiments the agent is a small molecule (e.g., Branaplam (Novartis) or Risdiplam (Roche)) capable of binding to the target site (e.g., the STMN2 transcript) and shifting the metabolism of the target.
In some embodiments the agent is an oligonucleotide, protein, or a small molecule. In some embodiments the agent comprises one or more oligonucleotides. Agents comprising multiple oligonucleotides may be considered multimeric compounds. In some aspects the agent comprises one or more copies of an oligonucleotide. In some aspects the agent comprises one or more copies of multiple oligonucleotides. In some aspects, multiple oligonucleotides may be covalently linked. In some aspects the oligonucleotide is a splice-switching oligonucleotide. In certain aspects the oligonucleotide is an antisense oligonucleotide (ASO). In some embodiments the agent is a small molecule (e.g., Branaplam (Novartis) or Risdiplam (Roche)) capable of binding to the target site (e.g., the STMN2 transcript) and shifting the metabolism of the target. In some aspects the agent does not exhibit toxicity, e.g., platelet toxicity.
An agent may target one or more of a 5′ splice site, a 3′ splice site, a normal binding site, or a polyadenylation site. In some aspects an agent targets one or more of a site proximal to a 5′ splice site, a site proximal to a 3′ splice site, a site proximal to a normal binding site, and/or a site proximal to a polyadenylation of the STMN2 transcript. In some embodiments, the agent targets a site proximal to a cryptic splice site. In some embodiments, the agent targets a site proximal to a premature polyadenylation site. In some embodiments, the agent targets a single stranded region of the STMN2 transcript. In some embodiments, the agent targets a single stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the agent targets a region located between the cryptic splice site and the premature polyadenylation site. In some aspects the polyadenylation site is the polyadenylation site of the STMN2 transcript. In some aspects the polyadenylation site is the polyadenylation site of the cryptic exon (e.g., is a cryptic polyadenylation site). In some embodiments an agent does not target a 5′ splice site (e.g., a TDP-43 5′ splice site). In some embodiments an agent does not target a normal binding site (e.g., a normal TDP-43 binding site). In some embodiments an agent does not target a polyadenylation site (e.g., a cryptic polyadenylation site). In some aspects, a
In certain embodiments an antisense oligonucleotide may target one or more of a 5′ splice site, a 3′ splice site, a normal binding site, or a polyadenylation site. In some embodiments an antisense oligonucleotide does not target a 5′ splice site (e.g., a TDP-43 5′ splice site). In certain aspects an antisense oligonucleotide targets one or more of a site proximal to a 5′ splice site, a site proximal to a 3′ splice site, a site proximal to a normal binding site, and/or a site proximal to a polyadenylation of the STMN2 transcript. In some embodiments an antisense oligonucleotide targets a single stranded region of the STMN2 transcript. In certain embodiments, the antisense oligonucleotide targets a single stranded region located between the TDP-43 binding site and the polyadenylation site. In some embodiments, the antisense oligonucleotide targets a site proximal to a cryptic splice site, e.g., targets a site −1 of a cryptic splice site. In some embodiments, the antisense oligonucleotide targets a site proximal to a premature polyadenylation site. In some embodiments, the antisense oligonucleotide targets a region located between the cryptic splice site and the premature polyadenylation site. In some aspects, the antisense oligonucleotide targets a region +90 to +105, or more specifically +94 or +101, relative to a cryptic splice junction. In some embodiments an antisense oligonucleotide does not target a normal binding site (e.g., a normal TDP-43 binding site). In some embodiments an antisense oligonucleotide does not target a polyadenylation site (e.g., a cryptic polyadenylation site).
In certain embodiments an antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOS: 37-85. In some embodiments an antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOS: 37-74. In some aspects, the antisense oligonucleotide comprises a sequence selected from the group consisting of: SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO:50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78. In certain aspects, the antisense oligonucleotide comprises SEQ ID NO: 52. In some embodiments, the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. In one embodiment, the antisense oligonucleotide comprises SEQ ID NO: 73. In one embodiment, the antisense oligonucleotide comprises SEQ ID NO: 53. In one embodiment, the antisense oligonucleotide comprises SEQ ID NO: 72.
Table 1 provides a listing of exemplary antisense oligonucleotides, and in some instances, the corresponding target site within the STMN2 intron. The underlined bases within SEQ ID NOS: 93-108 represent bases flanking the cryptic splice site. The underlined bases within SEQ ID NOS: 112-114 represent the binding site of TDP-43 protein. The oligonucleotides described herein were synthesized with multiple chemical modifications. For example, the antisense oligonucleotides of SEQ ID NOS: 37-74 were made fully modified with MOE sugars having the following structure:
and phosphorothioate linkages. Additional modifications may also be tested.
G GACTCGGCAGAAGACCT
GACTCGGCAGAAGACCTT
TGTGTGAGCATGTGTGCGTGTGTG
Oligonucleotides (e.g., antisense oligonucleotides) may be designed to bind mRNA regions that prevent ribosomal assembly at the 5′ cap, prevent polyadenylation during mRNA maturation, or affect splicing events (Bennett and Swayze, Annu. Rev. Phamacol. Toxicol., 2010; Watts and Corey, J. Pathol., 2012; Kole et al., Nat. Rev. Drug Discov., 2012; Saleh et al, In Exon Skipping: Methods and Protocols, 2012, each incorporated herein by reference). In some aspects, an oligonucleotide (e.g., an antisense oligonucleotide) is designed to target one or more sites including, for example, the 5′ TDP-3 splice site or the TDP-43 normal binding site. In some aspects, the oligonucleotide targets one or more splice sites. In some aspects, the oligonucleotide targets one or more of the 5′ splice site regulated by TDP-43 or the TDP-43 normal binding site. In some aspects, an antisense oligonucleotide is designed to not target a polyadenylation site (e.g., a cryptic polyadenylation site). In some aspects, the oligonucleotide targets an unstructured region located between the cryptic splice site and the polyadenylation site (see
Antisense oligonucleotides are small sequences of DNA (e.g., about 8-50 base pairs in length) able to target RNA transcripts by Watson-Crick base pairing, resulting in reduced or modified protein expression. Oligonucleotides are composed of a phosphate backbone and sugar rings. In some embodiments oligonucleotides are unmodified. In other embodiments oligonucleotides include one or more modifications, e.g., to improve solubility, binding, potency, and/or stability of the antisense oligonucleotide. Modified oligonucleotides may comprise at least one modification relative to unmodified RNA or DNA. In some embodiments, oligonucleotides are modified to include internucleoside linkage modifications, sugar modifications, and/or nucleobase modifications. Examples of such modifications are known to those of skill in the art.
In some embodiments the oligonucleotide is modified by the substitution of at least one nucleotide with a modified nucleotide, such that in vivo stability is enhanced as compared to a corresponding unmodified oligonucleotide. In some aspects, the modified nucleotide is a sugar-modified nucleotide. In another aspect, the modified nucleotide is a nucleobase-modified nucleotide.
In some embodiments, oligonucleotides, may contain at least one modified nucleotide analogue. The nucleotide analogues may be located at positions where the target-specific activity, e.g., the splice site selection modulating activity is not substantially affected, e.g., in a region at the 5′-end and/or the 3′-end of the oligonucleotide molecule. In some aspects, the ends may be stabilized by incorporating modified nucleotide analogues.
In some aspects preferred nucleotide analogues include sugar- and/or backbone-modified ribonucleotides (i.e., include modifications to the phosphate-sugar backbone). For example, the phosphodiester linkages of a ribonucleotide may be modified to include at least one of a nitrogen or sulfur heteroatom. In preferred backbone-modified ribonucleotides the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g., of phosphothioate group. In preferred sugar-modified ribonucleotides, the 2′ OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2 or ON, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
In some embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In some embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In some embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, modified oligonucleotides comprise at least two of: one or more modified nucleosides comprising a modified sugar moiety, one or more modified nucleosides comprise a modified nucleobase, and one or more modified internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety, one or more modified nucleosides comprise a modified nucleobase, and one or more modified internucleoside linkages.
Sugar Modifications
In some embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In some embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In some embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
In some embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.
In some embodiments, modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In some aspects the bicyclic sugar moiety comprises a bridge between the 4′ and 2′ furanose ring atoms.
In some aspects bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configurations. In some embodiments, an LNA nucleoside is in the a-L configuration. In some embodiments, an LNA nucleoside is in the β-D configuration.
In some embodiments an oligonucleotide modification includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 3′ or 4′ carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. The linkage is preferably a methelyne (—CH2)n group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226, the entire contents of which are incorporated by reference herein.
In some embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).
In some embodiments, modified sugar moieties are sugar surrogates. In some aspects the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon, or nitrogen atom. In some aspects such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. In some aspects sugar surrogates comprise rings having other than 5 atoms. In certain aspects a sugar surrogate comprises a six-membered tetrahydropyran (THP). In some aspects sugar surrogates comprise acyclic moieties.
Nucleobase Modifications
Modified oligonucleotides may comprise one or more nucleosides comprising an unmodified nucleobase. In some embodiments modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In some embodiments, modified oligonucleotides comprise one or more nucleosides that does not comprise a nucleobase.
In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C° C.-C]¾) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Also preferred are nucleobase-modified ribonucleotides, i.e., ribonucleotides, containing at least one non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Examples of modified nucleobases include, but are not limited to, uridine and/or cytidine modifications at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and/or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl adenosine. Oligonucleotide reagents of the invention also may be modified with chemical moieties that improve the in vivo pharmacological properties of the oligonucleotide reagents.
Internucleoside Modifications
In some embodiments, nucleosides of modified oligonucleotides are linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorous atom. Representative phosphorus-containing internucleo side linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS-P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH2—N(CH3)—O—CH2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2—O—); and N,N′-dimethylhydrazine (—CH2—N(CH3)—N(CH3)—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
Additional modifications are known by those of skill in the art and examples can be found in WO 2019/241648, U.S. Pat. Nos. 10,307,434, 9,045,518, and 10,266,822, each of which is incorporated herein by reference.
Oligonucleotides may be of any size and/or chemical composition sufficient to target the abortive or altered STMN2 RNA. In some embodiments, an oligonucleotide is between about 5-300 nucleotides or modified nucleotides. In some aspects an oligonucleotide is between about 10-100, 15-85, 20-70, 25-55, or 30-40 nucleotides or modified nucleotides. In certain aspects an oligonucleotide is between about 15-35, 20-25, 25-30, or 30-35 nucleotides or modified nucleotides.
In some embodiments, an oligonucleotide and the target RNA sequence (e.g., the abortive or altered STMN2 RNA) have 100% sequence complementarity. In some aspects an oligonucleotide may comprise sequence variations, e.g., insertions, deletions, and single point mutations, relative to the target sequence. In some embodiments, an oligonucleotide has at least 70% sequence identity or complementarity to the target RNA (e.g., STMN2 mRNA, pre-mRNA, or nascent RNA). In certain embodiments, an oligonucleotide has at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to the target sequence.
An antisense oligonucleotide targeting the abortive or altered STMN2 RNA sequence (e.g., STMN2 mRNA, pre-mRNA, or nascent RNA sequence) may be designed by any methods known to those of skill in the art. In certain aspects one or more oligonucleotides are synthesized.
In some embodiments, STMN2 is administered as a gene therapy. In some embodiments STMN2 is administered in combination with an agent described herein.
In some embodiments an agent is an inhibitor of c-Jun N-terminal kinase (JNK). In some aspects a JNK inhibitor is selected from the group consisting of small organic or inorganic molecules; saccharines; oligosaccharides; polysaccharides; a biological macromolecule selected from the group consisting of peptides, proteins, peptide analogs and derivatives; peptidomimetics; nucleic acids selected from the group consisting of siRNAs, shRNAs, antisense RNAs, ribozymes, and aptamers; an extract made from biological materials selected from the group consisting of bacteria, plants, fungi, animal cells, and animal tissues; naturally occurring or synthetic compositions; antibodies; and any combination thereof. In certain aspects the agent is a small molecule inhibitor, an oligonucleotide (e.g., designed to reduce expression of JNK), or a gene therapy (e.g., designed to inhibit JNK). In some aspects inhibition of JNK restores or increases STMN2 protein levels. In certain embodiments the agent is an oligonucleotide (e.g., an antisense oligonucleotide) targeting JNK.
The disclosure further contemplates pharmaceutical compositions comprising the agent (e.g., the antisense oligonucleotide) that binds an abortive or altered STMN2 RNA sequence. In some embodiments, the pharmaceutical composition comprises the agent that binds an STMN2 mRNA, pre-mRNA, or nascent RNA sequence coding for a cryptic exon. In some embodiments pharmaceutical compositions comprise the agent that prevents degradation of an STMN2 protein. In some embodiments pharmaceutical compositions comprise the agent that increases expression of STMN2 protein, e.g., activates STMN2 protein expression. In some aspects the composition comprises an oligonucleotide, protein, or small molecule. In some embodiments the composition comprises an oligonucleotide (e.g., an antisense oligonucleotide), wherein the oligonucleotide specifically binds an STMN2 mRNA, pre-mRNA, or nascent RNA sequence coding for a cryptic exon. In some aspects the agent (e.g., the antisense oligonucleotide) suppresses or prevents inclusion of a cryptic exon in STMN2 RNA. In some aspects the agent suppresses cryptic splicing.
In some embodiments, a pharmaceutical composition comprises an agent (e.g., an antisense oligonucleotide) that targets one or more sites, e.g., one or more splice sites, binding sites, or polyadenylation sites. In some embodiments, a pharmaceutical composition comprises an agent that targets one or more splice sites (e.g., 5′ splice site regulated by TDP-43). In some embodiments, a pharmaceutical composition comprises an agent that targets a normal binding site (e.g., a TDP-43 normal binding site). In some embodiments, a pharmaceutical composition comprises an agent that targets a polyadenylation site (e.g., a cryptic polyadenylation site). In some embodiments, a pharmaceutical composition comprises an agent that targets a site proximal to a cryptic splice site or a site proximal to a polyadenylation site (e.g., a premature polyadenylation site). In some embodiments, a pharmaceutical composition comprises an agent that targets a site located between a cryptic splice site and a polyadenylation site. In some embodiments, a pharmaceutical composition comprises an agent that does not target one or more splice sites (e.g., 5′ splice site regulated by TDP-43). In some embodiments, a pharmaceutical composition comprises an agent that does not target a normal binding site (e.g., a TDP-43 normal binding site). In some embodiments, a pharmaceutical composition comprises an agent that does not target a polyadenylation site (e.g., a cryptic polyadenylation site).
In some aspects a pharmaceutical composition comprises a multimeric compound, e.g., a compound comprising two or more antisense oligonucleotides. The two or more antisense oligonucleotides may comprise two or more antisense oligonucleotides having the same sequence, or alternatively, may comprise two or more antisense oligonucleotides having different sequences. In some aspects, the two or more antisense oligonucleotides are covalently linked. In some aspects, a pharmaceutical composition comprises two or more antisense oligonucleotides. The two more antisense oligonucleotides may comprise a combination of multiple copies of the same antisense oligonucleotide and/or individual copies of multiple different antisense oligonucleotides.
In certain embodiments a pharmaceutical composition comprises an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NOS: 37-85. In some embodiments, a pharmaceutical composition comprises an antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOS: 37-74. In some aspects, the pharmaceutical composition comprises an antisense oligonucleotide comprising a sequence selected from the group consisting of: SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78. In certain aspects, the pharmaceutical composition comprises antisense oligonucleotide comprising SEQ ID NO: 52. In some embodiments, the pharmaceutical composition comprises an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. In certain embodiments, the pharmaceutical composition comprises an antisense oligonucleotide comprising SEQ ID NO: 73.
In some embodiments a pharmaceutical composition comprises an effective amount of an agent (e.g., an antisense oligonucleotide) that binds an STMN2 mRNA sequence coding for a cryptic exon and an effective amount of a second agent. In some aspects the second agent is an agent that treats or inhibits a neurodegenerative disorder. In some aspects the second agent is an agent that treats or inhibits a traumatic brain injury. In some aspects the second agent is an agent that treats or inhibits a proteasome inhibitor induced neuropathy.
In some embodiments a pharmaceutical composition comprises an effective amount of an agent (e.g., an antisense oligonucleotide) that binds to an abortive or altered STMN2 RNA sequence and an effective amount of STMN2 (e.g., administered as a gene therapy).
In some embodiments a pharmaceutical composition comprises an effective amount of a first agent (e.g., an antisense oligonucleotide) that binds to an abortive or altered STMN2 RNA sequence and a second agent that inhibits JNK.
In some embodiments a pharmaceutical composition comprises an effective amount of an agent (e.g., an antisense oligonucleotide) that binds an STMN2 mRNA, pre-mRNA, or nascent RNA sequence coding for a cryptic exon, an effective amount of a second agent, and a pharmaceutically acceptable carrier, diluent, or excipient.
The compositions comprising the agent (e.g., the antisense oligonucleotide) that binds to an abortive or altered STMN2 RNA sequence can be used for treating a disease or condition associated with a decline in TDP-43 function or a TDP-pathology. In some aspects the compositions comprising the agent (e.g., the antisense oligonucleotide) that binds to an abortive or altered STMN2 RNA sequence can be used for treating a disease or condition associated with mutant or reduced levels of STMN2 protein (e.g., in neuronal cells) as described herein.
The disclosure contemplates various methods of treatment utilizing compositions comprising an agent (e.g., antisense oligonucleotide) that restores normal length or protein coding STMN2 RNA. In some aspects, an agent (e.g., an antisense oligonucleotide) specifically binds a STMN2 mRNA, pre-mRNA, or nascent RNA sequence that occurs and increases in abundance when TDP-43 function declines or TDP-pathology occurs, thereby suppressing or preventing inclusion of an abortive or altered STMN2 RNA sequence. In some aspects, the agent restores expression of a normal full-length or protein coding STMN2 RNA. In some aspects an agent suppresses or prevents inclusion of a cryptic exon in STMN2 RNA. In some aspects, an agent activates protein expression of STMN2.
In some aspects, the disclosure contemplates the treatment of any disease or condition in which the disease is associated with a decline in TDP-43 function or a TDP-pathology. In some embodiments, the inventions disclosed herein relate to methods of treating mutant or reduced levels of TDP-43 in neuronal cells (e.g., a disease or condition having a TDP-43 associated pathology). In some embodiments, the inventions disclosed herein relate to methods of treating TDP-43 associated dementias (e.g., ALS, FTD, Alzheimer's, Parkinson's, or TBI).
In some embodiments, the inventions disclosed herein relate to methods of treating a disease or condition associated with mutant, increased, or reduced levels of TDP-43. In some embodiments, the inventions disclosed herein relate to methods of treating a disease or condition associated with mislocalized TDP-43. In some embodiments the inventions disclosed herein relate to methods of treating a disease or condition associated with mutant or reduced levels of STMN2 protein and/or mislocalization of STMN2 protein. In some embodiments, the inventions disclosed herein relate to methods of treating a disease or condition associated with proteasome-inhibitor induced neuropathies (e.g., neuropathies occurring as a result of reduced amounts of functional nuclear TDP-43). In some embodiments, the inventions disclosed herein relate to methods of treating neurodegenerative disorders. In some embodiments, the inventions disclosed herein relate to methods of treating disorders or conditions associated with or occurring as a result of a TBI (e.g., a concussion).
In some aspects mutant or reduced levels of TDP-43 (e.g., nuclear TDP-43) results in mutant or reduced levels of STMN2 protein. Mislocalization of TDP-43 may result in increased levels of TDP-43 in the cytosol, but decreased levels of nuclear TDP-43. In addition, STMN2 levels may be decreased as a result of mutations in TDP-43. In some aspects mutant or increased levels of TDP-43 (e.g., nuclear TDP-43) results in mutant or reduced levels of STMN2 protein.
In some aspects methods of treatment comprise increasing levels of and/or preventing degradation or retardation of STMN2 protein. In some aspects methods of treatment comprise correcting mutant or reduced levels of STMN2 protein. In some aspects methods of treating comprise increasing the amount or activity of STMN2 RNA. In some aspects methods of treating comprise increasing the amount of STMN2 protein, e.g., increasing activation of protein expression. In some aspects methods of treatment comprise suppressing or preventing inclusion of a cryptic exon in STMN2 RNA (e.g., STMN2 mRNA). In some aspects methods of treatment comprise rescuing neurite outgrowth and axon regeneration.
In some embodiments methods of treatment comprise administering an effective amount of an agent (e.g., an antisense oligonucleotide) to a subject, wherein the agent prevents degradation of STMN2 protein. In some embodiments methods of treatment comprise administering an effective amount of an agent to a subject, wherein the agent restores normal length or protein coding STMN2 RNA. In some embodiments methods of treatment comprise administering an effective amount of an agent to a subject, wherein the agent binds to an abortive or altered STMN2 RNA sequence. In some embodiments methods of treatment comprise administering an effective amount of an agent to a subject, wherein the agent suppresses or prevents inclusion of a cryptic exon in STMN2 RNA (e.g., in neuronal cells). In some aspects the agent increases STMN2 levels through exon skipping. In some aspects the agent is an oligonucleotide, protein, or small molecule. For example, the agent may be an oligonucleotide (e.g., an antisense oligonucleotide) that specifically binds an STMN2 mRNA, pre-mRNA or nascent RNA sequence coding for the cryptic exon.
In certain embodiments, methods of treatment comprise administering an effective amount an antisense oligonucleotide to a subject, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 37-85. In some aspects, methods of treatment comprise administering an effective amount an antisense oligonucleotide to a subject, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 37-74. In some embodiments, methods of treatment comprise administering an effective amount of an antisense oligonucleotide to a subject, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78. In some embodiments, methods of treatment comprise administering an effective amount of an antisense oligonucleotide to a subject, wherein the antisense oligonucleotide comprises SEQ ID NO: 52. In some embodiments, methods of treatment comprise administering an effective amount of an antisense oligonucleotide to a subject, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. In some embodiments, methods of treatment comprise administering an effective amount of an antisense oligonucleotide to a subject, wherein the antisense oligonucleotide comprises SEQ ID NO: 73. In some embodiments, methods of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's, Parkinson's, or TBI) comprises administering to a subject an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NOS: 37-85, or alternatively from the group consisting of SEQ ID NOS: 37-74. In some embodiments, methods of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's, Parkinson's, or TBI) comprises administering to a subject an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 78. In some embodiments, methods of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's, Parkinson's, or TBI) comprises administering to a subject an antisense oligonucleotide comprising SEQ ID NO: 52. In some embodiments, methods of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's, Parkinson's, or TBI) comprises administering to a subject an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 72, and SEQ ID NO: 73. In some embodiments, methods of treating a neurodegenerative disease or disorder (e.g., ALS, FTD, Alzheimer's, Parkinson's, or TBI) comprises administering to a subject an antisense oligonucleotide comprising SEQ ID NO: 73. In some embodiments, the methods of treatment include administering a second agent.
In some embodiments an agent (e.g., an antisense oligonucleotide) is administered (e.g., in vitro or in vivo) in an amount effective for increasing and/or restoring STMN2 protein levels.
In some aspects the agent (e.g., the antisense oligonucleotide) suppresses cryptic splicing. In some embodiments a subject treated with an agent that suppresses or prevents inclusion of a cryptic exon in STMN2 RNA exhibits improved neuronal (e.g., motor axon) outgrowth and/or repair. In some aspects the agent prevents degradation of STMN2 protein. In some aspects an agent improves symptoms of a neurodegenerative disease including ataxia, neuropathy, synaptic dysfunction, deficit in cognition, and/or decreased longevity.
In some embodiments inclusion of a cryptic exon in STMN2 RNA is suppressed or prevented using genome editing (e.g., CRISPR/Cas).
As used herein, “treat,” “treatment,” “treating,” or “amelioration” when used in reference to a disease, disorder or medical condition, refers to therapeutic treatments for a condition, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a symptom or condition. The term “treating” includes reducing or alleviating at least one adverse effect or symptom of a condition. Treatment is generally “effective” if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if the progression of a condition is reduced or halted. That is, “treatment” includes not just the improvement of symptoms or markers, but also a cessation or at least slowing of progress or worsening of symptoms that would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of the deficit, stabilized (i.e., not worsening) state of, for example, a neurodegenerative disorder, delay or slowing progression of a neurodegenerative disorder, and an increased lifespan as compared to that expected in the absence of treatment.
“Neurodegenerative disorder” refers to a disease condition involving neural loss mediated or characterized at least partially by at least one of deterioration of neural stem cells and/or progenitor cells. Non-limiting examples of neurodegenerative disorders include polyglutamine expansion disorders (e.g., HD, dentatorubropallidoluysian atrophy, Kennedy's disease (also referred to as spinobulbar muscular atrophy), and spinocerebellar ataxia (e.g., type 1, type 2, type 3 (also referred to as Machado-Joseph disease), type 6, type 7, and type 17)), other trinucleotide repeat expansion disorders (e.g., fragile X syndrome, fragile XE mental retardation, Friedreich's ataxia, myotonic dystrophy, spinocerebellar ataxia type 8, and spinocerebellar ataxia type 12), Alexander disease, Alper's disease, Alzheimer disease, amyotrophic lateral sclerosis (ALS), ataxia telangiectasia, Batten disease (also referred to as Spielmeyer-Vogt-Sjogren-Batten disease), Canavan disease, Cockayne syndrome, corticobasal degeneration, Creutzfeldt-Jakob disease, Guillain-Barré syndrome, ischemia stroke, Krabbe disease, kuru, Lewy body dementia, multiple sclerosis, multiple system atrophy, non-Huntingtonian type of Chorea, Parkinson's disease, Pelizaeus-Merzbacher disease, Pick's disease, primary lateral sclerosis, progressive supranuclear palsy, Refsum's disease, Sandhoff disease, Schilder's disease, spinal cord injury, spinal muscular atrophy (SMA), SteeleRichardson-Olszewski disease, frontotemperal dementia (FTD), and Tabes dorsalis. In some contexts neurodegenerative disorders encompass neurological injuries or damages to the CNS or PNS associated with physical injury (e.g., head trauma, mild to severe traumatic brain injury (TBI), diffuse axonal injury, cerebral contusion, acute brain swelling, and the like).
In some embodiments the neurodegenerative disorder is a disorder that is associated with mutant or reduced levels of TDP-43 in neuronal cells. In some embodiments the neurodegenerative disorder is a disorder that is associated with mutant or reduced levels of STMN2 protein and/or mislocalization of STMN2 protein. In some embodiments the neurodegenerative disorder is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), frontotemporal lobar degeneration (FTLD), Alzheimer's disease, Parkinson's disease, Inclusion Body Myositis (IBM) and combinations thereof. In some aspects the neurodegenerative disorder is ALS. In some aspects the neurodegenerative disorder is ALS in combination with FTD and/or FTLD. In some aspects the neurodegenerative disorder is Alzheimer's. In some aspects the neurodegenerative disorder is Parkinson's.
“Proteasome-inhibitor induced neuropathy” is used herein to refer to a disorder or condition that occurs as a result of a reduced amount of functional nuclear TDP-43. The nuclear TDP-43 may be decreased in overall levels, or the decreased levels may occur as a result of an increase in cytoplasmic aggregation of TDP-43, which induces evacuation of nuclear TDP-43. In some aspects, proteasome inhibition leads to decreased expression of STMN2.
“Traumatic brain injury” or “TBI” refers to an intracranial injury that occurs when an external force injures the brain. TBIs may be classified based on their severity (e.g., mild, moderate, or severe), mechanism (e.g., closed or penetrating head injury), or other features (e.g., location). A TBI can result in physical, cognitive, social, emotional, and behavioral symptoms. Conditions associated with TBI include concussions. TBIs and conditions associated with a TBI have been associated with TDP-43 pathology. In some aspects, alterations in STMN2 occur in a TBI or a condition associated therewith.
In some embodiments the traumatic brain injury is, or results in, a disorder that is associated with mutant levels of TDP-43 in neuronal cells. In some embodiments the traumatic brain injury is, or results in, a disorder that is associated with mutant or reduced levels of STMN2 protein and/or mislocalization of STMN2 protein. In some embodiments the severity of a traumatic brain injury is measured based on the decrease of functional TDP-43 in neuronal cells. In some embodiments the severity of a concussion is measured based on the decrease of functional TDP-43 in neuronal cells.
For administration to a subject, the agents disclosed herein can be provided in pharmaceutically acceptable compositions. These pharmaceutically acceptable compositions comprise a therapeutically-effective amount of one or more of the agents, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents. The pharmaceutical compositions of the present invention can be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), gavages, lozenges, dragees, capsules, pills, tablets (e.g., those targeted for buccal, sublingual, and systemic absorption), boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intrathecal, intercranially, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; (8) transmucosally; or (9) nasally. Additionally, agents can be implanted into a patient or injected using a drug delivery system. (See, for example, Urquhart, et al., Ann. Rev. Pharmacol. Toxicol. 24: 199-236 (1984); Lewis, ed. “Controlled Release of Pesticides and Pharmaceuticals” (Plenum Press, New York, 1981); U.S. Pat. No. 3,773,919; and U.S. Pat. No. 35 3,270,960, content of all of which is herein incorporated by reference.)
As used herein, the term “pharmaceutically acceptable” refers to those agents, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
As used herein, the term “pharmaceutically-acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject agent from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation. The terms such as “excipient”, “carrier”, “pharmaceutically acceptable carrier” or the like are used interchangeably herein.
The phrase “therapeutically-effective amount” as used herein means that amount of an agent, material, or composition comprising an agent described herein which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment. For example, an amount of an agent administered to a subject that is sufficient to produce a statistically significant, measurable increase in TDP-43 function.
The determination of a therapeutically effective amount of the agents and compositions disclosed herein is well within the capability of those skilled in the art. Generally, a therapeutically effective amount can vary with the subject's history, age, condition, sex, and the administration of other pharmaceutically active agents.
As used herein, the term “administer” refers to the placement of an agent or composition into a subject (e.g., a subject in need) by a method or route which results in at least partial localization of the agent or composition at a desired site such that desired effect is produced. Routes of administration suitable for the methods of the invention include both local and systemic routes of administration. Generally, local administration results in more of the administered agents being delivered to a specific location as compared to the entire body of the subject, whereas, systemic administration results in delivery of the agents to essentially the entire body of the subject.
The compositions and agents disclosed herein can be administered by any appropriate route known in the art including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration. Exemplary modes of administration include, but are not limited to, injection, infusion, instillation, inhalation, or ingestion. “Injection” includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracranial, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion. In preferred embodiments of the aspects described herein, the compositions are administered by intravenous infusion or injection.
As used herein, a “subject” means a human or animal (e.g., a mammal). Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. Patient or subject includes any subset of the foregoing, e.g., all of the above, but excluding one or more groups or species such as humans, primates or rodents. In certain embodiments of the aspects described herein, the subject is a mammal, e.g., a primate, e.g., a human. The terms, “patient” and “subject” are used interchangeably herein. A subject can be male or female. In some embodiments the subject suffers from a disease or condition associated with mutant or reduced levels of TDP-43 (e.g., in neuronal cells).
The disclosure contemplates methods of screening one or more test agents (e.g., one or more antisense oligonucleotides) to identify candidate agents for treating or reducing the likelihood of a disease or condition associated with a TDP-pathology. In some aspects, a disease or condition is associated with mutant or reduced levels of TDP-43 (e.g., in neuronal cells). The disclosure further contemplates methods of screening one or more test agents to identify candidate agents for treating or reducing the likelihood of a disease or condition associated with either mutant or reduced levels of STMN2 protein.
In some embodiments the method comprises providing a neuronal cell having reduced TDP-43 levels; contacting the cell with the one or more test agents; determining if the contacted cell has an increased level of STMN2 protein; and identifying the test agent as a candidate agent if the contacted cell has an increased level of STMN2 protein. In some aspects the step of determining if the contacted cell has increased level of STMN2 protein comprises measuring STMN2 protein levels in the contacted cell. In some aspects STMN2 protein level is measured using an ELISA (e.g., a sandwich ELISA), dot blot, and/or Western blot. In some aspects the step of determining if the contacted cell has increased level of STMN2 protein comprises assessing the morphology or function of the contacted cell. For example, neurons lacking STMN2 may have an altered morphology from that of neurons having STMN2. In some aspects the morphology or function of the contacted cell is assessed using immunoblotting and/or immunocytochemistry. In some aspects the contacted cell may further be assessed to determine if it expresses full-length STMN2 RNA. STMN2 RNA expression may be measured using qRT-PCR.
In some embodiments the method comprises providing a neuronal cell having mutant TDP-43 levels; contacting the cell with the one or more test agents; determining if the contacted cell has an increased level of STMN2 protein; and identifying the test agent as a candidate agent if the contacted cell has an increased level of STMN2 protein. In some aspects the step of determining if the contacted cell has increased level of STMN2 protein comprises measuring STMN2 protein levels in the contacted cell. In some aspects STMN2 protein level is measured using an ELISA, dot blot, and/or Western blot. In some aspects the step of determining if the contacted cell has increased level of STMN2 protein comprises assessing the morphology or function of the contacted cell. For example, neurons lacking STMN2 or having a reduced amount of STMN2 may have an altered morphology from that of neurons having normal levels of STMN2 (i.e., levels of STMN2 from a control sample). In some aspects the morphology or function of the contacted cell is assessed using immunoblotting and/or immunocytochemistry. In some aspects the contacted cell may further be assessed to determine if it expresses full-length STMN2 RNA. STMN2 RNA expression may be measured using qRT-PCR.
In some embodiments the method comprises providing a neuronal cell having reduced TDP-43 levels; contacting the cell with the one or more test agents; and determining if the contacted cell has cryptic exons in STMN2 RNA. The contacted cell may be assessed using FISH RNA, or RT-PCT, qPCR, qRT-PCR, or RNA sequencing to identify whether there is a cryptic exon in the STMN2 RNA. In some embodiments the method comprises providing a neuronal cell having reduced TDP-43 levels; contacting the cell with the one or more test agents; and determining if the contacted cell expresses full length STMN2 RNA. The contacted cell may be assessed using RNA FISH or RT-PCT, qPCR, qRT-PCR, or RNA sequencing.
In some embodiments the method comprises providing a neuronal cell having mutant TDP-43 levels; contacting the cell with the one or more test agents; and determining if the contacted cell has cryptic exons in STMN2 RNA. The contacted cell may be assessed using FISH RNA or RT-PCT, qPCR or RNA sequencing to identify whether there is a cryptic exon in the STMN2 RNA. In some embodiments the method comprises providing a neuronal cell having mutant TDP-43 levels; contacting the cell with the one or more test agents; and determining if the contacted cell expresses full length STMN2 RNA. The contacted cell may be assessed using RNA FISH or RT-PCT, qPCR, qRT-PCR, or RNA sequencing.
In some aspects the disclosure contemplates the use of STMN2 and/or ELAVL3 as a biomarker for a disease or condition associated with a decline in TDP-43 functionality (e.g., a disease or condition having a substantial TDP-43-associated pathology). In some aspects STMN2 and/or ELAVL3 may act as a biomarker for the presence of a disease or condition. In other aspects STMN2 and/or ELAVL3 may act as a biomarker for monitoring the progression of a disease or condition. In some aspects STMN2 and/or ELAVL3 protein levels are assessed. In some aspects STMN2 and/or ELAVL3 transcript levels are assessed.
In some embodiments, a disease or condition is associated with mutant or reduced levels of TDP-43 in neuronal cells. In some embodiments, a disease or condition is associated with mutant or increased levels of TDP-43 in neuronal cells. In some embodiments the disease or condition is a neurodegenerative disease (e.g., amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, or frontotemperal dementia (FTD)). In some embodiments the disease or condition is associated with or occurs as a result of a traumatic brain injury.
In some aspects a method for detecting a disease or condition associated with a decline in TDP-43 functionality comprises obtaining a sample from a subject and assessing the sample to determine if it exhibits either mutant or reduced levels of STMN2 and/or ELAVL3 protein. In some embodiments the STMN2 and/or ELAVL3 protein levels are measured using any method known to those of skill in the art, including immunoblot, immunocytochemistry, dot blot, and/or ELISA. In certain aspects STMN2 and/or ELAVL3 protein levels are measured using ELISA. In some aspects a method for detecting a disease or condition associated with a decline in TDP-43 functionality comprises obtaining a sample from a subject and assessing the sample to determine if it exhibits reduced levels of STMN2 and/or ELAVL3 transcript. In some embodiments the STMN2 and/or ELAVL3 transcript levels are measured using any method known to those of skill in the art, including RNA FISH, RT-PCR, qPCR, or RNA sequencing. In certain aspects STMN2 and/or ELAVL3 transcript levels are measured using qRT-PCR. Reduced levels of STMN2 and/or ELAVL3 protein and/or transcript may be an indication of a decline in TDP-43 functionality as a result of a disease or disorder. In some aspects the progression of a disease or condition associated with a decline in TDP-43 functionality is assessed by analyzing multiple samples from a subject over an extended period of time to monitor the levels of STMN2 and/or ELAVL3 protein and/or transcript (e.g., in response to a treatment protocol).
In some aspects a method for detecting a neurodegenerative disease (e.g., ALS, FTD, Parkinson's, Alzheimer's) in a subject comprises obtaining a sample (e.g., a biofluid sample) from the subject suffering, and determining if the sample contains altered levels of STMN2 and/or ELAVL3 protein. In certain aspects the determination is made using ELISA. In some aspects a method for detecting a neurodegenerative disease (e.g., ALS, FTD, Parkinson's, Alzheimer's) in a subject comprises obtaining a sample (e.g., a biofluid sample) from the subject suffering, and determining if the sample contains reduced levels of STMN2 and/or ELAVL3 transcript. The screening of the sample may be performed using RNA FISH, RT-PCR, qPCR, or RNA sequencing. In certain aspects STMN2 and/or ELAVL3 transcript levels are measured using qRT-PCR. Reduced levels of STMN2 and/or ELAVL3 protein and/or transcript may be an indication of a decline in TDP-43 functionality as a result of a neurodegenerative disease or disorder.
In some aspects a method for detecting a traumatic brain injury (TBI) in a subject comprises obtaining a sample (e.g., a biofluid sample) from the subject, and determining if the sample contains altered levels of STMN2 and/or ELAVL3 protein. In certain aspects the determination is made using ELISA. In some aspects a method for detecting a traumatic brain injury (TBI) in a subject comprises obtaining a sample (e.g., a biofluid sample) from the subject, and screening the sample for reduced levels of STMN2 and/or ELAVL3 transcript. The screening of the sample may be performed using RNA FISH, RT-PCR, qPCR, or RNA sequencing. In certain aspects STMN2 and/or ELAVL3 transcript levels are measured using qRT-PCR. Reduced levels of STMN2 and/or ELAVL3 protein and/or transcript may be an indication of a decline in TDP-43 functionality as a result of a TBI.
In some aspects the disclosure contemplates the use of cryptic variants of STMN2 as a biomarker for a disease or condition associated with a decline in TDP-43 functionality (e.g., a disease or condition having a substantial TDP-43-associated pathology). In some embodiments the disease or condition is a neurodegenerative disease (e.g., ALS, FTD, Alzheimer's, Parkinson's). In some embodiments the disease or condition is associated with or is a result of a traumatic brain injury.
In some aspects a method for detecting a disease or condition associated with a decline in TDP-43 functionality comprises obtaining a sample from a subject and assessing the sample to determine if it includes a cryptic variant of STMN2. In some embodiments the STMN2 transcript is assessed using RNA FISH, RT-PCR, qPCR, or RNA sequencing. In certain aspects an STMN2 transcript is measured using qRT-PCR. The presence of a cryptic variant of STMN2 may be an indication of a decline in TDP-43 functionality.
In some aspects a method for detecting a neurodegenerative disease comprises obtaining a sample (e.g., a biofluid sample) from the subject, and screening the sample for a cryptic variant of STMN2. The screening of the sample may be performed using PCR. The presence of a cryptic variant of STMN2 may be an indication of a decline in TDP-43 functionality as a result of a neurodegenerative disease or disorder.
In some aspects a method for detecting a TBI comprises obtaining a sample (e.g., a biofluid sample) from the subject, and screening the sample for a cryptic variant of STMN2. The screening of the sample may be performed using PCR. The presence of a cryptic variant of STMN2 may be an indication of a decline in TDP-43 functionality as a result of a traumatic brain injury.
In a landmark finding, TDP-43 (TAR DNA-binding protein 43) was discovered to be a major constituent of ubiquitin-positive inclusions in many sporadic cases of ALS and a substantial subset of FTD (7). TDP-43 is a predominantly nuclear DNA/RNA binding protein (8) with functional roles in transcriptional regulation (9), splicing (10, 11), pre-miRNA processing (12), stress granule formation (13, 14), and mRNA transport and stability (15, 16). Subsequently, autosomal-dominant, apparently causative mutations in TARDBP were identified in both ALS and FTD families, linking genetics and pathology with neurodegeneration (17-21). Thus, elucidating the role that TDP-43 mislocalization and mutation play in disease is essential to understanding both sporadic and familial ALS.
Whether neurodegeneration associated with TDP-43 pathology is the result of loss-of-function mechanisms, toxic gain-of-function mechanisms, or a combination of both, remains unclear (22). Early studies showed that overexpression of both wildtype and mutant TDP-43 led to its aggregation and loss of nuclear localization (22). While these studies along with the autosomal dominant inheritance pattern of TARDBP mutations would seemingly support a gain-of-function view, the loss of nuclear TDP-43, generally associated with its aggregation, suggests its normal functions might also be impaired. Subsequent findings revealed that TDP-43 depletion in the developing embryo or post-mitotic motor neurons can have profound consequences (23-27).
Given the myriad roles TDP-43 plays in neuronal RNA metabolism, a key question has become: what are the RNA substrates that are misregulated upon TDP-43 mislocalization, and how do they contribute to motor neuropathy? Early efforts to answer this question utilized cross-linking and immunoprecipitation with RNA sequencing (RNA-seq) of whole brain homogenates from either patients or mice subjected to TARDBP knockdown (11, 28). These resulting discoveries led to a general understanding that many transcripts are regulated by TDP-43 with a preference towards lengthy RNAs containing UG repeats and long introns; however, the prominence of glial RNAs in the brain homogenates sequenced in these experiments limited insights into the specific neuronal targets of TDP-43. As a result, few clear connections between the TDP-43 target RNAs and mechanisms of motor neuron degeneration could be forged.
To identify substrates that when misregulated contribute to neuronal degeneration, the identity of RNAs regulated by TDP-43 in purified human motor neurons was sought. Because the vulnerable motor neurons in living ALS patients are fundamentally inaccessible for isolation and experimental perturbation, directed differentiation approaches have been developed for guiding human pluripotent stem cells into motor neurons (hMNs) to study ALS and other neurodegenerative conditions in vitro (29-31). Here, RNA-seq of hMNs was performed after TDP-43 knockdown to identify transcripts whose abundance are positively or negatively regulated by TDP-43's deficit. In total, 885 transcripts were identified for which TDP-43 is needed to maintain normal RNA levels. Although misregulation of any number of these targets may play subtle roles in motor neuron degeneration, it was noted that one of the most abundant transcripts in motor neurons, encoding STMN2, was particularly sensitive to a decline in TARDBP, but not FUS or C9ORF72 activities. Additionally, it was determined that STMN2 levels were also decreased in hMNs expressing mutant TDP-43 and in hMNs whose proteasomes were pharmacologically inhibited, which has been shown to induce cytoplasmic accumulation and aggregation of TDP-43 in rodent neurons (32). It was further shown that STMN2, a known regulator of microtubule stability, encodes a protein that is necessary for normal human motor neuron outgrowth and repair. Importantly, loss of STMN2 function as a result of loss of TDP-43 activity is likely to be of functional relevance to people with ALS as its expression was also found to be reproducibly decreased in the motor neurons of ALS patients.
Differentiation and Purification of Human Motor Neurons (hMNs)
In order to produce hMNs, the human embryonic stem cell line HUES3 Hb9::GFP (33, 34) was differentiated into GFP+ hMNs under adherent culture conditions (35, 36) using a modified 14-day strategy (
RNA-Seq of hMNs with Reduced Levels of TDP-43
Reduced nuclear TDP-43 observed in ALS is emerging as potential cellular mechanism that may contribute to downstream neurodegenerative events (7, 37). It was therefore desired to identify the specific RNAs regulated by TDP-43 in purified hMN populations through a combination of knock-down and RNA-Seq approaches. Using a short interfering RNA conjugated to Alexa Fluor 555, transfection conditions were first validated to achieve high levels of siRNA delivery (˜94.6%) into the hMNs (
To capture global changes in gene expression in response to partial loss of TDP-43 in hMNs, RNA-Seq libraries were prepared from siRNA treated cells (
In addition to altering total transcriptional levels of hundreds of genes in the mammalian CNS (11), reduced levels of TDP-43 can also influence gene splicing (11, 39-42). Although global analysis of splicing variants traditionally involves splicing-sensitive exon arrays (11, 39), the development of computational approaches for isoform deconvolution of RNA-Seq reads is rapidly evolving (43-45). A limited examination of the data with the bioinformatics algorithm ‘Cuffdiff 2’ (45) was indeed able to detect the POLDIP3 gene as the top candidate for differential splicing with two significant isoform-switching events (
Of the 885 genes identified as significantly misregulated after TDP-43 knockdown, a candidate subset was selected for further validation. First, genes with enriched neuronal expression (STMN2 (47,48), ELAVL3 (49)), and association with neurodevelopment and neurological disorders (RCAN1 (50), NAT8L (51)) were considered. In addition, genes with reasonable expression levels (TPM≥5) and high fold changes as ‘positive controls’ (SELPLG, NAT8L) were considered, as it was hypothesized that these candidates would be more robust and likely to validate. RNA was then obtained from independent biological replicates after TDP-43 knockdown and the relative expression levels for 11 candidate genes, including TARDBP, was determined by qRT-PCR. Notably, differential gene expression for 9/11 of these genes was confirmed in cells treated with either siTDP-43 relative to those treated with scrambled control (
STMN2 Levels are Downregulated in hMNs Expressing Mutant TDP-43
It was next asked if any of the RNAs with altered abundances after TDP-43 depletion were also perturbed by expression of mutant forms of TDP-43 that cause ALS. To this end, the putative TDP-43 target RNAs that displayed reproducibly altered expression after TDP-43 knockdown in patient iPS cell-derived motor neurons harboring pathogenic mutations in TARDBP were investigated (
After 10 days of further neuronal culture, total RNA from these FACS-purified MNs were collected and qRT-PCR was performed to investigate levels of the gene products most reproducibly impacted by TDP-43 depletion (ALOXSAP, STMN2, ELAVL3, and RCAN1). For two of the genes (STMN2 and ELAVL3), a significant decrease in transcript levels was observed (
How ALS-associated mutations might hamper TDP-43's ability to regulate target transcripts was subsequently explored. Previous studies have reported that hMNs derived from iPSC lines expressing mutant TDP-43 recapitulate some aspects of TDP-43 pathology including its accumulation in both soluble and insoluble cell protein extracts (54, 55) as well as cytoplasmic mislocalization (56). Because decreased nuclear TDP-43 in mutant neurons could mimic the partial loss induced by the siRNAs, signs of TDP-43 mislocalization were tested for using immunofluorescence. In both control and mutant neurons, however, primarily nuclear staining for TDP-43 was observed (
STMN2 Levels are Regulated by TDP-43 in hMNs
It was intriguing to see that transcripts for Stathmin-like 2 (STMN2) were decreased in both neurons expressing mutant TDP-43 and after TDP-43 depletion. STMN2 is one of four proteins (STMN1, STMN2, SCLIP/STMN3, and RB3/STMN4) belonging to the Stathmin family of microtubule-binding proteins with functional roles in neuronal cytoskeletal regulation and axonal regeneration pathways (47,48,58-62). In humans, STMN1 and STMN3 genes exhibit ubiquitous expression, whereas STMN2 and STMN4 are enriched in CNS tissues (63). Considering the growing evidence for the relevance of cytoskeletal pathways in ALS (64-66) and its enrichment within the CNS, it was decided to focus on further characterizing the relationship between STMN2 and TDP-43.
First, it was examined if the significant downregulation of the STMN2 transcripts also resulted in reduced levels of STMN2 protein. In independent RNAi experiments, qRT-PCR was performed with two different sets of primer pairs binding the STMN2 mRNA and found significant downregulation (˜50-60%) in siTDP43-treated hMNs relative to controls (
It was then considered whether downregulation of two other ALS-linked genes, FUS or C9ORF72 (5,67), would also change STMN2 levels in hMNs. FUS protein, structurally similar to TDP-43, is also involved in RNA metabolism (68), and FUS variants have been detected in familial ALS and FTD cases (69). The function of C9ORF72 is an active area of research, but large repeat expansions in the intronic regions of C9ORF72 are responsible for a substantial number of familial and sporadic ALS and FTD cases (70-72). Following induction of RNAi targeting TDP-43, FUS, or C9ORF72, significant downregulation of the respective siRNA-targeted genes by qRT-PCR was found. (
Through highly conserved RNA recognition motifs (73), TDP-43 can bind to RNA molecules to regulate them. To determine whether TDP-43 associates directly with STMN2 RNA, which has many canonical TDP-43 binding motifs (
STMN2 Function in hMNs
The function of STMN2 in hMNs was explored next. First, expression of STMN2 was examined across the differentiation process that yields MNs (
To explore the cellular consequences of decreased STMN2 levels in hMNs, STMN2 knock-out stem cells were generated. Specifically, a CRISPR/Cas9-mediated genome editing strategy was used (
Given the reported role of STMN2 in regulating axonal growth by promoting the dynamic instability of microtubules (77), phenotypic assays were carried out characterizing neurite outgrowth in the STMN2−/− hMNs. After 7 days in culture, sorted hMNs were fixed and stained for β-III-tubulin to label the neuronal processes (
It was next asked if STMN2 functions not only in neuronal outgrowth, but also in neuronal repair after injury. To test these hypothesis, sorted hMNs were plated into a microfluidic device that permits the independent culture of axons from neuronal cell bodies (79) (
A previous study established that proteasome inhibition in hMNs could trigger accumulation of mutant SOD-1 (31). It was, therefore, examined whether MG-132-mediated proteasome inhibition affected TDP-43 localization in hMNs as a potential model of sporadic ALS. First, the range and timing of small molecule treatment that could inhibit the proteasome without inducing overt cellular toxicity was established (
To determine what happened to TDP-43 after proteasome inhibition, TDP-43 levels were examined by immunoblot analysis in both the detergent-soluble and detergent-insoluble fractions. In the soluble lysates obtained from control neurons treated with a low dose of MG-132 (
TDP-43 Suppresses Appearance of Cryptic Exons in hMNs
TDP-43 plays an important role in the nucleus regulating RNA splicing, and recent studies highlight its ability to suppress non-conserved or cryptic exons to maintain intron integrity (80). When cryptic exons are included in RNA transcripts, in many cases, their inclusion can affect normal levels of the gene product by disrupting its translation or by promoting nonsense-mediated decay (80). Interestingly, no overlap in the genes regulated by TDP-43 cryptic exon suppression has been observed between mouse and man (80). The sequencing data was examined for evidence of cryptic exons in genes observed to be reproducibly regulated by TDP-43 in human cancer cells (81). Reads mapping to cryptic exons in 9 of these 95 genes were found, including PFKP, which was consistently down-regulated in the RNA-Seq experiment (
Finally, it was sought to test if the in vitro findings were relevant to ALS patient motor neurons in vivo. To this end, immunohistochemistry was used of human adult spinal cord tissues to investigate STMN2 expression in control and ALS patients. It was predicted that levels of STMN2 protein would be altered in post-mortem spinal MNs from sporadic ALS cases, which typically manifest pathological loss of nuclear TDP-43 staining and accumulation of cytoplasmic TDP-43 immunoreactive inclusions (7, 37). Similar to what was observed in stem cell derived hMNs, strong STMN2 immunoreactivity was present in the cytoplasmic region of human adult lumbar spinal MNs, but absent in the surrounding glial cells (
The studies suggest that the abundance of hundreds of transcripts is likely regulated by TDP-43 in human motor neurons, including several RNAs that have surfaced previously in the context of studying ALS. For instance, the findings suggest that BDNF expression could in part be regulated by TDP-43, which is of note given that decreased expression of this neurotrophin has been observed previously (85). MMP9 has previously been shown in the SOD1 ALS mouse model to define populations of motor neurons most sensitive to degeneration (86). The studies suggest that reduced TDP-43 function might more widely induce expression of this factor, which could sensitize motor neurons to degeneration. Further interrogation of the transcripts that were identified here may provide insights into how perturbations to TDP-43 lead to motor neuron dysfunction.
An important outstanding question has been, what are the mechanistic consequences of familial mutations in TDP-43 and how do their effects relate to the events that occur when TDP-43 becomes pathologically relocalized in patients with sporadic disease. The identification of motor neuron transcripts regulated by TDP-43 provided an opportunity to explore the potential impact of differing manipulations to TDP-43 relevant to both familial and sporadic disease. First, it was asked whether a subset of the target RNAs identified as reduced after TDP-43 depletion displayed significant expression changes in motor neurons produced from patients with TDP-43 mutations. Interestingly, modest but significant changes were found in the expression of the RNA binding protein ELAVL3 and the microtubule regulator STMN2, but not other putative targets identified. Thus, reduced expression of target RNAs is considered as a TDP-43 phenotype, patient mutations displayed partial loss-of-function effects.
Upon over-expression, it has previously been shown that mutant TDP-43 is prone to aggregation (22). Some studies have also suggested that mutant TDP-43 is similarly prone to aggregation when expressed at native levels in patient specific motor neurons (54, 56, 57). To determine whether aggregation or loss of nuclear mutant TDP-43 could be contributing to decreased expression of STMN2 and ELAVL3 in the experiments, TDP-43 was carefully monitored in these patient motor neurons, but no such defect was identified. Although it cannot be ruled out that modest nuclear TDP-43 loss or insolubility that were below the range of detection are responsible for the observed decline in STMN2 and ELAVL3 expression, the findings are consistent with the notion that mutant protein might simply have reduced affinity or ability to process certain substrates. Further biochemical experiments beyond the scope of this study will likely be required to discern these potential hypotheses.
It is believed that if larger scale aggregation, or nuclear loss of mutant TDP-43 were occurring in familial patient motor neurons it would be detectable. It was found that proteasome inhibition induced dramatic nuclear loss of TDP-43, along with its insoluble accumulation. The inspiration to perform this manipulation occurred after discovering that proteasome inhibition led to an accumulation of insoluble SOD1 in motor neurons from SOD1 ALS patient-specific stem cells but not in control motor neurons harboring only normal SOD1 (31). Interestingly, and as apparently observed by others in distinct contexts (32), proteasome inhibition caused loss of nuclear TDP-43 and its insoluble accumulation regardless of whether in a control of disease genotype. This result was captivating as it suggested that disrupted proteostasis induced by any number of ALS implicated mutations or events could be upstream of the most common histopathological finding in sporadic ALS. The findings further the thought that TDP-43 re-localization to the cytoplasm may initially provide a protective and adaptive response to disrupted proteostasis (87). However, it may be that the biochemical nature of this response and the liquid crystal conversion that these complexes can undergo causes a transient response to become a pathological state that chronically depletes motor neurons of important RNAs regulated by TDP-43 (88). The finding that TDP-43 targets are depleted from motor neurons following proteasome inhibition is consistent with that model.
Although it was found that hundreds of RNAs were impacted by TDP-43 depletion, it was noted that not all transcripts seemed to be equally affected by alterations in TDP-43, with a modest number, including those encoding STMN2, ELAVL3 being particularly sensitive. This observation raises an important question with substantial therapeutic implications: Are the primary effects of TDP-43 pathology in patients and the role that it might play in motor neuropathy and degeneration propagated through a small number of target RNAs? If so, understanding the functions of these key TDP-43 targets, the mechanisms by which they become disrupted and whether they can be restored could be significant as it might spotlight a pathway downstream of TDP-43 pathology for restoring motor neuron functionality. Given the established functions of STMN orthologs and the magnitude of the effect of TDP-43 depletion on STMN2 levels, it was wondered if it might be such a target.
The Stathmin family of proteins are recognized regulators of microtubule stability and have been demonstrated to regulate motor axon biology in the fly (77). Gene editing was used to determine if STMN2 has an important function in human stem cell derived motor neurons and it was found that both motor axon outgrowth and repair were significantly impaired in the absence of this protein. Although hMNs generated in vitro share many molecular and functional properties with bona fide MNs (29), the in vivo validation of discoveries from stem cell-based models of ALS is a critical test of their relevance to disease mechanisms and therapeutic strategies (89). Human adult spinal cord tissues were therefore used to provide in vivo evidence corroborating the finding that STMN2 levels are altered in ALS. The likely mechanism for reduced expression of STMN2 was the emergence of a cryptic exon. Properly targeted antisense oligonucleotides may suppress this splicing event and restore STMN2 expression.
Cell culture and Differentiation of hESCs and hiPSCs into MNs
Pluripotent stem cells were grown with mTeSR1 medium (Stem Cell Technologies) on tissue culture dishes coated with Matrigel™ (BD Biosciences), and maintained in 5% CO2 incubators at 37° C. Stem cells were passaged as small aggregates of cells after 1 mM EDTA treatment. 10 μM ROCK inhibitor (Sigma, Y-27632) was added to the cultures for 16-24 hours after dissociation to prevent cell death. MN differentiation was carried out using a modified protocol based on adherent culture conditions in combination with dual inhibition of SMAD signaling, inhibition of NOTCH and FGF signaling, and patterning by retinoic acid and SHH signaling. In brief, ES cells were dissociated to single cells using accutase™ (Stem Cell Technologies) and plated at a density of 80,000 cells/cm 2 on matrigel-coated culture plates with mTeSR1 medium (Stem Cell Technologies) supplemented with ROCK inhibitor (10 μM Y-27632, Sigma). When cells reached 100% confluency, medium was changed to differentiation medium (1/2 Neurobasal (Life Technologies™) 1/2 DMEM-F12 (Life Technologies™) supplemented with 1×B-27 supplement (Gibed)), 1×N-2 supplement (Gibed)), 1× Gibco® GlutaMAX™ (Life Technologies™) and 100 μM non-essential amino-acids (NEAA)). This time point was defined as day 0 (d0) of motor neuron differentiation. Treatment with small molecules was carried out as follows: 10 μM SB431542 (Custom Synthesis), 100 nM LDN-193189 (Custom Synthesis), 111M retinoic acid (Sigma) and 1 μM Smoothend agonist (Custom Synthesis) on d0-d5; 5 μM DAPT (Custom Synthesis), 4 μM SU-5402 (Custom Synthesis), 1 μM retinoic acid (Sigma) and 1 μM Smoothend agonist (Custom Synthesis) on d6-d14.
On d14, differentiated cultures were dissociated to single cells using accutase™ treatment for 1 hour inside a 5% CO2/37° C. incubator. Repeated (10-20 times) but gentle pipetting with a 1000 μL Pipetman® was used to achieve a single cell preparation. Cells were spun down, washed 1× with PBS and resuspended in sorting buffer (lx cation-free PBS 15 mM HEPES at pH 7 (Gibed)), 1% BSA (Gibe“, lx penicillin-streptomycin (Gibe”, 1 mM EDTA, and DAPI (1 μg/mL). Cells were passed through a 45 μm filter immediately before FACS analysis and purification. The BD FACS Aria II cell sorter was routinely used to purify Hb9::GFP+ cells into collection tubes containing MN medium (Neurobasal (Life Technologies™), 1×N-2 supplement (Gibco®), B-27 supplement (Gibco®), GlutaMax and NEAA) with 10 μM ROCK inhibitor (Sigma, Y-27632) and 10 ng/mL of neurotrophic factors GDNF, BDNF and CNTF (R&D). DAPI signal was used to resolve cell viability, and differentiated cells not exposed to MN patterning molecules (RA and SAG) were used as negative controls to gate for green fluorescence. For lines not containing the Hb9::GFP reporter, single cell sunspensions were incubated with antibodies against NCAM (BD Bioscience, BDB557919, 1:200) and EpCAM (BD Bioscience, BDB347198, 1:50) for 25 minutes in sorting buffer, then washed once with PBS lx and resuspended in sorting buffer. For RNA-Seq experiments, 200,000 GFP+ cells per well were plated in 24-well tissue culture dishes precoated with matrigel. MN medium supplemented with 10 ng/mL of each GDNF, BDNF and CNTF (R&D Systems) was used to feed and mature the purified MNs. RNA-Seq experiments and most downstream assays were carried with d10 purified MNs (10 days in culture after FACS) grown plates coated with 0.1 mg/ml poly-Dlysine (Invitrogen) and 5 μg/ml laminin (Sigma-Aldrich) at a concentration of around 130000 cells/cm2.
RNAi in cultures of purified GFP+ MNs was induced with Silencer® Select siRNAs (Life Technologies™) targeting the TDP-43 mRNA or with a non-targeting siRNA control with scrambled sequence that is not predicted to bind to any human transcripts. Lyophilized siRNAs were resuspended in nuclease-free water and stored at −20° C. as 20 μM stocks until ready to use. For transfection, siRNAs were diluted in Optimem (Gibco®) and mixed with RNAiMAX (Invitrogen) according to manufacturer's instructions. After 30 min incubation, the mix was added drop-wise to the MN cultures, so that the final siRNA concentration in each well was 60 nM in 1:1 Optimem:MN medium (Neurobasal (Life Technologies™, N2 supplement (Gibco®), B-27 supplement (Gibco®), GlutaMax and NEAA) and 10 ng/mL of each GDNF, BDNF and CNTF (R&D). 12-16 hours posttransfection media was changed. RNA-Seq experiments and validation assays were carried with material collected 4 days after transfection.
For immunofluorescence, cells were fixed with ice-cold 4% PFA for 15 minutes at 4° C., permeabilized with 0.2% Triton-X in lx PBS for 45 minutes and blocked with 10% donkey serum in lx PBS-T (0.1% Tween-20) for 1 hour. Cells were then incubated overnight at 4° C. with primary antibody (diluted in blocking solution). At least 4 washes (5 min incubation each) with 1×PBS-T were carried out, before incubating the cells with secondary antibodies for 1 hour at room temperature (diluted in blocking solution). Nuclei were stained with DAPI. The following antibodies were used in this study: Hb9 (1:100, DSHB, MNR2 81.5C10-c), TUJ1 (1:1000, Sigma, T2200), MAP2 (1:10000, Abcam ab5392), Ki67 (1:400, Abcam, ab833), GFP (1:500, Life Technologies™, A10262), Islet1 (1:500, Abcam ab20670), TDP-43 (1:500, ProteinTech Group), STMN2 (1:4000, Novus), AlexaFluor™ 647-Phalloidin (1:200,). Secondary antibodies used (488, 555, 594, and 647) were AlexaFluor™ (1:1000, Life Technologies™) and DyLight (1:500, Jackson ImmunoResearch Laboratories). Micrographs were analyzed using FIJI software to determine the correlation coefficient.
For analysis of TDP-43 and STMN2 protein expression levels, d10 MNs were lysed in RIPA buffer (150 mM Sodium Chloride; 1% Triton X-100; 0.5% sodium deoxycholate; 0.1% SDS; 50 mM Tris pH 8.0) containing protease and phosphatase inhibitors (Roche) for 20 min on ice, and centrifuged at high speed. 200 μL of RIPA buffer per well of 24-well culture were routinely used, which yielded ˜20 μg of total protein as determined by BCA (Thermo Scientific). After two washes with RIPA buffer, insoluble pellets were resuspended in 200 μl of UREA buffer (Bio-Rad). For immunoblot assays 2-3 μg of total protein were separated by SDS-PAGE (BioRad), transferred to PDVF membranes (BioRad) and probed with antibodies against TDP-43 (1:1000, ProteinTech Group), GAPDH (1:1000, Millipore) and STMN2 (1:3000, Novus). Insoluble pellets were loaded based on protein concentration of correspondent RIPA-soluble counterparts. The same PDVF membrane was immunoassayed 2-3 times using Restore™ PLUS Western Blot Stripping Buffer (Thermo Scientific). GAPDH levels were used to normalized each sample, and LiCor software was used to quantitate protein band signal.
RNA Preparation, qRT-PCR and RNA Sequencing
Total RNA was isolated from d10 MNs for RNA-Seq experiments and validation assays using Trizol LS (Invitrogen) according to manufacturer's instructions. 500 μL were added per well of the 24-well cultures. A total of 300-1000 ng of total RNA was used to synthesize cDNA by reverse transcription according to the iSCRIPT kit (Bio-rad). Quantitative RT-PCR (qRT-PCR) was then performed using SYBR green (Bio-Rad) and the iCycler system (Bio-rad). Quantitative levels for all genes assayed were normalized using GAPDH expression. Normalized expression was displayed relative to the relevant control sample (mostly sired treated MNs or cells with lx TDP-43 levels). For comparison between patient line, normalized expression was displayed relative to the average of pooled data points. All primer sequences are available upon request. For next-generation RNA sequencing (RNA-Seq), at least two technical replicas per siRNA sample or AAVS1-TDP43 genotype were included in the analyses. After RNA extraction, samples with RNA integrity numbers (RIN) above 7.5, determined by a bioAnalyzer, were used for library preparation. In brief, RNA sequencing libraries were generated from −250 ng of total RNA using the illumina TruSeq RNA kit v2, according to the manufacturer's directions. Libraries were sequenced at the Harvard Bauer Core Sequencing facility on a HiSeq 2000 platform. All FASTQ files were analyzed using the bcbioRNASeq workflow and toolchain (90). The FASTQ files were aligned to the GRCh37/hg19 reference genome. Differential expression testing was performed using DESeq2 suite of bioinformatics tools (38). The Cuffdiff module of Cufflinks was used to identify differential splicing. Salmon was used to generate the counts and tximport to load them at gene level (91,92). All p-values are then corrected for multiple comparisons using the method of Benjamini and Hochberg (93).
GFP+ MNs were plated at a density of 5,000 cells/cm2 on poly-D-lysine/laminin-coated coverslips and cultured for 10 days in MN medium, conditioned for 2-3 days by mouse glial cells and supplemented with 10 ng/mL of each GDNF, BDNF and CNTF (R&D Systems). Electrophysiology recordings were carried out as previously reported (31,94). Briefly, whole-cell voltage-clamp or current-clamp recordings were made using a Multiclamp 700B (Molecular Devices) at room temperature (21-23C). Data were digitized with a Digidata 1440A A/D interface and recorded using pCLAMP 10_software (Molecular Devices). Data were sampled at 20 kHz and low-pass filtered at 2 kHz. Patch pipettes were pulled from borosilicate glass capillaries on a Sutter Instruments P-97 puller and had resistances of 2-4 MW. The pipette capacitance was reduced by wrapping the shank with Parafilm and compensated for using the amplifier circuitry. Series resistance was typically 5-10 MW, always less than 15 MW, and compensated by at least 80%. Linear leakage currents were digitally subtracted using a P/4 protocol. Voltages were elicited from a holding potential of −80 mV to test potentials ranging from −80 mV to 30 mV in 10 mV increments. The intracellular solution was a potassium-based solution and contained K gluconate, 135; MgCl2, 2; KCl, 6; HEPES, 10; Mg ATP, 5; 0.5 (pH 7.4 with KOH). The extracellular was sodium-based and contained NaCl, 135; KCl, 5; CaCl2), 2; MgCl2, 1; glucose, 10; HEPES, 10, pH 7.4 with NaOH). Kainate was purchased from Sigma.
1 well of a 6 well plate of hMNs (2 million cells) were crosslinked and processed according to the MagnaRIP instructions (Millipore). The following antibodies were used in this study: SOD1 (Cell Signaling Technologies), TDP-43 (FL9, gift of D. Cleveland), and mouse IgG, (cell signaling technology). Each RIP RNA fractions' Ct value was normalized to the Input RNA fraction Ct value for the same qPCR Assay to account for RNA sample preparation differences. To calculate the dCt [normalized RIP], Ct[RIP]-(Ct[Input]-log 2 (Input Dilution Factor)) was determined, where the dilution factor was 100 or 1%. To determine the fold enrichment, the ddCt by dCt[normalized RIP]-dCt[normalized IgG] then fold enrichment=2{circumflex over ( )}-ddCt was calculated.
STMN2 guide RNAs were designed using the following web resources: CHOPCHOP (chopchop.rc.fas.harvard.edu) from the Schier Lab (95). Guides were cloned into a vector containing the human U6 promotor (custom synthesis Broad Institute, Cambridge) followed by the cloning site available by cleavage with BbsI, as well as ampicillin resistance. To perform the cloning, all the gRNAs were modified before ordering. The following modifications were used in order to generate overhangs compatible with a BbsI sticky end: if the 5′ nucleotide of the sense strand was not a G, this nucleotide was removed and substituted with a G; for the reverse complement strand, the most 3′ nucleotide was removed and substituted with a C, while AAAC was added to the 5′ end. The resulting modified STMN2 gRNA sequences were used for Cas9 nuclease genome editing: guide 1: 5′ CACCGTATAGATGTTGATGTTGCG 3′ (Exon 2) (SEQ ID NO: 4), guide 2: 5′ CACCTGAAACAATTGGCAGAGAAG 3′ (Exon 3) (SEQ ID NO: 5), guide 3: 5′ CACCAGTCCTTCAGAAGGCTTTGG 3′ (Exon 4) (SEQ ID NO: 6). Cloning was performed by first annealing and phosphorylating both the gRNAs in PCR tubes. 1 μL of both the strands at a concentration of 10011M was added to 1 μL of T4 PNK (New England Biolabs), 1 μL of T4 ligation buffer and 6 μL of H2O. The tubes were placed in the thermocycler and incubated at 37° C. for 30 mins, followed by 5 mins at 95° C. and a slow ramp down to 25° C. at a rate of 5° C./minute. The annealed oligos were subsequently diluted 1:100 and 2 μL was added to the ligation reaction containing 2 μL of the 100 μM pUC6 vector, 2 μL of NEB buffer 2.1, 1 μL of 10 mM DTT, 1 μL of 10 mM ATP, 1 μL of BbsI (New England Biolabs), 0.5 μL of T7 ligase (New England Biolabs) and 10.5 μL of H2O. This solution was incubated in a thermocycler with the following cycle, 37° C. for 5 minutes followed by 21° C. for 5 minutes, repeated a total of 6 times. The vectors were subsequently cloned in OneShot Top10 (ThermoFisher Scientific) cells and plated on LB-ampicilin agar plates and incubated overnight on 37° C. The vectors were isolated using the Qiagen MlDlprep kit (Qiagen) and measured DNA concentration using the nanodrop. Proper cloning was verified by sequencing the vectors by Genewiz using the M13F(-21) primer.
Stem cell transfection was performed using the Neon Transfection System (ThermoFisher Scientific) with the 100 μL kit (ThermoFisher Scientific). Prior to the transfection, stem cells were incubated in mTeSR1 containing 1011M Rock inhibitor for 1 hour. Cells were subsequently dissociated by adding accutase and incubating for min at 37° C. Cells were counted using the Countess and resuspended in R medium at a concentration of 2,5*106 cells/mL. The cell solution was then added to a tube containing 1 μg of each vector containing the guide and 1.5 μg of the pSpCas9n(BB)-2A-Puro (PX462) V2.0, a gift from Feng Zhang (Addgene). The electroporated cells were immediately released in pre-incubated 37° C. mTeSR medium containing 1011M of Rock inhibitor in a 10-cm dish when transfected with the puromycin resistant vector. 24 hours after transfection with the Puromycin resistant vector, selection was started. Medium was aspirated and replaced with mTESR1 medium containing different concentrations of Puromycin: 1 μg/μL, 2 μg/μL and 4 μg/μL. After an additional 24 hours, the medium was aspirated and replaced with mTeSR1 medium. Cells were cultured for 10 days before colony picking the cells into a 24-well plate for expansion.
Genomic DNA was extracted from puromycin-selected colonies using the Qiagen DNeasy Blood and Tissue kit (Qiagen) and PCR screened to confirm the presence of the intended deletion in the STMN2 gene. PCR products were analyzed after electrophoresis on a 1% Agarose Gel. In brief, the targeted sequence was PCR amplified by a pair of primers external to the deletion, designed to produce a 1100 bp deletion-band in order to detect deleted clones. Sequences of the primers used are as follows: OUT_FWD, 5′ GCAAAGGAGTCTACCTGGCA 3′ (SEQ ID NO: 7) and OUT_REV, 5′ GGAAGGGTGACTGACTGCTC 3′ (SEQ ID NO: 8). Knockout lines were further confirmed using immunoblot analysis.
Individual Tuj1-positive neurons used for Sholl analyses were randomly selected and imaged using a Nikon Eclipse TE300 with a 40× objective. The neurites were traced using the ImageJ (NIH) plugin NeuronJ (78), and Sholl analysis was performed using the Sholl tool of Fiji (96), quantifying the number of intersections at intervals from the cell body. Statistical analysis was performed by comparing the number of intersections of KO clones with the parental WT line for each 10 μm interval using Prism 6 (Graph Pad, La Jolla, CA, USA). Significance was assessed by a standard Student's t-test, with a p value of p<0.05 considered as significant.
Sorted motor neurons were cultured in standard neuron microfluidic devices (SND150, XONA Microfluidics) mounted on glass coverslips coated with 0.1 mg/ml poly-D-lysine (Sigma-Aldrich) and 5 μg/ml laminin (Invitrogen) at a concentration of around 250,000 neurons/device. Axotomy was performed at day 7 of culture by repeated vacuum aspiration and reperfusion of the axon chamber until axons were cut effectively without disturbing cell bodies in the soma compartment.
Post-mortem samples from 3 sporadic ALS cases and 3 controls (no evidence of spinal cord disease) were gathered from the Massachusetts Alzheimer's Disease Research Center (ADRC) in accordance with Partners and Harvard IRB protocols. Histologic analysis of TDP-43 immunoreactivity (rabbit polyclonal, ProteinTech Group) was performed to confirm the diagnosis. For STMN2 analyses, sections of formalin fixed lumbar spinal cord were stained using standard immunohistochemical procedure with the exception that citrate buffer antigen retrieval was performed before blocking. Briefly, samples were rehydrated, rinsed with water, blocked in 3% hydrogen peroxide then normal serum, incubated with primary STMN2 rabbit-derived antibody (1:100 dilution, Novus), followed by incubation with the appropriate secondary antibody (anti-rabbit IgG conjugated to horseradish peroxidase 1:200), and exposure to ABC Vectastain kit and DAB peroxidase substrate, and briefly counterstained with hematoxylin before mounting. Multiple levels were examined for each sample.
Total RNA was isolated from neurons using RNeasy Mini Kit (Qiagen) according to manufacturer's instructions. A total of 300-1000 ng of total RNA was used to synthesize cDNA by reverse transcription according to the iSCRIPT kit (Bio-rad). RT-PCR was then performed using one cryptic exon-specific primer and then analyzed using the Agilent 2200 Tapestation.
Statistical significance for qRT-PCR assays and STMN2 immunohistochemical analyses was assessed using a 2-tail unpaired Student's t-test, with a p value of *p<0.05 considered as significant. Type II Error was controlled at the customary level of 0.05.
90. Steinbaugh, M. J. et al. bcbioRNASeq: R package for bcbio RNA-seq analysis. F1000Research 6, 1976 (2017).
Recently the identity of mRNA transcripts regulated by the RNA binding protein TDP-43 in human motor neurons was reported. See Klim, J. R., et al., ALS-implicated protein TDP-43 sustains levels of STMN2, a mediator of motor neuron growth and repair. Nat Neurosci, 2019. 22(2): p. 167-179. Although TDP-43 regulates hundreds of transcripts in human motor neurons, one of the transcripts most affected by TDP-43 depletion was STMN2. STMN2 is a protein involved in microtubule assembly and is one of the most abundant transcripts expressed by a neuron. In depth analysis of the data revealed that TDP-43 suppresses a cryptic exon in the STMN2 transcript. The inclusion of this cryptic exon prevents the full-length form from being expressed leading to drastically decreased levels of STMN2 protein. Knockdown of TDP-43 in cell culture, as well as post-mortem tissue from patients exhibiting TDP-43 pathology, display altered STMN2 splicing. The cryptic exon-containing transcript contains its own stop and start sites and therefore potentially encodes for a 17 amino acid peptide. This change in human models was validated in RNA sequencing data from post-mortem spinal cord. Therefore, it was considered whether the cryptic STMN2 transcript or the peptide it encodes could serve as a CSF/fluid biomarker for people developing or with ALS or other patients exhibiting TDP-43 proteinopathies (e.g., Parkinson's, traumatic brain injury, Alzheimer's).
The most common pathological hallmark in ALS is the cytoplasmic accumulation and nuclear clearance of TDP-43. Many groups and companies are interested in developing therapeutics that rescue these changes in TDP-43 localization and function. However, to date, there are no biomarkers that could be used in a living person to monitor TDP-43 dysfunction or its rescue. The assay described here could be used in exactly this way. Furthermore, there is interest in STMN2 and its cryptic splicing itself as a target in ALS. The assay will allow for target engagement to be directly measured in patients during clinical studies.
The patient is currently a 40 year old male whose ALS symptoms first began in April 2017 with weakness in the left hand. The weakness progressively worsened and spread to involve bilateral hand and arm atrophy. Around May 2018, the patient developed progressively worsening leg spasticity, weakness and atrophy, and dysarthria. The diagnosis of ALS was established clinically in November 2017, and confirmed by EMG studies in March 2018. There is no family history of ALS; comprehensive exome and genome scans have not disclosed any mutations documented to cause ALS such as mutations in the C9ORF72 or SOD1 genes.
The patient takes three FDA-approved ALS therapies: riluzole, edaravone, and Nuedexta. Additionally, the patient was treated with autologous mesenchymal stem cells in South Korea in June and November 2019. Despite the foregoing therapies, the patient's clinical course and the ALSFRS trajectory have accelerated.
Stathmin2 (STMN2) is a 179 amino acid protein expressed exclusively in the CNS (and particularly prominently in spinal motor neurons) that controls stability of microtubules. Studied for years as SCG10 (superior cervical ganglion 10), STMN2 is essential for axon regrowth after injury. Strikingly, in 2019 two important papers independently documented that the function of stathmin2 is suppressed in many cases of sporadic ALS, as well as in ALS arising from mutations in genes encoding TDP43 and C9ORF72 (1, 2). These findings were recently independently confirmed by a third lab (3).
Importantly, these studies identified STMN2, one of the most abundant transcripts in human motor neurons, as a central TDP-43 interacting RNA. They also each provided support for a mechanism in sporadic ALS in which disruptions to protein homeostasis resulting from aging, environmental exposure, injury or ALS/FTD-causing mutations leading to TDP43 mislocalization, aggregation, and altered RNA metabolism—a pathology that is present in nearly all sporadic ALS cases. While the abundance of many transcripts changes due to loss of TDP-43 function, the precipitous loss of STMN2 after TDP-43 knockdown or loss of function provides compelling evidence linking STMN2 to TDP-43 pathology and the disruption of mechanisms protecting the axon and preventing neuropathy.
In light of this impressive recent literature, tissue was sampled from the patient, and culture conditions were developed for modeling impacts on his motor neurons. A series of studies directed at this pathway and the patient's cells were undertaken to study the mechanism of TDP-43 regulation of STMN2 in which TDP-43 binds to STMN2 pre-mRNA on the intron between exons 1 and 2. Either reduction of TDP-43 levels or nuclear egress leads to the same outcome for STMN2: early polyadenylation and splicing of a cryptic exon leading to a truncated STMN2 mRNA transcript at the cost of full-length transcript (
After extensive screening, a panel of three ASOs were identified, with one (SJ+94) that: (i) effectively corrects TDP-43-induced STMN2 mis-splicing in the patient's motor neurons and (ii) is non-toxic. Further analysis was also performed of the other two ASOs in the panel.
Patient's Motor Neurons have Less Nuclear TDP-43 when Compared to Healthy Individuals
The scientific discoveries that ultimately led to the ASOs in the panel, including SJ+94 and SJ-1, are that (1) sporadic ALS patients have mis-localization of TDP-43, i.e., less nuclear TDP-43 when compared to healthy individual, and (2) this mis-localization of TDP-43 causes mis-splicing of STMN2, leading to truncated, cryptic STMN2 in sporadic ALS patients which is a driver of the progression of their disease.
Cells were reprogramed from cells donated by the patient to generate induced pluripotent stem cells (iPSC) MGH 138 (
Once the patient's motor neurons were generated, it was determined to ascertain whether there is any difference in the nuclear TDP-43 in the patient's motor neurons versus healthy controls. As discussed above, loss of nuclear TDP-43, which can manifest as cytoplasmic mis-localization, is a pathological hallmark of sporadic ALS based on multiple analyses of post-mortem CNS tissues. Though far more difficult to detect in motor neurons than post-mortem tissue, at least one previous study has reported that iPSC-derived neurons from ALS patients can recapitulate TDP-43 pathology, including its cytoplasmic mis-localization.
Neurons were isolated from the patient's iPS cells as well as five healthy control iPSC lines. Immunocytochemistry was used to probe the subcellular localization of TDP-43 in the neurons (
Over the last two years three independent published studies have shown that depletion of nuclear TDP-43 in sporadic ALS patients causes truncation of STMN2. These studies however have involved post-mortem tissue of sporadic ALS patients. Thus, the patient's motor neurons were studied to see if the patient's STMN2 is similarly regulated by TDP-43. Therefore, while it has been demonstrated that the nuclear TDP-43 level in the patient's motor neurons was reduced when compared to non-ALS controls, it was then further reduced in an in vitro cell assay in order to more clearly assess the efficacy, if any, of the potential ASO's in suppressing cryptic STMN2 in the patient's motor neurons. This approach was required because definitive corroboration that TDP-43 and STMN2 are dysfunctional requires detailed analysis and dissection of CNS tissue, which is not an option for any living ALS patient. Moreover, this in vitro approach is fully consistent with the in vivo TDP-43 pathology (loss of functional TDP-43) in the patient with sporadic ALS.
To test whether the patient's STMN2 is regulated by TDP-43 the patient's motor neurons were treated with siTARDBP RNA, to reduce TDP-43 levels. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed to measure TDP-43 mRNA levels and it was confirmed that TDP-43 mRNA levels had been reduced in the patient's motor neurons relative to those exposed to a nontargeting siRNA (siCTRL) (
These results thus confirmed that the patient's STMN2 is regulated by TDP-43. Moreover, it was established that depletion of TDP-43 levels in the patient's motor neurons directly causes mis-splicing of STMN2 leading to truncated, cryptic STMN2 mRNA transcript at the cost of full-length transcript. With these results, it was then assessed whether the pathological effects in the patient's motor neurons would be amenable to therapeutic modulation using antisense oligonucleotides—the pharmacological approach used for nusinersen, eteplirsen, mipomersen, milasen and jacifusen.
To ensure that ASOs that were designed matched the patient's genetic signature, the region around the STMN2 cryptic exon—the intronic region that is retained upon TDP-43 dysfunction—was PCR-amplified from genomic DNA extracted from the patient's iPS cells. The region was focused on as it was hypothesized that defects in STMN2 transcription could be rescued by targeting ASOs to the RNA region from the cryptic splice site to the cryptic polyadenylation site, and which includes the TDP-43 binding site. The PCR product was then Sanger sequenced and confirmed that the targeted region was a perfect match between the patient's sequence and the reference genome (
ASOs targeting this region were designed and synthesized in order to attempt to correct the splicing defects observed in STMN2 transcript of the patient's motor neurons. In particular, several ASOs were designed to be complementary to a region of the pre-mRNA that is predicted to be unstructured and thus potentially accessible for ASO binding (this region is from bases 94 to 121 after the cryptic splice site). These ASOs were synthesized using two different chemistries (2′-O-methoxyethyl RNA (MOE), as well as chimeras of MOE with locked nucleic acid; all sequences contained phosphorothioate linkages) and were tiled along the intron ranging from just 5′ of the cryptic exon to the 3′ polyadenylation site (
In total, 51 ASOs were screened in the patient's motor neurons for their ability to (1) suppress the generation of truncated STMN2 transcript as well as (2) restore the full-length STMN2 transcript. ASO SJ+94 and ASO SJ-1 were selected as candidates after iterative screening experiments described below based upon their ability to both suppress cryptic splicing of STMN2 and restore full length STMN2 RNA in the patient's motor neurons (the latter in two different experiments), boost STMN2 protein levels in the patient's motor neurons and promote axonal regrowth in the patient's motor neurons—creating the potential for a real clinical benefit.
In the first experiment the patient's motor neurons were treated with siTARDBP, the patient's motor neurons were then cultured with the various ASOs over a range of concentrations (ranging from 30 nM to 0.03 nM) before extracting total RNA. Extracted RNA was used to synthesize cDNA by reverse transcription. qRT-PCR was used to assess levels for both truncated and full-length STMN2 RNAs normalized using RNA18S5 expression. While a number of ASOs showed promising results, ASO SJ+94's results stood out as it was able in a dose dependent manner to both (i) suppress cryptic splicing (
It was established that ASO (SJ+94) and ASO (SJ-1) suppressed cryptic splicing of STMN2 and restored full length STMN2 RNA in the patient's motor neurons when there is a reduction in nuclear TDP-43. It was then assessed to see if it would prove efficacious in a different experimental paradigm when TDP-43 was mis-localized. Post-mortem tissue studies have shown that TDP-43 mis-localization and its aggregation in cytoplasm is a hallmark of sporadic ALS. Several groups have reported cytoplasmic aggregation of TDP-43 akin to that observed in post-mortem tissue of sporadic ALS patients occurs in response to pharmacological inhibition of the proteasome (1, 4). This mis-localization of TDP-43 has also been shown to cause altered expression of its transcripts including STMN2.
Proteasome inhibition (MG-132 (1 uM)) in the patient's neurons, which induces nuclear depletion of TDP-43, led to decreased STMN2 expression (
After establishing and validating that the STMN2 ASOs could affect transcript levels, it was sought to determine if they could also rescue diminished protein levels observed after TDP-43 reduction. The patient's motor neurons were treated with siRNAs and either a nontargeting ASO (NTC) or one of the lead compounds from the screen (
It was previously demonstrated that TDP-43 depletion leads to reduced axonal regrowth after injury (1). A similar phenotype was observed in hMNs with reduced levels of STMN2 or completely lacking STMN2, which could be rescued through restoration of STMN2 or post-translational stabilization of STMN2 (1, 2). These results strongly implicate STMN2 in the motor neuropathy observed in ALS. To test if ASO SJ+94 could rescue axonal regrowth after TDP-43 depletion and injury, the patient's motor neurons were cultured in microfluidic devices that permitted axon growth into a chamber distinct from the neuronal cell bodies (
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. The scope of the present invention is not intended to be limited to the Description or the details set forth therein. Articles such as “a”, “an” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” or “and/or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the claims (whether original or subsequently added claims) is introduced into another claim (whether original or subsequently added). For example, any claim that is dependent on another claim can be modified to include one or more element(s), feature(s), or limitation(s) found in any other claim, e.g., any other claim that is dependent on the same base claim. Any one or more claims can be modified to explicitly exclude any one or more embodiment(s), element(s), feature(s), etc. For example, any particular sideroflexin, sideroflexin modulator, cell type, cancer type, etc., can be excluded from any one or more claims.
It should be understood that (i) any method of classification, prediction, treatment selection, treatment, etc., can include a step of providing a sample, e.g., a sample obtained from a subject in need of classification, prediction, treatment selection, treatment, for cancer, e.g., a cancer sample obtained from the subject; (ii) any method of classification, prediction, treatment selection, treatment, etc., can include a step of providing a subject in need of such classification, prediction, treatment selection, treatment, or treatment for cancer.
Where the claims recite a method, certain aspects of the invention provide a product, e.g., a kit, agent, or composition, suitable for performing the method.
Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. For purposes of conciseness only some of these embodiments have been specifically recited herein, but the present disclosure encompasses all such embodiments. It should also be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc.
Where numerical ranges are mentioned herein, the invention includes embodiments in which the endpoints are included, embodiments in which both endpoints are excluded, and embodiments in which one endpoint is included and the other is excluded. It should be assumed that both endpoints are included unless indicated otherwise. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. Where phrases such as “less than X”, “greater than X”, or “at least X” is used (where X is a number or percentage), it should be understood that any reasonable value can be selected as the lower or upper limit of the range. It is also understood that where a list of numerical values is stated herein (whether or not prefaced by “at least”), the invention includes embodiments that relate to any intervening value or range defined by any two values in the list, and that the lowest value may be taken as a minimum and the greatest value may be taken as a maximum. Furthermore, where a list of numbers, e.g., percentages, is prefaced by “at least”, the term applies to each number in the list. For any embodiment of the invention in which a numerical value is prefaced by “about” or “approximately”, the invention includes an embodiment in which the exact value is recited. For any embodiment of the invention in which a numerical value is not prefaced by “about” or “approximately”, the invention includes an embodiment in which the value is prefaced by “about” or “approximately”. “Approximately” or “about” generally includes numbers that fall within a range of 1% or in some embodiments 5% or in some embodiments 10% of a number in either direction (greater than or less than the number) unless otherwise stated or otherwise evident from the context (e.g., where such number would impermissibly exceed 100% of a possible value).
It should be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one act, the order of the acts of the method is not necessarily limited to the order in which the acts of the method are recited, but the disclosure encompasses embodiments in which the order is so limited. In some embodiments a method may be performed by an individual or entity. In some embodiments steps of a method may be performed by two or more individuals or entities such that a method is collectively performed. In some embodiments a method may be performed at least in part by requesting or authorizing another individual or entity to perform one, more than one, or all steps of a method. In some embodiments a method comprises requesting two or more entities or individuals to each perform at least one step of a method. In some embodiments performance of two or more steps is coordinated so that a method is collectively performed. It should also be understood that unless otherwise indicated or evident from the context, any product or composition described herein may be considered “isolated”. It should also be understood that, where applicable, unless otherwise indicated or evident from the context, any method or step of a method that may be amenable to being performed mentally or as a mental step or using a writing implement such as a pen or pencil, and a surface suitable for writing on, such as paper, may be expressly indicated as being performed at least in part, substantially, or entirely, by a machine, e.g., a computer, device (apparatus), or system, which may, in some embodiments, be specially adapted or designed to be capable of performing such method or step or a portion thereof.
Section headings used herein are not to be construed as limiting in any way. It is expressly contemplated that subject matter presented under any section heading may be applicable to any aspect or embodiment described herein.
Embodiments or aspects herein may be directed to any agent, composition, article, kit, and/or method described herein. It is contemplated that any one or more embodiments or aspects can be freely combined with any one or more other embodiments or aspects whenever appropriate. For example, any combination of two or more agents, compositions, articles, kits, and/or methods that are not mutually inconsistent, is provided. It will be understood that any description or exemplification of a term anywhere herein may be applied wherever such term appears herein (e.g., in any aspect or embodiment in which such term is relevant) unless indicated or clearly evident otherwise.
This application claims priority to U.S. Provisional Application No. 63/133,749, filed on Jan. 4, 2021, U.S. Provisional Application No. 63/063,174, filed on Aug. 7, 2020, and U.S. Provisional Application No. 62/994,797, filed on Mar. 25, 2020. The entire teachings of the above applications are incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/024254 | 3/25/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63133749 | Jan 2021 | US | |
| 63063174 | Aug 2020 | US | |
| 62994797 | Mar 2020 | US |
