Protein/(poly)peptide libraries

Abstract

The present invention relates to synthetic DNA sequences which encode one or more collections of homologous proteins/(poly)peptides, and methods for generating and applying libraries of these DNA sequences. In particular, the invention relates to the preparation of a library of human-derived antibody genes by the use of synthetic consensus sequences which cover the structural repertoire of antibodies encoded in the human genome. Furthermore, the invention relates to the use of a single consensus antibody gene as a universal framework for highly diverse antibody libraries.

Description

FIELD OF THE INVENTION

The present invention relates to synthetic DNA sequences which encode one or more collections of homologous proteins/(poly)peptides, and methods for generating and applying libraries of these DNA sequences. In particular, the invention relates to the preparation of a library of human-derived antibody genes by the use of synthetic consensus sequences which cover the structural repertoire of antibodies encoded in the human genome. Furthermore, the invention relates to the use of a single consensus antibody gene as a universal framework for highly diverse antibody libraries.

BACKGROUND OF THE INVENTION

All current recombinant methods which use libraries of proteins/(poly)peptides, e.g. antibodies, to screen for members with desired properties, e.g. binding a given ligand, do not provide the possibility to improve the desired properties of the members in an easy and rapid manner. Usually a library is created either by inserting a random oligonucleotide sequence into one or more DNA sequences cloned from an organism, or a family of DNA sequences is cloned and used as the library. The library is then screened, e.g. using phage display, for members which show the desired property. The sequences of one or more of these resulting molecules are then determined. There is no general procedure available to improve these molecules further on.

Winter (EP 0 368 684B1) has provided a method for amplifying (by PCR), cloning, and expressing antibody variable region genes. Starting with these genes he was able to create libraries of functional antibody fragments by randomizing the CDR3 of the heavy and/or the light chain. This process is functionally equivalent to the natural process of VJ and VDJ recombination which occurs during the development of B-cells in the immune system.

However the Winter invention does not provide a method for optimizing the binding affinities of antibody fragments further on, a process which would be functionally equivalent to the naturally occurring phenomenon of “affinity maturation”, which is provided by the present invention. Furthermore, the Winter invention does not provide for artificial variable region genes, which represent a whole family of structurally similar natural genes, and which can be assembled from synthetic DNA oligonucleotides. Additionally, Winter does not enable the combinatorial assembly of portions of antibody variable regions, a feature which is provided by the present invention. Furthermore, this approach has the disadvantage that the genes of all antibodies obtained in the screening procedure have to be completely sequenced, since, except for the PCR priming regions, no additional sequence information about the library members is available. This is time and labor intensive and potentially leads to sequencing errors.

The teaching of Winter as well as other approaches have tried to create large antibody libraries having high diversity in the complementarity determining regions (CDRs) as well as in the frameworks to be able to find antibodies against as many different antigens as possible. It has been suggested that a single universal framework may be useful to build antibody libraries, but no approach has yet been successful.

Another problem lies in the production of reagents derived from antibodies. Small antibody fragments show exciting promise for use as therapeutic agents, diagnostic reagents, and for biochemical research. Thus, they are needed in large amounts, and the expression of antibody fragments, e.g. Fv, single-chain Fv (scFv), or Fab in the periplasm of E. coli (Skerra & Plückthun, 1988; Better et al., 1988) is now used routinely in many laboratories. Expression yields vary widely, however. While some fragments yield up to several mg of functional, soluble protein per liter and OD of culture broth in shake flask culture (Carter et al., 1992, Plückthun et al. 1996), other fragments may almost exclusively lead to insoluble material, often found in so-called inclusion bodies. Functional protein may be obtained from the latter in modest yields by a laborious and time-consuming refolding process. The factors influencing antibody expression levels are still only poorly understood. Folding efficiency and stability of the antibody fragments, protease lability and toxicity of the expressed proteins to the host cells often severely limit actual production levels, and several attempts have been tried to increase expression yields. For example, Knappik & Plückthun (1995) could show that expression yield depends on the antibody sequence. They identified key residues in the antibody framework which influence expression yields dramatically. Similarly, Ullrich et al. (1995) found that point mutations in the CDRs can increase the yields in periplasmic antibody fragment expression. Nevertheless, these strategies are only applicable to a few antibodies. Since the Winter invention uses existing repertoires of antibodies, no influence on expressibility of the genes is possible.

Furthermore, the findings of Knappik & Plückthun and Ullrich demonstrate that the knowledge about antibodies, especially about folding and expression is still increasing. The Winter invention does not allow to incorporate such improvements into the library design.

The expressibility of the genes is important for the library quality as well, since the screening procedure relies in most cases on the display of the gene product on a phage surface, and efficient display relies on at least moderate expression of the gene.

These disadvantages of the existing methodologies are overcome by the present invention, which is applicable for all collections of homologous proteins. It has the following novel and useful features illustrated in the following by antibodies as an example:

Artificial antibodies and fragments thereof can be constructed based on known antibody sequences, which reflect the structural properties of a whole group of homologous antibody genes. Therefore it is possible to reduce the number of different genes without any loss in the structural repertoire. This approach leads to a limited set of artificial genes, which can be synthesized de novo, thereby allowing introduction of cleavage sites and removing unwanted cleavages sites. Furthermore, this approach enables (i), adapting the codon usage of the genes to that of highly expressed genes in any desired host cell and (ii), analyzing all possible pairs of antibody light (L) and heavy (H) chains in terms of interaction preference, antigen preference or recombinant expression titer, which is virtually impossible using the complete collection of antibody genes of an organism and all combinations thereof.

The use of a limited set of completely synthetic genes makes it possible to create cleavage sites at the boundaries of encoded structural sub-elements. Therefore, each gene is built up from modules which represent structural sub-elements on the protein/(poly)peptide level. In the case of antibodies, the modules consist of “framework” and “CDR” modules. By creating separate framework and CDR modules, different combinatorial assembly possibilities are enabled. Moreover, if two or more artificial genes carry identical pairs of cleavage sites at the boundaries of each of the genetic sub-elements, pre-built libraries of sub-elements can be inserted in these genes simultaneously, without any additional information related to any particular gene sequence. This strategy enables rapid optimization of, for example, antibody affinity, since DNA cassettes encoding libraries of genetic sub-elements can be (i), pre-built, stored and reused and (ii), inserted in any of these sequences at the right position without knowing the actual sequence or having to determine the sequence of the individual library member.

Additionally, new information about amino acid residues important for binding, stability, or solubility and expression could be integrated into the library design by replacing existing modules with modules modified according to the new observations.

The limited number of consensus sequences used for creating the library allows to speed up the identification of binding antibodies after screening. After having identified the underlying consensus gene sequence, which could be done by sequencing or by using fingerprint restriction sites, just those part(s) comprising the random sequence(s) have to be determined. This reduces the probability of sequencing errors and of false-positive results.

The above mentioned cleavage sites can be used only if they are unique in the vector system where the artificial genes have been inserted. As a result, the vector has to be modified to contain none of these cleavage sites. The construction of a vector consisting of basic elements like resistance gene and origin of replication, where cleavage sites have been removed, is of general interest for many cloning attempts. Additionally, these vector(s) could be part of a kit comprising the above mentioned artificial genes and pre-built libraries.

The collection of artificial genes can be used for a rapid humanization procedure of non-human antibodies, preferably of rodent antibodies. First, the amino acid sequence of the non-human, preferably rodent antibody is compared with the amino acid sequences encoded by the collection of artificial genes to determine the most homologous light and heavy framework regions. These genes are then used for insertion of the genetic sub-elements encoding the CDRs of the non-human, preferably rodent antibody.

Surprisingly, it has been found that with a combination of only one consensus sequence for each of the light and heavy chains of a scFv fragment an antibody repertoire could be created yielding antibodies against virtually every antigen. Therefore, one aspect of the present invention is the use of a single consensus sequence as a universal framework for the creation of useful (poly)peptide libraries and antibody consensus sequences useful therefor.

DETAILED DESCRIPTION OF THE INVENTION

The present invention enables the creation of useful libraries of (poly)peptides. In a first embodiment, the invention provides for a method of setting up nucleic acid sequences suitable for the creation of said libraries. In a first step, a collection of at least three homologous proteins is identified and then analyzed. Therefore, a database of the protein sequences is established where the protein sequences are aligned to each other. The database is used to define subgroups of protein sequences which show a high degree of similarity in both the sequence and, if information is available, in the structural arrangement. For each of the subgroups a (poly)peptide sequence comprising at least one consensus sequence is deduced which represents the members of this subgroup; the complete collection of (poly)peptide sequences represent therefore the complete structural repertoire of the collection of homologous proteins. These artificial (poly)peptide sequences are then analyzed, if possible, according to their structural properties to identify unfavorable interactions between amino acids within said (poly)peptide sequences or between said or other (poly)peptide sequences, for example, in multimeric proteins. Such interactions are then removed by changing the consensus sequence accordingly. The (poly)peptide sequences are then analyzed to identify sub-elements such as domains, loops, helices or CDRs. The amino acid sequence is backtranslated into a corresponding coding nucleic acid sequence which is adapted to the codon usage of the host planned for expressing said nucleic acid sequences. A set of cleavage sites is set up in a way that each of the sub-sequences encoding the sub-elements identified as described above, is flanked by two sites which do not occur a second time within the nucleic acid sequence. This can be achieved by either identifying a cleavage site already flanking a sub-sequence of by changing one or more nucleotides to create the cleavage site, and by removing that site from the remaining part of the gene. The cleavage sites should be common to all corresponding sub-elements or sub-sequences, thus creating a fully modular arrangement of the sub-sequences in the nucleic acid sequence and of the sub-elements in the corresponding (poly)peptide.

In a further embodiment, the invention provides for a method which sets up two or more sets of (poly)peptides, where for each set the method as described above is performed, and where the cleavage sites are not only unique within each set but also between any two sets. This method can be applied for the creation of (poly)peptide libraries comprising for example two a-helical domains from two different proteins, where said library is screened for novel hetero-association domains.

In yet a further embodiment, at least two of the sets as described above, are derived from the same collection of proteins or at least a part of it. This describes libraries comprising for example, but not limited to, two domains from antibodies such as VH and VL, or two extracellular loops of transmembrane receptors.

In another embodiment, the nucleic acid sequences set up as described above, are synthesized. This can be achieved by any one of several methods well known to the practitioner skilled in the art, for example, by total gene synthesis or by PCR-based approaches.

In one embodiment, the nucleic acid sequences are cloned into a vector. The vector could be a sequencing vector, an expression vector or a display (e.g. phage display) vector, which are well known to those skilled in the art. Any vector could comprise one nucleic acid sequence, or two or more nucleic sequences, either in different or the same operon. In the last case, they could either be cloned separately or as contiguous sequences.

In one embodiment, the removal of unfavorable interactions as described above, leads to enhanced expression of the modified (poly)peptides.

In a preferred embodiment, one or more sub-sequences of the nucleic acid sequences are replaced by different sequences. This can be achieved by excising the sub-sequences using the conditions suitable for cleaving the cleavage sites adjacent to or at the end of the sub-sequence, for example, by using a restriction enzyme at the corresponding restriction site under the conditions well known to those skilled in the art, and replacing the sub-sequence by a different sequence compatible with the cleaved nucleic acid sequence. In a further preferred embodiment, the different sequences replacing the initial sub-sequence(s) are genomic or rearranged genomic sequences, for example in grafting CDRs from non-human antibodies onto consensus antibody sequences for rapid humanization of non-human antibodies. In the most preferred embodiment, the different sequences are random sequences, thus replacing the sub-sequence by a collection of sequences to introduce variability and to create a library. The random sequences can be assembled in various ways, for example by using a mixture of mononucleotides or preferably a mixture of trinucleotides (Virnekäs et al., 1994) during automated oligonucleotide synthesis, by error-prone PCR or by other methods well known to the practitioner in the art. The random sequences may be completely randomized or biased towards or against certain codons according to the amino acid distribution at certain positions in known protein sequences. Additionally, the collection of random sub-sequences may comprise different numbers of codons, giving rise to a collection of sub-elements having different lengths.

In another embodiment, the invention provides for the expression of the nucleic acid sequences from a suitable vector and under suitable conditions well known to those skilled in the art.

In a further preferred embodiment, the (poly)peptides expressed from said nucleic acid sequences are screened and, optionally, optimized. Screening may be performed by using one of the methods well known to the practitioner in the art, such as phage-display, selectively infective phage, polysome technology to screen for binding, assay systems for enzymatic activity or protein stability. (Poly)peptides having the desired property can be identified by sequencing of the corresponding nucleic acid sequence or by amino acid sequencing or mass spectrometry. In the case of subsequent optimization, the nucleic acid sequences encoding the initially selected (poly)peptides can optionally be used without sequencing. Optimization is performed by repeating the replacement of sub-sequences by different sequences, preferably by random sequences, and the screening step one or more times.

The desired property the (poly)peptides are screened for is preferably, but not exclusively, selected from the group of optimized affinity or specificity for a target molecule, optimized enzymatic activity, optimized expression yields, optimized stability and optimized solubility.

In one embodiment, the cleavage sites flanking the sub-sequences are sites recognized and cleaved by restriction enzymes, with recognition and cleavage sequences being either identical or different, the restricted sites either having blunt or sticky ends.

The length of the sub-elements is preferably, but not exclusively ranging between 1 amino acid, such as one residue in the active site of an enzyme or a structure-determining residue, and 150 amino acids, as for whole protein domains. Most preferably, the length ranges between 3 and 25 amino acids, such as most commonly found in CDR loops of antibodies.

The nucleic acid sequences could be RNA or, preferably, DNA.

In one embodiment, the (poly)peptides have an amino acid pattern characteristic of a particular species. This can for example be achieved by deducing the consensus sequences from a collection of homologous proteins of just one species, most preferably from a collection of human proteins. Since the (poly)peptides comprising consensus sequences are artificial, they have to be compared to the protein sequence(s) having the closest similarity to ensure the presence of said characteristic amino acid pattern.

In one embodiment, the invention provides for the creation of libraries of (poly)peptides comprising at least part of members or derivatives of the immunoglobulin superfamily, preferably of member or derivatives of the immunoglobulins. Most preferably, the invention provides for the creation of libraries of human antibodies, wherein said (poly)peptides are or are derived from heavy or light chain, variable regions wherein said structural sub-elements are framework regions (FR) 1, 2, 3, or 4 or complementary determining regions (CDR) 1, 2, or 3. In a first step, a database of published antibody sequences of human origin is established where the antibody sequences are aligned to each other. The database is used to define subgroups of antibody sequences which show a high degree of similarity in both the sequence and the canonical fold of CDR loops (as determined by analysis of antibody structures). For each of the subgroups a consensus sequence is deduced which represents the members of this subgroup; the complete collection of consensus sequences represent therefore the complete structural repertoire of human antibodies.

These artificial genes are then constructed e.g. by total gene synthesis or by the use of synthetic genetic subunits. These genetic subunits correspond to structural sub-elements on the (poly)peptide level. On the DNA level, these genetic subunits are defined by cleavage sites at the start and the end of each of the sub-elements, which are unique in the vector system. All genes which are members of the collection of consensus sequences are constructed such that they contain a similar pattern of corresponding genetic sub-sequences. Most preferably, said (poly)peptides are or are derived from the HuCAL consensus genes: Vκ1, Vκ2, Vκ3, Vκ4, Vλ1, Vλ2, Vλ3, VH1A, VH1B, VH2, VH3, VH4, VH5, VH6, Cκ, Cλ, CH1 or any combination of said HuCAL consensus genes.

This collection of DNA molecules can then be used to create libraries of antibodies or antibody fragments, preferably Fv, disulphide-linked Fv, single-chain Fv (scFv), or Fab fragments, which may be used as sources of specificities against new target antigens. Moreover, the affinity of the antibodies can be optimized using pre-built library cassettes and a general procedure. The invention provides a method for identifying one or more genes encoding one or more antibody fragments which binds to a target, comprising the steps of expressing the antibody fragments, and then screening them to isolate one or more antibody fragments which bind to a given target molecule. Preferably, an scFv fragment library comprising the combination of HuCAL VH3 and HuCAL Vλ2 consensus genes and at least a random sub-sequence encoding the heavy chain CDR3 sub-element is screened for binding antibodies. If necessary, the modular design of the genes can then be used to excise from the genes encoding the antibody fragments one or more genetic sub-sequences encoding structural sub-elements, and replacing them by one or more second sub-sequences encoding structural sub-elements. The expression and screening steps can then be repeated until an antibody having the desired affinity is generated.

Particularly preferred is a method in which one or more of the genetic subunits (e.g. the CDRs) are replaced by a random collection of sequences (the library) using the said cleavage sites. Since these cleavage sites are (i) unique in the vector system and (ii) common to all consensus genes, the same (pre-built) library can be inserted into all artificial antibody genes. The resulting library is then screened against any chosen antigen. Binding antibodies are selected, collected and used as starting material for the next library. Here, one or more of the remaining genetic subunits are randomized as described above.

A further embodiment of the present invention relates to fusion proteins by providing for a DNA sequence which encodes both the (poly)peptide, as described above, as well as an additional moiety. Particularly preferred are moieties which have a useful therapeutic function. For example, the additional moiety may be a toxin molecule which is able to kill cells (Vitetta et al., 1993). There are numerous examples of such toxins, well known to the one skilled in the art, such as the bacterial toxins Pseudomonas exotoxin A, and diphtheria toxin, as well as the plant toxins ricin, abrin, modeccin, saporin, and gelonin. By fusing such a toxin for example to an antibody fragment, the toxin can be targeted to, for example, diseased cells, and thereby have a beneficial therapeutic effect. Alternatively, the additional moiety may be a cytokine, such as IL-2 (Rosenberg & Lotze, 1986), which has a particular effect (in this case a T-cell proliferative effect) on a family of cells. In a further embodiment, the additional moiety may confer on its (poly)peptide partner a means of detection and/or purification. For example, the fusion protein could comprise the modified antibody fragment and an enzyme commonly used for detection purposes, such as alkaline phosphatase (Blake et al., 1984). There are numerous other moieties which can be used as detection or purification tags, which are well known to the practitioner skilled in the art. Particularly preferred are peptides comprising at least five histidine residues (Hochuli et al., 1988), which are able to bind to metal ions, and can therefore be used for the purification of the protein to which they are fused (Lindner et al., 1992). Also provided for by the invention are additional moieties such as the commonly used C-myc and FLAG tags (Hopp et al., 1988; Knappik & Plückthun, 1994).

By engineering one or more fused additional domains, antibody fragments or any other (poly)peptide can be assembled into larger molecules which also fall under the scope of the present invention. For example, mini-antibodies (Pack, 1994) are dimers comprising two antibody fragments, each fused to a self-associating dimerization domain. Dimerization domains which are particularly preferred include those derived from a leucine zipper (Pack & Plückthun, 1992) or helix-turn-helix motif (Pack et al., 1993).

All of the above embodiments of the present invention can be effected using standard techniques of molecular biology known to anyone skilled in the art.

In a further embodiment, the random collection of sub-sequences (the library) is inserted into a singular nucleic acid sequence encoding one (poly)peptide, thus creating a (poly)peptide library based on one universal framework. Preferably a random collection of CDR sub-sequences is inserted into a universal antibody framework, for example into the HuCAL H3κ2 single-chain Fv fragment described above.

In further embodiments, the invention provides for nucleic acid sequence(s), vector(s) containing the nucleic acid sequencers), host cell(s) containing the vector(s), and (poly)peptides, obtainable according to the methods described above.

In a further preferred embodiment, the invention provides for modular vector systems being compatible with the modular nucleic acid sequences encoding the (poly)peptides. The modules of the vectors are flanked by restriction sites unique within the vector system and essentially unique with respect to the restriction sites incorporated into the nucleic acid sequences encoding the (poly)peptides, except for example the restriction sites necessary for cloning the nucleic acid sequences into the vector. The list of vector modules comprises origins of single-stranded replication, origins of double-stranded replication for high- and low copy number plasmids, promotor/operator, repressor or terminator elements, resistance genes, potential recombination sites, gene III for display on filamentous phages, signal sequences, purification and detection tags, and sequences of additional moieties. The vectors are preferably, but not exclusively, expression vectors or vectors suitable for expression and screening of libraries.

In another embodiment, the invention provides for a kit, comprising one or more of the list of nucleic acid sequence(s), recombinant vector(s), (poly)peptide(s), and vector(s) according to the methods described above, and suitable host cell(s) for producing the (poly)peptide(s).

In a preferred embodiment, the invention provides for the creation of libraries of human antibodies. In a first step, a database of published antibody sequences of human origin is established. The database is used to define subgroups of antibody sequences which show a high degree of similarity in both the sequence and the canonical fold (as determined by analysis of antibody structures). For each of the subgroups a consensus sequence is deduced which represents the members of this subgroup; the complete collection of consensus sequences represent therefore the complete structural repertoire of human antibodies.

These artificial genes are then constructed by the use of synthetic genetic subunits. These genetic subunits correspond to structural sub-elements on the protein level. On the DNA level, these genetic subunits are defined by cleavage sites at the start and the end of each of the subelements, which are unique in the vector system. All genes which are members of the collection of consensus sequences are constructed such that they contain a similar pattern of said genetic subunits.

This collection of DNA molecules can then be used to create libraries of antibodies which may be used as sources of specificities against new target antigens. Moreover, the affinity of the antibodies can be optimised using pre-built library cassettes and a general procedure. The invention provides a method for identifying one or more genes encoding one or more antibody fragments which binds to a target, comprising the steps of expressing the antibody fragments, and then screening them to isolate one or more antibody fragments which bind to a given target molecule. If necessary, the modular design of the genes can then be used to excise from the genes encoding the antibody fragments one or more genetic sub-sequences encoding structural sub-elements, and replacing them by one or more second sub-sequences encoding structural sub-elements. The expression and screening steps can then be repeated until an antibody having the desired affinity is generated.

Particularly preferred is a method in which one or more of the genetic subunits (e.g. the CDR's) are replaced by a random collection of sequences (the library) using the said cleavage sites. Since these cleavage sites are (i) unique in the vector system and (ii) common to all consensus genes, the same (pre-built) library can be inserted into all artificial antibody genes. The resulting library is then screened against any chosen antigen. Binding antibodies are eluted, collected and used as starting material for the next library. Here, one or more of the remaining genetic subunits are randomised as described above.

Definitions

Protein

The term protein comprises monomeric polypeptide chains as well as homo- or heteromultimenac complexes of two or more polypeptide chains connected either by covalent interactions (such as disulphide bonds) or by non-covalent interactions (such as hydrophobic or electrostatic interactions).

Analysis of Homologous Proteins

The amino acid sequences of three or more proteins are aligned to each other (allowing for introduction of gaps) in a way which maximizes the correspondence between identical or similar amino acid residues at all positions. These aligned sequences are termed homologous if the percentage of the sum of identical and/or similar residues exceeds a defined threshold. This threshold is commonly regarded by those skilled in the art as being exceeded when at least 15% of the amino acids in the aligned genes are identical, and at least 30% are similar. Examples for families of homologous proteins are: immunoglobulin superfamily, scavenger receptor superfamily, fibronectin superfamilies (e.g. type II and III), complement control protein superfamily, cytokine receptor superfamily, cystine knot proteins, tyrosine kinases, and numerous other examples well known to one of ordinary skill in the art.

Consensus Sequence

Using a matrix of at least three aligned amino acid sequences, and allowing for gaps in the alignment, it is possible to determine the most frequent amino acid residue at each position. The consensus sequence is that sequence which comprises the amino acids which are most frequently represented at each position. In the event that two or more amino acids are equally represented at a single position, the consensus sequence includes both or all of those amino acids.

Removing Unfavorable Interactions

The consensus sequence is per se in most cases artificial and has to be analyzed in order to change amino acid residues which, for example, would prevent the resulting molecule to adapt a functional tertiary structure or which would block the interaction with other (poly)peptide chains in multimeric complexes. This can be done either by (i) building a three-dimensional model of the consensus sequence using known related structures as a template, and identifying amino acid residues within the model which may interact unfavorably with each other, or (ii) analyzing the matrix of aligned amino acid sequences in order to detect combinations of amino acid residues within the sequences which frequently occur together in one sequence and are therefore likely to interact with each other. These probable interaction-pairs are then tabulated and the consensus is compared with these “interaction maps”. Missing or wrong interactions in the consensus are repaired accordingly by introducing appropriate changes in amino acids which minimize unfavorable interactions.

Identification of Structural Sub-elements

Structural sub-elements are stretches of amino acid residues within a protein/(poly)peptide which correspond to a defined structural or functional part of the molecule. These can be loops (e.g. CDR loops of an antibody) or any other secondary or functional structure within the protein/(poly)peptide (domains, α-helices, β-sheets, framework regions of antibodies, etc.). A structural sub-element can be identified using known structures of similar or homologous (poly)peptides, or by using the above mentioned matrices of aligned amino acid sequences. Here the variability at each position is the basis for determining stretches of amino acid residues which belong to a structural sub-element (e.g. hypervariable regions of an antibody).

Sub-sequence

A sub-sequence is defined as a genetic module which is flanked by unique cleavage sites and encodes at least one structural sub-element. It is not necessarily identical to a structural sub-element.

Cleavage Site

A short DNA sequence which is used as a specific target for a reagent which cleaves DNA in a sequence-specific manner (e.g. restriction endonucleases).

Compatible Cleavage Sites

Cleavage sites are compatible with each other, if they can be efficiently ligated without modification and, preferably, also without adding an adapter molecule.

Unique Cleavage Sites

A cleavage site is defined as unique if it occurs only once in a vector containing at least one of the genes of interest, or if a vector containing at least one of the genes of interest could be treated in a way that only one of the cleavage sites could be used by the cleaving agent.

Corresponding (poly)peptide Sequences

Sequences deduced from the same part of one group of homologous proteins are called corresponding (poly)peptide sequences.

Common Cleavage Sites

A cleavage site in at least two corresponding sequences, which occurs at the same functional position (i.e. which flanks a defined sub-sequence), which can be hydrolyzed by the same cleavage tool and which yields identical compatible ends is termed a common cleavage site.

Excising Genetic Sub-sequences

A method which uses the unique cleavage sites and the corresponding cleavage reagents to cleave the target DNA at the specified positions in order to isolate, remove or replace the genetic sub-sequence flanked by these unique cleavage sites.

Exchanging Genetic Sub-sequences

A method by which an existing sub-sequence is removed using the flanking cleavage sites of this sub-sequence, and a new sub-sequence or a collection of sub-sequences, which contain ends compatible with the cleavage sites thus created, is inserted.

Expression of Genes

The term expression refers to in vivo or in vitro processes, by which the information of a gene is transcribed into mRNA and then translated into a protein/(poly)peptide. Thus, the term expression refers to a process which occurs inside cells, by which the information of a gene is transcribed into mRNA and then into a protein. The term expression also includes all events of post-translational modification and transport, which are necessary for the (poly)peptide to be functional.

Screening of Protein/(poly)peptide Libraries

Any method which allows isolation of one or more proteins/(poly)peptides having a desired property from other proteins/(poly)peptides within a library.

Amino Acid Pattern Characteristic for a Species

A (poly)peptide sequence is assumed to exhibit an amino acid pattern characteristic for a species if it is deduced from a collection of homologous proteins from just this species.

Immunoglobulin Superfamily (IgSF)

The IgSF is a family of proteins comprising domains being characterized by the immunoglobulin fold. The IgSF comprises for example T-cell receptors and the immunoglobulins (antibodies).

Antibody Framework

A framework of an antibody variable domain is defined by Kabat et al. (1991) as the part of the variable domain which serves as a scaffold for the antigen binding loops of this variable domain.

Antibody CDR

The CDRs (complementarity determining regions) of an antibody consist of the antigen binding loops, as defined by Kabat et al. (1991). Each of the two variable domains of an antibody Fv fragment contain three CDRs.

HuCAL

Acronym for Human Combinatorial Antibody Library. Antibody Library based on modular consensus genes according to the invention (see Example 1).

Antibody Fragment

Any portion of an antibody which has a particular function, e.g. binding of antigen. Usually, antibody fragments are smaller than whole antibodies. Examples are Fv, disulphide-linked Fv, single-chain Fv (scFv), or Fab fragments. Additionally, antibody fragments are often engineered to include new functions or properties.

Universal Framework

One single framework which can be used to create the full variability of functions, specificities or properties which is originally sustained by a large collection of different frameworks, is called universal framework.

Binding of an Antibody to its Target

The process which leads to a tight and specific association between an antibody and a corresponding molecule or ligand is called binding. A molecule or ligand or any part of a molecule or ligand which is recognized by an antibody is called the target.

Replacing Genetic Sub-sequences

A method by which an existing sub-sequence is removed using the flanking cleavage sites of this sub-sequence, and a new sub-sequence or collection of sub-sequences, which contains ends compatible with the cleavage, sites thus created, is inserted.

Assembling of Genetic Sequences

Any process which is used to combine synthetic or natural genetic sequences in a specific manner in order to get longer genetic sequences which contain at least parts of the used synthetic or natural genetic sequences.

Analysis of Homologous Genes

The corresponding amino acid sequences of two or more genes are aligned to each other in a way which maximizes the correspondence between identical or similar amino acid residues at all positions. These aligned sequences are termed homologous if the percentage of the sum of identical and/or similar residues exceeds a defined threshold. This threshold is commonly regarded by those skilled in the art as being exceeded when at least 15 per cent of the amino acids in the aligned genes are identical, and at least 30 per cent are similar.

LEGENDS TO FIGURES AND TABLES

FIG. 1 : Flow chart outlining the process of construction of a synthetic human antibody library based on consensus sequences.

FIGS. 2 A- 2 G: Alignment of consensus sequences designed for each subgroup (amino acid residues are shown with their standard one-letter abbreviation). ( 2 A- 2 B) (SEQ ID NOS 28-31, respectively) kappa sequences, ( 2 C- 2 D) (SEQ ID NOS 32-34, respectively) lambda sequences and ( 2 E- 2 G) (SEQ ID NOS 35-41, respectively), heavy chain sequences. The positions are numbered according to Kabat (1991). In order to maximize homology in the alignment, gaps (−) have been introduced in the sequence at certain positions.

FIGS. 3 A- 3 K: Gene sequences (SEQ ID NOS 42, 44, 46 and 48, respectively) of the synthetic V kappa consensus genes. The corresponding amino acid sequences (SEQ ID NOS 43, 45, 47 and 49, respectively) (see FIGS. 2A-2B ) as well as the unique cleavage sites are also shown.

FIGS. 4 A- 4 I: Gene sequences (SEQ ID NOS 50, 52 and 54, respectively) of the synthetic V lambda consensus genes. The corresponding amino acid sequences (SEQ ID NOS 51, 53 and 55, respectively) (see FIGS. 2C-2D ) as well as the unique cleavage sites are also shown.

FIGS. 5 A- 5 U: Gene sequences (SEQ ID NOS 56, 58, 60, 62, 64, 66 and 68, respectively) of the synthetic V heavy chain consensus genes. The corresponding amino acid sequences (SEQ ID NOS 57, 59, 61, 63, 65, 67 and 69, respectively) (see FIGS. 2E-2G ) as well as the unique cleavage sites are also shown.

FIGS. 6 A- 6 G: Oligonucleotides (SEQ ID NOS 70-164, respectively) used for construction of the consensus genes. The oligos are named according to the corresponding consensus gene, e.g. the gene Vκ1 was constructed using the six oligonucleotides O1K1 to O1K6. The oligonucleotides used for synthesizing the genes encoding the constant domains Cκ (OCLK1 to 8) and CH1 (OCH1 to 8) are also shown.

FIGS. 7 A- 7 D: Sequences of the synthetic genes (SEQ ID NOS 165 and 167, respectively) encoding the constant domains Cκ ( 7 A- 7 B) and CH1 ( 7 C- 7 D). The corresponding amino acid sequences (SEQ ID NOS 166 and 168, respectively) as well as unique cleavage sites introduced in these genes are also shown.

FIGS. 7 E- 7 H: Functional map and sequence (SEQ ID NOS 169-170, respectively) of module M24 comprising the synthetic Cλ gene segment (huCL lambda).

FIGS. 7 I- 7 J: Oligonucleotides (SEQ ID NOS 171-176) used for synthesis of module M24.

FIGS. 8 A- 8 E: Sequence (SEQ ID NOS 177-178, respectively) and restriction map of the synthetic gene encoding the consensus single-chain fragment VH3-Vκ2. The signal sequence (amino acids 1 to 21) was derived from the E. coli phoA gene (Skerra & Plückthun, 1988). Between the phoA signal sequence and the VH3 domain, a short sequence stretch encoding 4 amino acid residues (amino acid 22 to 25) has been inserted in order to allow detection of the single-chain fragment in Western blot or ELISA using the monoclonal antibody M1 (Knappik & Plückthun, 1994). The last 6 basepairs of the sequence were introduced for cloning purposes (EcoRI site).

FIG. 9 : Plasmid map of the vector plG10.3 used for phage display of the H3κ2 scFv fragment. The vector is derived from plG10 and contains the gene for the lac operon repressor, lac, the artificial operon encoding the H3κ2-gene3ss fusion under control of the lac promoter, the Ipp terminator of transcription, the single-strand replication origin of the E. coli phage 11 (F1_ORI), a gene encoding β-lactamase (bla) and the ColEI derived origin of replication.

FIGS. 10 A- 10 B: Sequencing results of independent clones from the initial library, translated into the corresponding amino acid sequences. (A) (SEQ ID NO: 179) Amino acid sequence of the VH3 consensus heavy chain CDR3 (position 93 to 102, Kabat numbering). (B) (SEQ ID NOS 180-191, respectively) Amino acid sequences of 12 clones of the 10-mer library. (C) (SEQ ID NOS 192-202, respectively) Amino acid sequences of 11 clones of the 15-mer library, *: single base deletion.

FIG. 11 : Expression test of individual library members. (A) Expression of 9 independent clones of the 10-mer library. (B) Expression of 9 independent clones of the 15-mer library. The lane designated with M contains the size marker. Both the gp3-scFv fusion and the scFv monomer are indicated.

FIG. 12 : Enrichment of specific phage antibodies during the panning against FITC-BSA. The initial as well as the subsequent fluorescein-specific sub-libraries were panned against the blocking buffer and the ratio of the phage eluted from the FITC-BSA coated well vs. that from the powder milk coated well from each panning round is presented as the “specificity factor”.

FIG. 13 : Phage ELISA of 24 independent clones after the third round of panning tested for binding on FITC-BSA.

FIG. 14 : Competition ELISA of selected FITC-BSA binding clones. The ELISA signals (OD 405 nm ) of scFv binding without inhibition are taken as 100.

FIG. 15 : Sequences results of the heavy chain CDR3s of independent clones after 3 rounds of planning against FITC-BSA, translated into the corresponding amino acid sequences (SEQ ID NOS 203-218, respectively) (position 93 to 102. Kabat numbering).

FIG. 16 : Coomassie-Blue stained SDS-PAGE of the purified anti-fluorescein scFv fragments: M: molecular weight marker, A: total soluble cell extract after induction, B: fraction of the flow-through, C, D and E: purified scFv fragments 1HA-3E4, 1HA-3E5 and 1HA-3E10, respectively.

FIG. 17 : Enrichment of specific phage antibodies during the panning against β-estradiol-BSA, testosterone-BSA, BSA, ESL-1, interleukin-2, lymphotoxin-β, and LeY-BSA after three rounds of panning.

FIG. 18 : ELISA of selected ESL-1 and β-estradiol binding clones.

FIG. 19 : Selectivity and cross-reactivity of HuCAL antibodies: in the diagonal specific binding of HuCAL antibodies can be seen, off-diagonal signals show non-specific cross-reactivity.

FIG. 20 : Sequencing results of the heavy chain CDR3s of independent clones after 3 rounds of panning against β-estradiol-BSA, translated into the corresponding amino acid sequences (SEQ ID NOS 219-230 respectively) (position 93 to 102, Kabat numbering). One clone is derived from the 10 mer library.

FIG. 21 : Sequencing results of the heavy chain CDR3s of independent clones after 3 rounds of panning against testosterone-BSA, translated into the corresponding amino acid sequences (SEQ ID NOS 231-236, respectively) (position 93 to 102, Kabat numbering).

FIG. 22 : Sequencing results of the heavy chain CDR3s of independent clones after 3 rounds of panning against lymphotoxin-β, translated into the corresponding amino acid sequences (SEQ ID NOS 237-244, respectively) (position 93 to 102, Kabat numbering). One clone comprises a 14 mer CDR, presumably introduced by incomplete coupling of the trinucleotide mixture during oligonucleotide synthesis.

FIG. 23 : Sequencing results of the heavy chain CDR3s of independent clones after 3 rounds of panning agains ESL-1, translated into the corresponding amino acid sequences (SEQ ID NOS 245-256, respectively) (position 93 to 102, Kabat numbering). Two clones are derived from the 10 mer library. One clone comprises a 16 mer CDR, presumably introduced by chain elongation during oligonucleotide synthesis using trinucleotides.

FIG. 24 : Sequencing results of the heavy chain CDR3s of independent clones after 3 rounds of panning against BSA, translated into the corresponding amino acid sequences (SEQ ID NOS 257-262, respectively) (position 93 to 102, Kabat numbering).

FIGS. 27 A- 27 B: Functional map and sequence (SEQ ID NO: 263) of the multi-cloning site module (MCS).

FIGS. 28 A- 28 G: Functional map and sequence (SEQ ID NO: 264-265, respectively) of the pMCS cloning vector series.

FIGS. 29 A- 29 B: Functional map and sequence (SEQ ID NO: 266) of the pCAL module M1 (see FIGS. 26 A- 26 D).

FIGS. 30 A- 30 C: Functional map and sequence (SEQ ID NOS 267-268, respectively) of the pCAL module M7-III (see FIGS. 26 A- 26 D).

FIGS. 31 A- 31 B: Functional map and sequence (SEQ ID NO: 269) of the pCAL module M9-II (see FIGS. 26 A- 26 D).

FIGS. 32 A- 32 C: Functional map and sequence (SEQ ID NO: 270) of the pCAL module M11-II (see FIGS. 26 A- 26 D).

FIGS. 33 A- 33 D: Functional map and sequence (SEQ ID NO: 271) of the pCAL module M14-Ext2 (see FIGS. 26 A- 26 D).

FIGS. 34 A- 34 D: Functional map and sequence (SEQ ID NOS 272-273, respectively) of the pCAL module M17 (see FIGS. 26 A- 26 D).

FIGS. 35 A- 35 I: Functional map and sequence (SEQ ID NOS 274-276, respectively) module vector pCAL4.

FIGS. 35 J- 35 XXX: Functional maps and sequences (SEQ ID NOS 277-300, respectively) of additional pCAL modules (M2, M3, M7I, M7II, M8, M10II, M11II, M12, M13, M19, M20, M21, M41) and of low-copy number plasmid vectors (pCALO1 to pCALO3).

FIGS. 35 YYY- 35 CCCC: List of oligonucleotides and primers (SEQ ID NOS 301-360, respectively) used for synthesis of pCAL vector modules.

FIGS. 36 A- 36 F: Functional map and sequence (SEQ ID NOS 361-362, respectively) of the β-lactamase cassette for replacement of CDRs for CDR library cloning.

FIGS. 37 A- 37 D: Oligo and primer (SEQ ID NOS 363-367, respectively) design for Vκ CDR3 libraries.

FIGS. 38 A- 38 D: Oligo and primer (SEQ ID NOS 368-371, respectively) design for Vλ CDR3 libraries.

FIG. 39 : Functional map of the pBS13 expression vector series.

FIGS. 40 A- 40 B: Expression of all 49 HuCAL scFvs obtained by combining each of the 7 VH genes with each of the 7 VL genes (pBS 13, 30° C.): Values are given for the percentage of soluble vs. insoluble material, the total and the soluble amount compared to the combination H3P2, which was set to 100%. In addition, the corresponding values for the McPC603 scFv are given.

Table 1: Summary of human immunoglobulin germline sequences used for computing the germline membership of rearranged sequences. (A) kappa sequences, (B) lambda sequences and (C), heavy chain sequences. (1) The germline name used in the various calculations, (2) the references number for the corresponding sequence (see appendix for sequence related citations), (3) the family where each sequence belongs to and (4), the various names found in literature for germiine genes with identical amino acid sequences.

Table 2: Rearranged human sequences used for the calculation of consensus sequences. (A) kappa sequences, (B) lambda sequences and (C), heavy chain sequences. The table summarized the name of the sequence (1), the length of the sequence in amino acids (2), the germline family (3) as well as the computed germline counterpart (4). The number of amino acid exchanges between the rearranged sequence and the germline sequence is tabulated in (5), and the percentage of different amino acids is given in (6). Column (7) gives the references number for the corresponding sequence (see appendix for sequence related citations).

Table 3: Assignment of rearranged V sequences to their germline counterparts. (A) kappa sequences, (B) lambda sequences and (C), heavy chain sequences. The germline genes are tabulated according to their family (1), and the number of rearranged genes found for every germline gene is given in (2).

Table 4: Computation of the consensus sequence of the rearranged V kappa sequences. (A) (SEQ ID NO: 14), V kappa subgroup 1, (B) (SEQ ID NO: 15), V kappa subgroup 2, (C) (SEQ ID NO: 16), V kappa subgroup 3 and (D) (SEQ ID NO: 17), V kappa subgroup 4. The number of each amino acid found at each position is tabulated together with the statistical analysis data. (1) Amino acids are given with their standard one-letter abbreviations (and B means D or N, Z means E or Q and X means any amino acid). The statistical analysis summarizes the number of sequences found at each position (2), the number of occurrences of the most common amino acid (3), the amino acid residue which is most common at this position (4), the relative frequency of the occurrence of the most common amino acid (5) and the number of different amino acids found at each position (6).

Table 5: Computation of the consensus sequence of the rearranged V lambda sequences. (A) (SEQ ID NO: 18), V lambda subgroup 1, (B) (SEQ ID NO: 19), V lambda subgroup 2, and (C) (SEQ ID NO: 20), V lambda subgroup 3. The number of each amino acid found at each position is tabulated together with the statistical analysis of the data. Abbreviations are the same as in Table 4.

Table 6: Computation of the consensus sequence of the rearranged V heavy chain sequences. (A) (SEQ ID NO: 21), V heavy chain subgroup 1A, (B) (SEQ ID NO: 22), V heavy chain subgroup 1B, (C) (SEQ ID NO: 23), V heavy chain subgroup 2, (D) (SEQ ID NO: 24), V heavy chain subgroup 3, (E) (SEQ ID NO: 25), V heavy chain subgroup 4, (F) (SEQ ID NO: 26), V heavy chain subgroup 5, and (G) (SEQ ID NO: 27), V heavy chain subgroup 6. The number of each amino acid found at each position is tabulated together with the statistical analysis of the data. Abbreviations are the same as in Table 4.

EXAMPLES

Example 1

Design of a Synthetic Human Combinatorial Antibody Library (HuCAL)

The following example describes the design of a fully synthetic human combinatorial antibody library (HuCAL), based on consensus sequences of the human immunoglobulin repertoire, and the synthesis of the consensus genes. The general procedure is outlined in FIG. 1 .

1.1 Sequence Database

1.1.1 Collection and Alignment of Human Immunoglobulin Sequences

In a first step, sequences of variable domains of human immunoglobulins have been collected and divided into three sub bases: V heavy chain (VH), V kappa (Vκ) and V lambda (Vλ). For each sequence, the gene sequence was then translated into the corresponding amino acid sequence. Subsequently, all amino acid sequences were aligned according to Kabat et al. (1991). In the case of Vλ sequences, the numbering system of Chuchana et al. (1990) was used. Each of the three main databases was then divided into two further sub bases: the first sub base contained all sequences derived from rearranged V genes, where more than 70 positions of the sequence were known. The second sub base contained all germline gene segments (without the D- and J-minigenes; pseudogenes with internal stop codons were also removed). In all cases, where germline sequences with identical amino acid sequence but different names were found, only one sequence was used (see Table 1). The final databases of rearranged sequences contained 386, 149 and 674 entries for Vκ, Vλ and VH, respectively. The final databases of germline sequences contained 48, 26 and 141 entries for Vκ, Vλ and VH, respectively.

1.1.2 Assignment of Sequences to Subgroups

The sequences in the three germline databases where then grouped according to sequence homology (see also Tomlinson et al., 1992, Williams & Winter, 1993, and Cox et al., 1994). In the case of Vκ, 7 families could be established. Vλ was divided into 8 families and VH into 6 families. The VH germline genes of the VH7 family (Van Dijk et al., 1993) were grouped into the VH1 family, since the genes of the two families are highly homologous. Each family contained different numbers of germline genes, varying from 1 (for example VH6) to 47 (VH3).

1.2 Analysis of Sequences

1.2.1 Computation of Germline Membership

For each of the 1209 amino acid sequences in the databases of rearranged genes, the nearest germline counterpart, i.e. the germline sequence with the smallest number of amino acid differences was then calculated. After the germline counterpart was found, the number of somatic mutations which occurred in the rearranged gene and which led to amino acid exchanges could be tabulated. In 140 cases, the germline counterpart could not be calculated exactly, because more than one germline gene was found with an identical number of amino acid exchanges. These rearranged sequences were removed from the database. In a few cases, the number of amino acid exchanges was found to be unusually large (>20 for VL and >25 for VH), indicating either heavily mutated rearranged genes or derivation from germline genes not present in the database. Since it was not possible to distinguish between these two possibilities, these sequences were also removed from the database. Finally, 12 rearranged sequences were removed from the database because they were found to have very unusual CDR lengths and composition or unusual amino acids at canonical positions (see below). In summary, 1023 rearranged sequences out of 1209 (85%) could be clearly assigned to their germline counterparts (see Table 2).

After this calculation, every rearranged gene could be arranged in one of the families established for the germline genes. Now the usage of each germline gene, i.e. the number of rearranged genes which originate from each germline gene, could be calculated (see Table 2). It was found that the usage was strongly biased towards a subset of germline genes, whereas most of the germline genes were not present as rearranged genes in the database and therefore apparently not used in the immune system (Table 3). This observation had already been reported in the case of Vκ (Cox, et al., 1994). All germline gene families, where no or only very few rearranged counterparts could be assigned, were removed from the database, leaving 4 Vκ, 3 Vλ, and 6 VH families.

1.2.2 Analysis of CDR Conformations

The conformation of the antigen binding loops of antibody molecules, the CDRs, is strongly dependent on both the length of the CDRs and the amino acid residues located at the so-called canonical positions (Chothia & Lesk, 1987). It has been found that only a few canonical structures exist, which determine the structural repertoire of the immunoglobulin variable domains (Cholhia et el., 1989). The canonical amino acid positions can be found in CDR as well as framework regions. The 13 used germline families defined above (7 VL and 6 VH) were now analyzed for their canonical structures in order to define the structural repertoire encoded in these families.

In 3 of the 4 Vκ families (Vκ1, 2 and 4), one different type of CDR1 conformation could be defined for every family. The family Vκ3 showed two types of CDR1 conformation: one type which was identical to Vκ1 and one type only found in Vκ3. All Vκ CDR2s used the same type of canonical structure. The CDR3 conformation is not encoded in the germline gene segments. Therefore, the 4 Vκ families defined by sequence homology and usage corresponded also to 4 types of canonical structures found in Vκ germline genes.

The 3 Vλ families defined above showed 3 types of CDR1 conformation, each family with one unique type. The Vλ1 family contained 2 different CDR1 lengths (13 and 14 amino acids), but identical canonical residues, and it is thought that both lengths adopt the same canonical conformation (Chothia & Lesk, 1987). In the CDR2 of the used Vλ germlines, only one canonical conformation exists, and the CDR3 conformation is not encoded in the germline gene segments. Therefore, the 3 Vλ families defined by sequence homology and usage corresponded also to 3 types of canonical structures.

The structural repertoire of the human VH sequences was analyzed in detail by Chothia et al., 1992. In total, 3 conformations of CDR1 (H1-1, H1-2 and H1-3) and 6 conformations of CDR2 (H2-1, H2-2, H2-3, H2-4, H2-5 and H2-x) could be Since the CDR3 is encoded in the D- and J-minigene segments, no particular canonical residues are defined for this CDR.

All the members of the VH1 family defined above contained the CDR1 conformation H1-1, but differed in their CDR2 conformation: the H2-2 conformation was found in 6 germline genes, whereas the conformation H2-3 was found in 8 germline genes. Since the two types of CDR2 conformations are defined by different types of amino acid at the framework position 72, the VH1 family was divided into two subfamilies: VH1A with CDR2 conformation H2-2 and VH1B with the conformation H2-3. The members of the VH2 family all had the conformations H1-3 and H2-1 in CDR1 and CDR2, respectively. The CDR1 conformation of the VH3 members was found in all cases to be H1-1, but 4 different types were found in CDR2 (H2-1, H2-3, H2-4 and H2-x). In these CDR2 conformations, the canonical framework residue 71 is always defined by an arginine. Therefore, it was not necessary to divide the VH3 family into subfamilies, since the 4 types of CDR2 conformations were defined solely by the CDR2 itself. The same was true for the VH4 family. Here, all 3 types of CDR1 conformations were found, but since the CDR1 conformation was defined by the CDR itself (the canonical framework residue 26 was found to be glycine in all cases), no subdivisions were necessary. The CDR2 conformation of the VH4 members was found to be H2-1 in all cases. All members of the VH5 family were found to have the conformation H1-1 and H2-2, respectively. The single germline gene of the VH6 family had the conformations H1-3 and H2-5 in CDR1 and CDR2, respectively.

In summary, all possible CDR conformations of the Vκ and Vλ genes were present in the 7 families defined by sequence comparison. From the 12 different CDR conformations found in the used VH germline genes, 7 could be covered by dividing the family VH1 into two subfamilies, thereby creating 7 VH families. The remaining 5 CDR conformations (3 in the VH3 and 2 in the VH4 family) were defined by the CDRs themselves and could be created during the construction of CDR libraries. Therefore, the structural repertoire of the used human V genes could be covered by 49 (7×7) different frameworks.

1.2.3 Computation of Consensus Sequences

The 14 databases of rearranged sequences (4 Vκ, 3 Vλ, and 7 VH) were used to compute the HuCAL consensus sequences of each subgroup (4 HuCAL-Vκ, 3 HuCAL-Vλ, 7 HuCAL-VH, see Table 4, 5 and 6). This was done by counting the number of amino acid residues used at each position (position variability) and subsequently identifying the amino acid residue most frequently used at each position. By using the rearranged sequences instead of the used germline sequences for the calculation of the consensus, the consensus was weighted according to the frequency of usage. Additionally, frequently mutated and highly conserved positions could be identified. The consensus sequences were cross-checked with the consensus of the germline families to see whether the rearranged sequences were biased at certain positions towards amino acid residues which do not occur in the collected germline sequences, but this was found not to be the case. Subsequently, the number of differences of each of the 14 consensus sequences to each of the germline sequences found in each specific family was calculated. The overall deviation from the most homologous germline sequence was found to be 2.4 amino acid residues (s.d.=2.7), ensuring that the “artificial” consensus sequences can still be considered as truly human sequences as far as immunogenicity is concerned.

1.3 Structural Analysis

So far, only sequence information was used to design the consensus sequences. Since it was possible that during the calculation certain artificial combinations of amino acid residues have been created, which are located far away in the sequence but have contacts to each other in the three dimensional structure, leading to destabilized or even misfolded frameworks, the 14 consensus sequences were analyzed according to their structural properties.

It was rationalized that all rearranged sequences present in the database correspond to functional and therefore correctly folded antibody molecules. Hence, the most homologous rearranged sequence was calculated for each consensus sequence. The positions where the consensus differed from the rearranged sequence were identified as potential “artificial residues” and inspected.

The inspection itself was done in two directions. First, the local sequence stretch around each potentially “artificial residue” was compared with the corresponding stretch of all the rearranged sequences. If this stretch was found to be truly artificial, i.e. never occurred in any of the rearranged sequences, the critical residue was converted into the second most common amino acid found at this position and analyzed again. Second, the potentially “artificial residues” were analyzed for their long range interactions. This was done by collecting all available structures of human antibody variable domains from the corresponding PDB files and calculating for every structure the number and type of interactions each amino acid residue established to each side-chain. These “interaction maps” were used to analyze the probable side-chain/side-chain interactions of the potentially “artificial residues”. As a result of this analysis, the following residues were exchanged (given is the name of the gene, the position according to Kabat's numbering scheme, the amino acid found at this position as the most abundant one and the amino acid which was used instead):

VH2: S 65 T

Vκ1: N 34 A,

Vκ3: G 9 A, D 60 A, R 77 S

Vλ3: V 78 T

1.4 Design of CDR Sequences

The process described above provided the complete consensus sequences derived solely from the databases of rearranged sequences. It was rationalized that the CDR1 and CDR2 regions should be taken from the databases of used germline sequences, since the CDRs of rearranged and mutated sequences are biased towards their particular antigens. Moreover, the germline CDR sequences are known to allow binding to a variety of antigens in the primary immune response, where only CDR3 is varied. Therefore, the consensus CDRs obtained from the calculations described above were replaced by germline CDRs in the case of VH and Vκ. In the case of Vλ, a few amino acid exchanges were introduced in some of the chosen germline CDRs in order to avoid possible protease cleavage sites as well as possible structural constraints.

The CDRs of following germline genes have been chosen:

HuCAL gene	CDR1	CDR2
HuCAL-VH1A	VH1-12-1	VH1-12-1
HuCAL-VH1B	VH1-13-16	VH1-13-6,-7,-8,-9
HuCAL-VH2	VH2-31-10,-11,-12,-13	VH2-31-3,-4
HuCAL-VH3	VH3-13-8,-9,-10	VH3-13-8,-9,-10
HuCAL-VH4	VH4-11-7 to -14	VH4-11-8,-9,-11,-12,-14,-16
		VH4-31-17,-18,-19,-20
HuCAL-VH5	VH5-12-1,-2	VH5-12-1,-2
HuCAL-VH6	VH6-35-1	VH6-35-1
HUCAL-Vκ1	Vκ1-14,-15	Vκ1-2,-3,-4,-5,-7,-8,-12,-13,
		-18,-19
HUCAL-Vκ2	Vκ2-6	Vκ2-6
HUCAL-Vκ3	Vκ3-1,-4	Vκ3-4
HUCAL-Vκ4	Vκ4-1	Vκ4-1
HuCAL-Vλ1	HUMLV117,DPL5	DPL5
HuCAL-Vλ2	DPL11,DPL12	DPL12
HuCAL-Vλ3	DPL23	HUMLV318

In the case of the CDR3s, any sequence could be chosen since these CDRs were planned to be the first to be replaced by oligonucleotide libraries. In order to study the expression and folding behavior of the consensus sequences in E. coli , it would be useful to have all sequences with the same CDR3, since the influence of the CDR3s on the folding behavior would then be identical in all cases. The dummy sequences QQHYTTPP (see, for instance, positions 89-96 of SEQ ID NO: 28 and positions 88-95 of SEQ ID NO: 34) and ARWGGDGFYAMDY (positions 97-109 of SEQ ID NOS 35 & 36) were selected for the VL chains (kappa and lambda) and for the VH chains, respectively. These sequences are known to be compatible with antibody folding in E. coli (Carter et al., 1992).

1.5 Gene Design

The final outcome of the process described above was a collection of 14 HuCAL amino acid sequences, which represent the frequently used structural antibody repertoire ot the human immune system (see FIG. 2 ). These sequences were back-translated into DNA sequences. In a first step, the back-translation was done using only codons which are known to be frequently used in E. coil . These gene sequences were then used for creating a database of all possible restriction endonuclease sites, which could be introduced without changing the corresponding amino acid sequences. Using this database, cleavage sites were selected which were located at the flanking regions of all sub-elements of the genes (CDRs and framework regions) and which could be introduced in all HuCAL VH, Vκ or Vλ, genes simultaneously at the same position. In a few cases it was not possible to find cleavage sites for all genes of a subgroup. When this happened, the amino acid sequence was changed, if this was possible according to the available sequence and structural information. This exchange was then analyzed again as described above. In total, the following 6 amino acid residues were exchanged during this design (given is the name of the gene, the position according to Kabat's numbering scheme, the amino acid found at this position as the most abundant one and the amino acid which was used instead):

VH2: T 3 Q

VH6: S 42 G

Vκ3: E 1 D, I 58 V

Vκ4: K 24 R

Vλ3: T 22 S

In one case (5′-end of VH framework 3) it was not possible to identify a single cleavage site for all 7 VH genes. Two different type of cleavage sites were used instead: BstEII for HuCAL VH1A, VH1B, VH4 and VH5, and NspV for HUCAL VH2, VH3, VH4 and VH6.

Several restriction endonuclease sites were identified, which were not located at the flanking regions of the sub-elements but which could be introduced in every gene of a given group without changing the amino acid sequence. These cleavage sites were also introduced in order to make the system more flexible for further improvements. Finally, all but one remaining restriction endonuclease sites were removed in every gene sequence. The single cleavage site, which was not removed was different in all genes of a subgroup and could be therefore used as a “fingerprint” site to ease the identification of the different genes by restriction digest. The designed genes, together with the corresponding amino acid sequences and the group-specific restriction endonuclease sites are shown in FIGS. 3 , 4 and 5 , respectively.

1.6 Gene Synthesis and Cloning

The consensus genes were synthesized using the method described by Prodromou & Pearl, 1992, using the oligonucleotides shown in FIG. 6 . Gene segments encoding the human constant domains Cκ, Cλ and CH1 were also synthesized, based on sequence information given by Kabat et al., 1991 (see FIG. 6 and FIG. 7 ). Since for both the CDR3 and the framework. 4 gene segments identical sequences were chosen in all HuCAL Vκ, Vλ and VH genes, respectively, this part was constructed only once, together with the corresponding gene segments encoding the constant domains. The PCR products were cloned into pCR-Script KS(+) (Stratagene, Inc.) or pZErO-1 (Invitrogen, Inc.) and verified by sequencing.

Example 2

Cloning and Testing of a HuCAL-Based Antibody Library

A combination of two of the synthetic consensus genes was chosen after construction to test whether binding antibody fragments can be isolated from a library based on these two consensus frameworks. The two genes were cloned as a single-chain Fv (scFv) fragment, and a VH-CDR3 library was inserted. In order to test the library for the presence of functional antibody molecules, a selection procedure was carried out using the small hapten fluorescen bound to BSA (FITC-BSA) as antigen.

2.1 Cloning of the HuCAL VH3-Vk2 scFv Fragment

In order to test the design of the consensus genes, one randomly chosen combination of synthetic light and heavy gene (HuCAL-Vκ2 and HuCAL-VH3) was used for the construction of a single-chain antibody (scFv) fragment. Briefly, the gene segments encoding the VH3 consensus gene and the CH1 gene segment including the CDR3-framework 4 region, as well as the Vκ2 consensus gene and the Cκ gene segment including the CDR3-framework 4 region were assembled yielding the gene for the VH3-CH1 Fd fragment and the gene encoding the Vκ2-Cκ light chain, respectively. The CH1 gene segment was then replaced by an oligonucleotide (SEQ ID NOS 2 & 3, respectively) cassette encoding a 20-mer peptide linker (SEQ ID NO: 1) with the sequence AGGGSGGGGSGGGGSGGGGS. The two oligonucleotides encoding this linker were 5′-TCAGCGGGTGGCGGTTCTGGCGGCGGTGGGAGCGGTGGCGGTGGTTCTGGCGGTGGTGGTTCCGATATCGGTCCACGTACGG-3′ and 5′-AATTCCGTACGTGGACCGATATCGGAACCACCACCGCCAGAACCACCGCCACCGCTCCCACCGCCGCCAGAACCGCCACCCGC-3′, respectively. Finally, the HuCAL-Vκ2 gene was inserted via EcoRV and BsiWI into the plasmid encoding the HuCAL-VH3-linker fusion, leading to the final gene HuCAL-VH3-Vκ2, which encoded the two consensus sequences in the single-chain format VH-linker-VL. The complete coding sequence is shown in FIG. 8 .

2.2 Construction of a Monovalent Phage-display Phagemid Vector pIG 10.3

Phagemid pIG10.3 ( FIG. 9 ) was constructed in order to create a phage-display system (Winter et al., 1994) for the H3κ2 scFv gene. Briefly, the EcoRI/HindIII restriction fragment in the phagemid vector pIG10 (Ge et al., 1995) was replaced by the c-myc followed by an amber codon (which encodes an glutamate in the amber-suppresser strain XL1 Blue and a stop codon in the non-suppresser strain JM83) and a truncated version of the gene III (fusion junction at codon 249, see Lowman et al., 1991) through PCR mutagenesis.

2.3 Construction of H-CDR3 Libraries

Heavy chain CDR3 libraries of two lengths (10 and 15 amino acids) were constructed using trinucleotide codon containing oligonucleotides (Virnekäs et al., 1994) as templates and the oligonucleotides complementing the flanking regions as primers. To concentrate only on the CDR3 structures that appear most often in functional antibodies, we kept the salt-bridge of R H94 , and D H101 in the CDR3 loop. For the 15-mer library, both phenylalanine and methionine were introduced at position 100 since these two residues were found to occur quite often in human CDR3s of this length (not shown). For the same reason, valine and tyrosine were introduced at position 102. All other randomized positions contained codons for all amino acids except cystein, which was not used in the trinucleotide mixture.

The CDR3 libraries of lengths 10 and 15 were generated from the PCR fragments using oligonucleotide templates (SEQ ID NOS 4 & 5, respectively) O3HCDR103T (5′-GATACGGCCGTGTATTATTGCGCGCGT (TRI) 6 GATTATTGGGGCCAAGGCACCCTG-3′) and O3HCDR153T (5′GATACGGCCGTGTATTATTGCGCGCGT(TRI) 10 (TTT/ATG)GAT(GTT/TAT)TGGGGCCMGGCACCCTG-3′), and primers (SEQ ID NOS 6 & 7, respectively) O3HCDR35 (5′-GATACGGCCGTGTATTATTGC-3′) and O3HCDR33 (5′-CAGGGTGCCTTGGCCCC-3′), where TRI are trinucleotide mixtures representing all amino acids without cystein, (TTT/ATG) and (GTT/TAT) are trinucleotide mixtures encoding the amino acids phenylalanine/methionine and valine/tyrosine, respectively. The potential diversity of these libraries was 4.7×10 7 and 3.4×10 10 for 10-mer and 15-mer library, respectively. The library cassettes were first synthesized from PCR amplification of the oligo templates in the presence of both primers: 25 pmol of the oligo template O3HCDR103T or O3HCDR153T, 50 pmol each of the primers O3HCDR35 and O3HCDR33, 20 nmol of dNTP, 10× buffer and 2.5 units of Pfu DNA polymerase (Stratagene) in a total volume of 100 ml for 30 cycles (1 minute at 92° C., 1 minute at 62° C. and 1 minute at 72° C.). A hot-start procedure was used. The resulting mixtures were phenol-extracted, ethanol-precipitated and digested overnight with Eagl and StyI. The vector pIG10.3-scH3 2cat, where the Eagl-StyI fragment in the vector pIG10.3-scH3κ2 encoding the H-CDR3 was replaced by the chloramphenicol acetyltransferase gene (cat) flanked with these two sites, was similarly digested. The digested vector (35 μg) was gel-purified and ligated with 100 μg of the library cassette overnight at 16° C. The ligation mixtures were isopropanol precipitated, air-dried and the pellets were redissolved in 100 ml of ddH2O. The ligation was mixed with 1 ml of freshly prepared electrocompetent XL1 Blue on ice. 20 rounds of electroporation were performed and the transformants were diluted in SOC medium, shaken at 37° C. for 30 minutes and plated out on large LB plates (Amp/Tet/Glucose).

Expression levels of individual library members were also measured. Briefly, 9 clones from each library were grown in 2×YT medium containing Amp/Tet/0.5% glucose at 37° C. overnight. Next day, the cultures were diluted into fresh medium with Amp/Tet. At an OD 600 nm of 0.4, the cultures,were induced with 1 mM of IPTG and shaken at RT overnight. Then the cell pellets were suspended in 1 ml of PBS buffer+1 mM of EDTA. The suspensions were sonicated and the supernatants were separated on an SDS-PAGE under reducing conditions, blotted on nylon membrane and detected with anti-FLAG M1 antibody (see FIG. 11 ). From the nine clones of the 10-mer library, all express the scFv fragments. Moreover, the gene III/scFv fusion proteins were present in all cases. Among the nine clones from the 15-mer library analyzed, 6/9 (67%) led to the expression of both scFv and the gene III/scFv fusion proteins. More importantly, all clones expressing the scFvs and gene III/scFv fusions gave rise to about the same level of expression.

2.4 Biopanning

Phages displaying the antibody libraries were prepared using standard protocols. Phages derived from the 10-mer library were mixed with phages from the 15-mer library in a ratio of 20:1 (1×10 10 cfu/well of the 10-mer and 5×10 8 cfu/well of the 15-mer phages respectively). Subsequently, the phage solution was used for panning in ELISA plates (Maxisorp, Nunc) coated with FITC-BSA (Sigma) at concentration of 100 μg/ml in PBS at 4° C. overnight. The antigen-coated wells were blocked with 3% powder milk in PBS and the phage solutions in 1% powder milk were added to each well and the plate was shaken at RT for 1 hr. The wells were then washed with PBST and PBS (4 times each with shaking at RT for 5 minutes). The bound phages were eluted with 0.1 M triethylamine (TEA) at RT for 10 minutes. The eluted phage solutions were immediately neutralized with ½ the volume of 1 M TrisCl, pH 7.6. Eluted phage solutions (ca. 450 μl) were used to infect 5 ml of XL1 Blue cells at 37° C. for 30 min. The infected cultures were then plated out on large LB plates (Amp/Tet/Glucose) and allowed to grow at 37° C. until the colonies were visible. The colonies were suspended in 2×YT medium and the glycerol cultures were made as above described. This panning round was repeated twice, and in the third round elution was carried out with addition of fluorescein in a concentration of 100 μg/ml in PBS. The enrichment of specific phage antibodies was monitored by panning the initial as well as the subsequent fluorescein-specific sub-libraries against the blocking buffer (FIG. 12 ). Antibodies with specificity against fluorescein were isolated after 3 rounds of panning.

2.5 ELISA Measurements

One of the criteria for the successful biopanning is the isolation of individual phage clones that bind to the targeted antigen or hapten. We undertook the isolation of anti-FITC phage antibody clones and characterized them first in a phage ELISA formal. After the 3rd round of biopanning (see above), 24 phagemid containing clones were used to inoculate 100 μl of 2×YT medium (Amp/Tet/Glucose) in an ELISA plate (Nunc), which was subsequently shaken at 37° C. for 5 hrs. 100 μl of 2×YT medium (Amp/Tet/1 mM IPTG) were added and shaking was continued for 30 minutes. A further 100 μl of 2×YT medium (Amp/Tet) containing the helper phage ( 1×10 9 cfu/well) was added and shaking was done at RT for 3 hrs. After addition of kanamycin to select for successful helper phage infection, the shaking was continued overnight. The plates were then centrifuged and the supernatants were pipetted directly into ELISA wells coated with 100 μl FITC-BSA (100 μg/ml) and blocked with milk powder. Washing was performed similarly as during the panning procedure and the bound phages were detected with anti-M13 antibody-POD conjugate (Pharmacia) using soluble POD substrate (Boehringer-Mannheim). Of the 24 clones screened against FITC-BSA, 22 were active in the ELISA (FIG. 13 ). The initial libraries of similar titer gave rise to no detectable signal. Specificity for fluorescein was measured in a competitive ELISA. Periplasmic fractions of five FITC specific scFvs were prepared as described above Western blotting indicated that all clones expressed about the same amount of scFv fragment (data not shown). ELISA was performed as described above, but additionally, the periplasmic fractions were incubated 30 min at RT either with buffer (no inhibition), with 10 mg/ml BSA (inhibition with BSA) or with 10 mg/ml fluorescein (inhibition with fluorescein) before adding to the well. Binding scFv fragment was detected using the anti-FLAG antibody M1. The ELISA signal could only be inhibited, when soluble fluorescein was added, indicating binding of the scFvs was specific for fluorescein (FIG. 14 ).

2.6 Sequence Analysis

The heavy chain CDR3 region of 20 clones were sequenced in order to estimate the sequence diversity of fluorescein binding antibodies in the library (FIG. 15 ). In total, 16 of 20 sequences (80%) were different, showing that the constructed library contained a highly diverse repertoire of fluorescein binders. The CDR3s showed no particular sequence homology, but contained on average 4 arginine residues. This bias towards arginine in fluorescein binding antibodies had already been described by Barbas et al., 1992.

2.7 Production

E. coli JM83 was transformed with phagemid DNA of 3 selected clones and cultured in 0.5 L 2×YT medium. Induction was carried out with 1 mM IPTG at OD 600 nm =0.4 and growth was continued with vigorous shaking at RT overnight. The cells were harvested and pellets were suspended in PBS buffer and sonicated. The supernatants were separated from the cell debris via centrifugation and purified via the BioLogic system (Bio-Rad) by with a POROS®MC 20 column (IMAC, PerSeptive Biosystems, Inc.) coupled with an ion-exchange chromatography column. The ion-exchange column was one of the POROS®HS, CM or HQ or PI 20 (PerSeptive Biosystems, Inc.) depended on the theoretical pI of the scFv being purified. The pH of all the buffers was adjusted to one unit lower or higher than the pI of the scFv being purified throughout. The sample was loaded onto the first IMAC column, washed with 7 column volumes of 20 mM sodium phosphate, 1 M NaCl and 10 mM imidazole. This washing was followed by 7 column volumes of 20 mM sodium phosphate and 10 mM imidazole. Then 3 column volumes of an imidazole gradient (10 to 250 mM) were applied and the eluent was connected directly to the ion-exchanger. Nine column volumes of socratic washing with 250 mM imidazole was followed by 15 column volumes of 250 mM to 100 mM and 7 column volumes of an imidazole/NaCl gradient (100 to 10 mM imidazole, 0 to 1 M NaCl). The flow rate was 5 ml/min. The purity of scFv fragments was checked by SDS-PAGE Coomassie staining (FIG. 16 ). The concentration of the fragments was determined from the absorbance at 280 nm using the theoretically determined extinction coefficient (Gill & von Hippel, 1989). The scFv fragments could be purified to homogeneity (see FIG. 16 ). The yield of purified fragments ranged from 5 to 10 mg/L/OD.

Example 3

HuCAL H3κ2 Library Against a Collection of Antigens

In order to test the library used in Example 2 further, a new selection procedure was carried out using a variety of antigens comprising β-estradiol, testosterone, Lewis-Y epitope (LeY), interleukin-2 (IL-2), lymphotoxin-β (LT-β), E-selectin ligand-1 (ESL-1). and BSA.

3.1 Biopanning

The library and all procedures were identical to those described in Example 2. The ELISA plates were coaled with β-estradiol-BSA (100 μg/ml), testosterone-BSA (100 μg/ml), LeY-BSA (20 μg/ml) IL-2 (20 μg/ml), ESL-1 (20 μg/ml) and BSA (100 μg/ml), LT-β (denatured protein, 20 μg/ml). In the first two rounds, bound phages were eluted with 0.1 M triethylamine (TEA) at RT for 10 minutes. In the case of BSA, elution after three rounds of panning was carried out with addition of BSA in a concentration of 100 μg/ml in PBS. In the case of the other antigens, third round elution was done with 0.1 M triethylamine. In all cases except LeY, enrichment of binding phages could be seen (FIG. 17 ). Moreover, a repetition of the biopanning experiment using only the 15-mer library resulted in the enrichment of LeY-binding phages as well (data not shown).

3.2. ELISA Measurements

Clones binding to β-estradiol, testosterone, LeY, LT-β, ESL-1 and BSA were further analyzed and characterized as described in Example 2 for FITC. ELISA data for anti-β-estradiol and anti-ESL-1 antibodies are shown in FIG. 18 . In one experiment. selectivity and cross-reactivity of binding scFv fragments were tested. For this purpose, an ELISA plate was coated with FITC, testosterone, β-estradiol, BSA, and ESL-1, with 5 wells for each antigen arranged in 5 rows, and 5 antibodies, one against each of the antigens, were screened against each of the antigens. FIG. 19 shows the specific binding of the antibodies to the antigen it was selected for, and the low cross-reactivity with the other four antigens.

3.3 Sequence Analysis

The sequencing data of several clones against β-estradiol (34 clones), testosterone (12 clones), LT-β (23 clones), ESL-1 (34 clones), and BSA (10 clones) are given in FIGS. 20 to 24 .

Example 4

Vector Construction

To be able to take advantage of the modularity of the consensus gene repertoire, a vector system had to be constructed which could be used in phage display screening of HuCAL libraries and subsequent optimization procedures. Therefore, all necessary vector elements such as origins of single-stranded or double-stranded replication, promotor/operator, repressor or terminator elements, resistance genes, potential recombination sites, gene III for display on filamentous phages, signal sequences, or detection tags had to be made compatible with the restriction site pattern of the modular consensus genes. FIG. 25 shows a schematic representation of the pCAL vector system and the arrangement of vector modules and restriction sites therein. FIG. 25 a shows a list of all restriction sites which are already incorporated into the consensus genes or the vector elements as part of the modular system or which are not yet present in the whole system. The latter could be used in a later stage for the introduction of or within new modules.

4.1 Vector Modules

A series of vector modules was constructed where the restriction sites flanking the gene sub-elements of the HuCAL genes were removed, the vector modules themselves being flanked by unique restriction sites. These modules were constructed either by gene synthesis or by mutagenesis of templates. Mutagenesis was done by add-on PCR, by site-directed mutagenesis (Kunkel et al., 1991) or multisite oligonucleotide-mediated mutagenesis (Sutherland et al., 1995; Perlak, 1990) using a PCR-based assembly method.

FIG. 26 contains a list of the modules constructed. Instead of the terminator module M9 (HindIII-IppPacI), a larger cassette M9II was prepared to introduce Fsel as additional restriction site. M9II can be cloned via HindIII/BsrGI. All vector modules were characterized by restriction analysis and sequencing. In the case of module M11-II, sequencing of the module revealed a two-base difference in positions 164/65 compared to the sequence database of the template. These two different bases (CA→GC) created an additional BanII site. Since the same two-base difference occurs in the it origin of other bacteriophages, it can be assumed that the two-base difference was present in the template and not created by mutagenesis during cloning. This Banli site was removed by site-directed mutagenesis, leading to module M11-III. The BssSI site of module M14 could initially not be removed without impact on the function of the ColE1 origin, therefore M14-Ext2 was used for cloning of the first pCAL vector series. FIGS. 29 to 34 are showing the functional maps and sequences of the modules used for assembly of the modular vector pCAL4 (see below). The functional maps and sequences of additional modules can be found in FIG. 35 a . FIG. 35 b contains a list of oligonucleotides and primers used for the synthesis of the modules.

4.2 Cloning Vector pMCS

To be able to assemble the individual vector modules, a cloning vector pMCS containing a specific multi-cloning site (MCS) was constructed. First, an MCS cassette ( FIG. 27 ) was made by gene synthesis. This cassette contains all those restriction sites in the order necessary for the sequential introduction of all vector modules and can be cloned via the 5′-HindIII site and a four base overhang at the 3′-end compatible with an AatII site. The vector pMCS ( FIG. 28 ) was constructed by digesting pUC19 with AatII and HindIII, isolating the 2174 base pair fragment containing the bla gene and the ColE1 origin, and ligating the MCS cassette.

4.3 Cloning of Modular Vector pCAL4

This was cloned step by step by restriction digest of pMCS and subsequent ligation of the modules M1 (via AatII/XbaI), M7III (via EcoRI/HindIII), and M9II (via HindIII/BsrGI), and M11-II (via BsrGI/Nhe). Finally, the bla gene was replaced by the cat gene module M17 (via AatlI/BglII), and the wild type ColE1 origin by module M14-Ext2 (via BglII/Nhel). FIG. 35 is showing the functional map and the sequence of pCAL4.

4.4 Cloning of Low-copy Number Plasmid Vectors pCALO

A series of low-copy number plasmid vectors was constructed in a similar way using the p15A module M12 instead of the ColE1 module M14-Ext2. FIG. 35 a is showing the functional maps and sequences of the vectors pCALO1 to pCAL03.

Example 5

Construction of a HuCAL scFv Library

5.1. Cloning of All 49 HuCAL scFv Fragments

All 49 combinations of the 7 HuCAL-VH and 7 HuCAL-VL consensus genes were assembled as described for the HuCAL VH3-Vκ2 scFv in Example 2 and inserted into the vector pBS12, a modified version of the pLisc series of antibody expression vectors (Skerra et al., 1991).

5.2 Construction of a CDR Cloning Cassette

For replacement of CDRs, a universal β-lactamase cloning cassette was constructed having a multi-cloning site at the 5′-end as well as at the 3′-end. The 5′-multi-cloning site comprises all restriction sites adjacent to the 5′-end of the HuCAL VH and VL CDRs, the 3′-multi-cloning site comprises all restriction sites adjacent to the 3′ end of the HuCAL VH and VL CDRs. Both 5′- and 3′-multi-cloning site were prepared as cassettes via add-on PCR using synthetic oligonucleotides as 5′-and 3′-primers using wild type β-lactamase gene as template. FIG. 36 shows the functional map and the sequence of the cassette bla-MCS.

5.3. Preparation of VL-CDR3 Library Cassettes

The VL-CDR3 libraries comprising 7 random positions were generated from the PCR fragments using oligonucleotide templates Vκ1& Vκ3, Vκ2 and Vκ4 and primers O_K3L — 5 and O_K3L3 ( FIG. 37 ) for the Vκ genes, and Vλ and primers O_L3L — 5 (5′-GCAGAAGGCGAACGTCC-3′) and O_L3LA — 3 ( FIG. 38 ) for the Vλ genes. Construction of the cassettes was performed as described in Example 2.3.

5.4 Cloning of HuCAL scFv Genes with VL-CDR3 Libraries

Each of the 49 single-chains was subcloned into pCAL4 via XbaI/EcoRI and the VL-CDR3 replaced by the β-lactamase cloning cassette via BbsI/MscI, which was then replaced by the corresponding VL-CDR3 library cassette synthesized as described above. This CDR replacement is described in detail in Example 2.3 where the cat gene was used.

5.5 Preparation of VH-CDR3 Library Cassette

The VH-CDR3 libraries were designed and synthesized as described in Example 2.3.

5.6 Cloning of HuCAL scFv Genes with VL-and VH-CDR3 Libraries

Each of the 49 single-chain VL-CDR3 libraries was digested with BssHII/StyI to replace VH-CDR3. The “dummy” cassette digested with BssHII/StyI was inserted, and was then replaced by a corresponding VH-CDR3 library cassette synthesized as described above.

Example 6

Expression Tests

Expression and toxicity studies were performed using the scFv format VH-linker-VL. All 49 combinations of the 7 HuCAL-VH and 7 HuCAL-VL consensus genes assembled as described in Example 5 were inserted into the vector pBS13, a modified version of the pLisc series of antibody expression vectors (Skerra et al., 1991). A map of this vector is shown in FIG. 39 .

E. Coli JM83 was transformed 49 times with each of the vectors and stored as glycerol stock. Between 4 and 6 clones were tested simultaneously, always including the clone H3κ2, which was used as internal control throughout. As additional control, the McPC603 scFv fragment (Knappik & Plückthun, 1995) in pBS13 was expressed under identical conditions. Two days before the expression test was performed, the clones were cultivated on LB plates containing 30 μg/ml chloramphenicol and 60 mM glucose. Using this plates an 3 ml culture (LB medium containing 90 μg chloramphenicol and 60 mM glucose) was inoculated overnight at 37° C. Next day the overnight culture was used to inoculate 30 ml LB medium containing chloramphenicol (30 μg/ml). The starting OD 600 nm was adjusted to 0.2 and a growth temperature of 30° C. was used. The physiology of the cells was monitored by measuring every 30 minutes for 8 to 9 hours the optical density at 600 nm . After the culture reached an OD 600 nm of 0.5, antibody expression was induced by adding IPTG to a final concentration of 1 mM. A 5 ml aliquot of the culture was removed after 2 h of induction in order to analyze the antibody expression. The cells were lysed and the soluble and insoluble fractions of the crude extract were separated as described in Knappik & Plückthun, 1995. The fractions were assayed by reducing SDS-PAGE with the samples normalized to identical optical densities. After blotting and immunostaining using the α-FLAG antibody M1 as the first antibody (see Ge et al., 1994) and an Fc-specific anti-mouse antiserum conjugated to alkaline phosphatase as the second antibody, the lanes were scanned and the intensities of the bands of the expected size (appr. 30 kDa) were quantified densitometrically and tabulated relative to the control antibody (see FIG. 40 ).

Example 7

Optimization of Fluorescein Binders

7.1. Construction of L-CDR3 and H-CDR2 Library Cassettes

A L-CDR3 library cassette was prepared from the oligonucleotide (SEQ ID NO: 9) template CDR3L (5′-TGGMGCTGMGACGTGGGCGTGTATTATTGCCAGCAG(TR5)(TRI) 4 CCG(TRI)TTTGGCCAGGGTACGAAAGTT-3′) and primer (SEQ ID NO: 10) 5′-AATTTCGTACCCTGGCC-3′ for synthesis of the complementary strand, where (TRI) was a trinucleotide mixture representing all amino acids except Cys, (TR5) comprised a trinucleotide mixture representing the 5 codons for Ala, Arg, His, Ser, and Tyr.

A H-CDR2 library cassette was prepared from the oligonucleotide template CDRsH (SEQ ID NOS 11 & 12, respectively) (5′-AGGGTCTCGAGTGGGTGAGC(TRI)ATT(TRI) 2-3 (6) 2 (TRI)ACC(TRI)TATGCGGATAGCGTGAAAGGCCGTTTTACCATTTCACGTGATAATTCGAAAAACACCA-3′), and primer (SEQ ID NO: 13) 5′-TGGTGTTTTTCGMTTATCA-3′ for synthesis of the complementary strand, where (TRI) was a trinucleotide mixture representing all amino acids except Cys, (6) comprised the incorporation of (ANG) (A/C/G) T, resulting in the formation of 6 codons for Ala, Asn, Asp, Gly, Ser, and Thr, and the length distribution being obtained by performing one substoichiometric coupling of the (TRI) mixture during synthesis, omitting the capping step normally used in DNA synthesis. DNA synthesis was performed on a 40 nmole scale, oligos were dissolved in TE buffer, purified via gel filtration using spin columns (S-200), and the DNA concentration determined by OD measurement at 260 nm (OD 1.0=40 μg/ml). 10 nmole of the oligonucleotide templates and 12 nmole of the corresponding primers were mixed and annealed at 80° C. for 1 min, and slowly cooled down to 37° C. within 20 to 30 min. The fill-in reaction was performed for 2 h at 37° C. using Klenow polymerase (2.0 μl) and 250 nmole of each dNTP. The excess of dNTPs was removed by gel filtration using Nick-Spin columns (Pharmacia), and the double-stranded DNA digested with BbsI/MscI (L-CDR3), or Xhol/Sful (H-CDR2) over night at 37° C. The cassettes were purified via Nick-Spin columns (Pharmacia), the concentration determined by OD measurement, and the cassettes aliquoted (15 pmole) for being stored at −80° C.

7.2 Library Cloning

DNA was prepared from the collection of FITC binding clones obtained in Example 2 (approx. 10 4 to clones). The collection of scFv fragments was isolated via XbaI/EcoRI digest. The vector pCAL4 (100 fmole, 10 μg) described in Example 4.3 was similarly digested with XbaI/EcoRI, gel-purified and ligated with 300 fmole of the scFv fragment collection over night at 16° C. The ligation mixture was isopropanol precipitated, air-dried, and the pellets were redissolved in 100 μl of dd H 2 O. The ligation mixture was mixed with 1 ml of freshly prepared electrocompetent SCS 101 cells (for optimization of L-CDR3), or XL1 Blue cells (for optimization of H-CDR2) on ice. One round of electroporation was performed and the transformants were eluted in SOC medium, shaken at 37° C. for 30 minutes, and an aliquot plated out on LB plates (Amp/Tet/Glucose) at 37° C. for 6-9 hrs. The number of transformants was 5×10 4 .

Vector DNA (100 μg) was isolated and digested (sequence and restriction map of scH3κ2 see FIG. 8 ) with. BbsI/MscI for optimization of L-CDR3, or XhoI/NspV for optimization of H-CDR2. 10 μg of purified vector fragments (5 pmole) were ligated with 15 pmole of the L-CDR3 or H-CDR2 library cassettes over night at 16° C. The ligation mixtures were isopropanol precipitated, air-dried, and the pellets were redissolved in 100 μl of dd H 2 O. The ligation mixtures were mixed with 1 ml of freshly prepared electrocompetent XL1 Blue cells on ice. Electroporation was performed and the transformants were eluted in SOC medium and shaken at 37° C. for 30 minutes. An aliquot was plated out on LB plates (Amp/Tet/Glucose) at 37° C. for 6-9 hrs. The number of transformants (library size) was greater than 10 8 for both libraries. The libraries were stored as glycerol cultures.

7.3. Biopanning

This was performed as described for the initial H3κ2 H-CDR3 library in Example 2.1. Optimized scFvs binding to FITC could be characterized and analyzed as described in Example 2.2 and 2.3, and further rounds of optimization could be made if necessary.

REFERENCES

Barbas III, C. F., Bain, J. D., Hoekstra, D. M. & Lerner, R. A., PNAS 89, 4457-4461 (1992).

Better, M., Chang, P., Robinson, R. & Horwitz, A. H., Science 240, 1041-1043 (1988).

Blake, M. S., Johnston, K. H., Russel-Jones, G. J. & Gotschlich, E. C., Ana). Biochem. 136, 175-179 (1984).

Carter, P., Kelly, R. F., Rodrigues, M. L., Snedecor, B., Covrrubias, M., Velligan, M. D., Wong, W. L. T., Rowland, A. M., Kotts, C. E., Carver, M. E., Yang, M., Bourell, J. H., Shepard, H. M. & Henner, D., Bio/Technology 10, 163-167 (1992).

Chothia, C. & Lesk, A. M., J. Biol. Chem. 196, 910-917 (1987).

Chothia, C., Lesk, A. M., Gherardi, E., Tomlinson, I. A., Walter, G., Marks, J. D., Llewelyn, M. B. & Winter, G., J. Mol. Biol. 227, 799-817 (1992).

Chothia, C., Lesk, A. M., Tramontano, A., Levitt, M., Smith-Gill, S. J., Air, G., Sheriff, S., Padlan, E. A., Davies, D., Tulip, W. R., Colman, P. M., Spinelli, S., Alzari, P. M. & Poijak, R. J., Nature 342, 877-883 (1989).

Chuchana, P., Blancher, A., Brockly, F., Alexandre, D., Lefranc, G & Lefranc, M.-P., Eur. J. Immunol. 20, 1317-1325 (1990).

Cox, J. P. L., Tomlinson, I. M. & Winter, G., Eur. J. Immunol. 24, 827-836 (1994).

Ge, L., Knappik, A., Pack, P., Freund, C. & Plückthun, A., In: Antibody Engineering.

Borrebaeck, C. A. K. (Ed.). p. 229-266 (1995), Oxford University Press, New York, Oxford.)

Gill, S. C. & von Hippel, P. H., Anal. Biochem. 182, 319. 326 (1989).

Hochuli, E., Bannwarth, W., Döbeli, H., Gentz, R. & Slüber, D., Bio/Technology 6, 1321-1325 (1988).

Hopp, T. P., Pricketl, K. S., Price, V. L., Libby, R. T., March, C. J., Cerretti, D. P., Urdal, D. L. & Conlon, P. J. Bio/Technology 6, 1204-1210 (1988).

Kabat, E. A., Wu, T. T., Perry, H. M., Gottesmann, K. S. & Foeller, C., Sequences of proteins of immunological interest, NIH publication 91-3242 (1991).

Knappik, A. & Plückthun, A., Biotechniques 17, 754-761 (1994).

Knappik, A. & Plückthun, A., Protein Engineering 8, 81-89 (1995).

Kunkel, T. A., Bebenek, K. & McClary, J., Methods in Enzymol. 204, 125-39 (1991).

Lindner, P., Guth, B., Wülfing, C., Krebber, C., Steipe, B., Müller, F. & Plückthun, A., Methods: A Companion to Methods Enzymol. 4, 41-56 (1992).

Lowman, H. B., Bass, S. H., Simpson, N. and Wells, J. A., Biochemistry 30, 10832-10838 (1991).

Pack, P. & Plückthun, A., Biochemistry 31, 1579-1584 (1992).

Pack, P., Kujau, M., Schroeckh, V., Knüpfer, U., Wenderoth, R., Riesenberg D. & Plückthun, A., Bio/Technology 11, 1271-1277 (1993).

Pack, P., Ph. D. thesis, Ludwig-Maximilians-Universität München (1994).

Perlak, F. J., Nuc. Acids Res. 18, 7457-7458 (1990).

Plückthun, A., Krebber, A., Krebber, C., Horn, U., Knüpfer, U., Wenderoth, R., Nieba, L., Proba, K. & Riesenberg, D., A practical approach. Antibody Engineering (Ed. J. McCafferty). IRL Press, Oxford, pp. 203-252 (1996).

Prodromou, C. & Pearl, L. H., Protein Engineering 5, 827-829 (1992).

Rosenberg, S. A. & Lotze, M. T., Ann. Rev. Immunol. 4,681-709 (1986).

Skerra, A. & Plückthun, A., Science 240, 1038-1041 (1988).

Skerra, A., Pfitzinger, 1. & Plückthun, A., Bio/Technology 9, 273-278 (1991).

Sutherland, L., Davidson, J., Glass, L. L., & Jacobs, H. T., BioTechniques 18, 458-464, 1995.

Tomlinson, I. M., Walter, G., Marks, J. D., Llewelyn, M. B. & Winter, G., J. Mol. Biol. 227, 776-798 (1992).

Ullrich, H. D., Patten, P. A., Yang, P. L., Romesberg, F. E. & Schultz, P. G., Proc. Natl. Acad. Sci. USA 92, 11907-11911 (1995).

Van Dijk, K. W., Mortari, F., Kirkham, P. M., Schroeder Jr., H. W. & Milimer, E. C. B., Eur J.Immunol. 23, 832-839 (1993).

Virnekäs, B., Ge, L., Plückthun, A., Schneider, K. C., Wellnhofer, G. & Moroney, S. E., Nucleic Acids Research 22, 5600-5607 (1994).

Viletta, E. S., Thorpe, P. E. & Uhr, J., Immunol. Today 14, 253-259 (1993).

Williams, S. C. & Winter, G., Eur. J. Immunol. 23, 1456-1461 (1993).

Winter, G., Griffiths. A. D., Hawkins, R. E. & Hoogenboom, H. R., Ann. Rev. Immunol. 12, 433-455 (1994).

TABLE 1A
Human kappa germline gene segments
Used Name 1	Reference 2	Family 3	Germline genes 4
Vk1-1	9	1	O8; O18; DPK1
Vk1-2	1	1	L14; DPK2
Vk1-3	2	1	L15(1); HK101; HK146; HK189
Vk1-4	9	1	L11
Vk1-5	2	1	A30
Vk1-6	1	1	LFVK5
Vk1-7	1	1	LFVK431
Vk1-8	1	1	L1; HK137
Vk1-9	1	1	A20; DPK4
Vk1-10	1	1	L18; Va″
Vk1-11	1	1	L4; L18; Va′; V4a
Vk1-12	2	1	L5; L19(1); Vb; Vb4; DPK5;
			L19(2); Vb″; DPK6
Vk1-13	2	1	L15(2); HK134; HK166; DPK7
Vk1-14	8	1	L8; Vd; DPK8
Vk1-15	8	1	L9; Ve
Vk1-16	1	1	L12(1); HK102; V1
Vk1-17	2	1	L12(2)
Vk1-18	1	1	O12a(V3b)
Vk1-19	6	1	O2; O12; DPK9
Vk1-20	2	1	L24; Ve″; V13; DPK10
Vk1-21	1	1	O4; O14
Vk1-22	2	1	L22
Vk1-23	2	1	L23
Vk2-1	1	2	A2; DPK12
Vk2-2	6	2	O1; O11(1); DPK13
Vk2-3	6	2	O12(2); V3a
Vk2-4	2	2	L13
Vk2-5	1	2	DPK14
Vk2-6	4	2	A3; A19; DPK15
Vk2-7	4	2	A29; DPK27
Vk2-8	4	2	A13
Vk2-9	1	2	A23
Vk2-10	4	2	A7; DPK17
Vk2-11	4	2	A17; DPK18
Vk2-12	4	2	A1; DPK19
Vk3-1	11	3	A11; humkv305; DPK20
Vk3-2	1	3	L20; Vg″
Vk3-3	2	3	L2; L16; humkv328; humkv328h2;
			humkv328h5; DPK21
Vk3-4	11	3	A27; humkv325; VkRF; DPK22
Vk3-5	2	3	L25; DPK23
Vk3-6	2	3	L10(1)
Vk3-7	7	3	L10(2)
Vk3-8	7	3	L6; Vg
Vk4-1	3	4	B3; VkIV; DPK24
Vk5-1	10	5	B2; EV15
Vk6-1	12	6	A14; DPK25
Vk6-2	12	6	A10; A26; DPK26
Vk7-1	5	7	B1

TABLE 1B
Human lambda germline gene segments
Used Name 1	Reference 2	Family 3	Germline genes 4
DP1	1	1
DPL2	1	1	HUMLV1L1
DPL3	1	1	HUMLV122
DPL4	1	1	VLAMBDA 1.1
HUMLV117	2	1
DPL5	1	1	HUMLV117D
DPL6	1	1
DPL7	1	1	IGLV1S2
DPL8	1	1	HUMLV1042
DPL9	1	1	HUMLV101
DPL10	1	2
VLAMBDA 2.1	3	2
DPL11	1	2
DPL12	1	2
DPL13	1	2
DPL14	1	2
DPL16	1	3	Humlv418; IGLV3S1
DPL23	1	3	Vl III.1
Humlv318	4	3
DPL18	1	7	4A; HUMIGLVA
DPL19	1	7
DPL21	1	8	VL8.1
HUMLV801	5	8
DPL22	1	9
DPL24	1	unassigned	VLAMBDA N.2
gVLX-4.4	8	10

TABLE 1C
Human heavy chain germline gene segments
Used Name 1	Reference 2	Family 3	Germline gene 4
VH1-12-1	19	1	DP10; DA-2; DA-6
VH1-12-8	22	1	RRVH1.2
VH1-12-2	6	1	hv1263
VH1-12-9	7	1	YAC-7; RR.VH1.1; 1-69
VH1-12-3	19	1	DP3
VH1-12-4	19	1	DP21; 4d275a; VH7a
VH1-12-5	18	1	I-4.1b; V1-4.1b
VH1-12-6	21	1	1D37; VH7b; 7-81; YAC-10
VH1-12-7	19	1	DP14; VH1GRR; V1-18
VH1-13-1	10	1	71-5; DP2
VH1-13-2	10	1	E3-10
VH1-13-3	19	1	DP1
VH1-13-4	12	1	V35
VH1-13-5	8	1	V1-2b
VH1-13-6	18	1	I-2; DP75
VH1-13-7	21	1	V1-2
VH1-13-8	19	1	DP8
VH1-13-9	3	1	1-1
VH1-13-10	19	1	DP12
VH1-13-11	15	1	V13C
VH1-13-12	18	1	1-3b; DP25; V1-3b
VH1-13-13	3	1	1-92
VH1-13-14	18	1	1-3; V1-3
VH1-13-15	19	1	DP15; V1-8
VH1-13-16	3	1	21-2; 3-1; DP7; V1-46
VH1-13-17	16	1	HG3
VH1-13-18	19	1	DP4; 7-2; V1-45
VH1-13-19	27	1	COS 5
VH1-1X-1	19	1	DP5; 1-24P
VH2-21-1	18	2	II-5b
VH2-31-1	2	2	VH2S12-1
VH2-31-2	2	2	VH2S12-7
VH2-31-3	2	2	VH2S12-9; DP27
VH2-31-4	2	2	VH2S12-10
VH2-31-5	14	2	V2-26; DP26; 2-26
VH2-31-6	15	2	VF2-26
VH2-31-7	19	2	DP28; DA-7
VHZ-31-14	7	2	YAC-3; 2-70
VH2-31-8	2	2	VH2S12-5
VH2-31-9	2	2	VH2S12-12
VH2-31-10	18	2	II-5; V2-5
VH2-31-11	2	2	VH2S12-2; VH2S12-8
VH2-31-12	2	2	VH2S12-4; VH2S12-6
VH2-31-13	2	2	VH2S12-14
VH3-11-1	13	3	v65-2; DP44
VH3-11-2	19	3	DP45
VH3-11-3	3	3	13-2; DP48
VH3-11-4	19	3	DP52
VH3-11-5	14	3	v3-13
VH3-11-6	19	3	DP42
VH3-11-7	3	3	8-1B; YAC-5; 3-66
VH3-11-8	14	3	V3-53
VH3-13-1	3	3	22-28; DP35; V3-11
VH3-13-5	19	3	DP59; VH19; V3-35
VH3-13-6	25	3	f1-p1; DP61
VH3-13-7	19	3	DP46; GL-SJ2; COS 8; hv3005;
			hv3005f3; 3d21b; 56p1
VH3-13-8	24	3	VH26
VH3-13-9	5	3	vh26c
VH3-13-10	19	3	DP47; VH26; 3-23
VH3-13-11	3	3	1-91
VH3-13-12	19	3	DP58
VH3-13-13	3	3	1-9III; DP49; 3-30; 3d28.1
VH3-13-14	24	3	3019B9; DP50; 3-33; 3d277
VH3-13-15	27	3	COS 3
VH3-13-16	19	3	DP51
VH3-13-17	16	3	H11
VH3-13-18	19	3	DP53; COS 6; 3-74; DA-8
VH3-13-19	19	3	DP54; VH3-11; V3-7
VH3-13-20	14	3	V3-64; YAC-6
VH3-13-21	14	3	V3-48
VH3-13-22	14	3	V3-43; DP33
VH3-13-23	14	3	V3-33
VH3-13-24	14	3	V3-21; DP77
VH3-13-25	14	3	V3-20; DP32
VH3-13-26	14	3	V3-9; DP31
VH3-14-1	3	3	12-2; DP29; 3-72; DA-3
VH3-14-4	7	3	YAC-9; 3-73; MTGL
VH3-14-2	4	3	VHD26
VH3-14-3	19	3	DP30
VH3-1X-1	1	3	LSG8.1; LSG9.1; LSG10.1;
			HUM12IGVH; HUM13IGVH
VH3-1X-2	1	3	LSG11.1; HUM4IGVH
VH3-1X-3	3	3	9-1; DP38; LSG7.1; RCG1.1;
			LSG1.1; LSG3.1; LSG5.1;
			HUM15IGVH; HUM2IGVH;
			HUM9IGVH
VH3-1X-4	1	3	LSG4.1
VH3-1X-5	1	3	LSG2.1
VH3-1X-6	1	3	LSG6.1; HUM10IGVH
VH3-1X-7	18	3	3-15; V3-15
VH3-1X-8	1	3	LSG12.1; HUM5IGVH
VH3-1X-9	14	3	V3-49
VH4-11-1	22	4	Tou-VH4.21
VH4-11-2	17	4	VH4.21; DP63; VH5; 4d76; V4-34
VH4-11-3	23	4	4.44
VH4-11-4	23	4	4.44.3
VH4-11-5	23	4	4.36
VH4-11-6	23	4	4.37
VH4-11-7	18	4	IV-4; 4.35; V4-4
VH4-11-8	17	4	VH4.11; 3d197d; DP71; 58p2
VH4-11-9	20	4	H7
VH4-11-10	20	4	H8
VH4-11-11	20	4	H9
VH4-11-12	17	4	VH4.16
VH4-11-13	23	4	4.38
VH4-11-14	17	4	VH4.15
VH4-11-15	11	4	58
VH4-11-16	10	4	71-4; V4-59
VH4-21-1	11	4	11
VH4-21-2	17	4	VH4.17; VH4.23; 4d255; 4.40;
			DP69
VH4-21-3	17	4	VH4.19; 79; V4-4b
VH4-21-4	19	4	DP70; 4d68; 4.41
VH4-21-5	19	4	DP67; VH4-4B
VH4-21-6	17	4	VH4.22; VHSP; VH-JA
VH4-21-7	17	4	VH4.13; 1-911; 12G-1; 3d28d;
			4.42; DP68; 4-28
VH4-21-8	26	4	hv4005; 3d24d
VH4-21-9	17	4	VH4.14
VH4-31-1	23	4	4.34; 3d230d; DP78
VH4-31-2	23	4	4.34.2
VH4-31-3	19	4	DP64; 3d216d
VH4-31-4	19	4	DP65; 4-31; 3d277d
VH4-31-5	23	4	4.33; 3d75d
VH4-31-6	20	4	H10
VH4-31-7	20	4	H11
VH4-31-8	23	4	4.31
VH4-31-9	23	4	4.32
VH4-31-10	20	4	3d277d
VH4-31-11	20	4	3d216d
VH4-31-12	20	4	3d279d
VH4-31-13	17	4	VH4.18; 4d154; DP79
VH4-31-14	8	4	V4-39
VH4-31-15	11	4	2-1; DP79
VH4-31-16	23	4	4.30
VH4-31-17	17	4	VH4.12
VH4-31-18	10	4	71-2; DP66
VH4-31-19	23	4	4.39
VH4-31-20	8	4	V4-61
VH5-12-1	9	5	VH251; DP73; VHVCW; 51-R1;
			VHVLB; VHVCH; VHVTT;
			VHVAU; VHVBLK; VhAU;
			V5-51
VH5-12-2	17	5	VHVJB
VH5-12-3	3	5	1-v; DP80; 5-78
VH5-12-4	9	5	VH32; VHVRG; VHVMW; 5-2R1
VH6-35-1	4	6	VHVI; VH6; VHVIIS; VHVITE;
			VHVUB; VHVICH; VHVICW;
			VHVIBLK; VHVIMW; DP74;
			6-1G1; V6-1

TABLE 2A
rearranged human kappa sequences
		Computed	Germline	Diff. to	% diff. to
Name 1	aa 2	family 3	gene 4	germline 5	germline 6	Reference 7
III-3R	108	1	O8	1	1.1%	70
No.86	109	1	O8	3	3.2%	80
AU	108	1	O8	6	6.3%	103
ROY	108	1	O8	6	6.3%	43
IC4	108	1	O8	6	6.3%	70
HIV-826	106	1	O8	3	3.2%	8
GRI	108	1	O8	8	8.4%	30
AG	106	1	O8	8	8.6%	116
REI	108	1	O8	9	9.5%	86
CLL PATIENT 16	88	1	O8	2	2.3%	122
CLL PATIENT 14	87	1	O8	2	2.3%	122
CLL PATIENT 15	88	1	O8	2	2.3%	122
GM4672	108	1	O8	11	11.6%	24
HUM. YFC51.1	108	1	O8	12	12.6%	110
LAY	108	1	O8	12	12.6%	48
HIV-b13	106	1	O8	9	9.7%	8
MAL-NaCl	108	1	O8	13	13.7%	102
STRAb SA-1A	108	1	O2	0	0.0%	120
HuVHCAMP	108	1	O8	13	13.7%	100
CRO	108	1	O2	10	10.5%	30
Am107	108	1	O2	12	12.6%	108
WALKER	107	1	O2	4	4.2%	57
III-2R	109	1	A20	0	0.0%	70
FOG1-A4	107	1	A20	4	4.2%	41
HK137	95	1	L1	0	0.0%	10
CEA4-8A	107	1	O2	7	7.4%	41
Va′	95	1	L4	0	0.0%	90
TR1.21	108	1	O2	4	4.2%	92
HAU	108	1	O2	6	6.3%	123
HK102	95	1	L12(1)	0	0.0%	9
H20C3K	108	1	L12(2)	3	3.2%	125
CHEB	108	1	O2	7	7.4%	5
HK134	95	1	L15(2)	0	0.0%	10
TEL9	108	1	O2	9	9.5%	73
TR1.32	103	1	O2	3	3.2%	92
RF-KES1	97	1	A20	4	4.2%	121
WES	108	1	L5	10	10.5%	61
DILp1	95	1	O4	1	1.1%	70
SA-4B	107	1	L12(2)	8	8.4%	120
HK101	95	1	L15(1)	0	0.0%	9
TR1.23	108	1	O2	5	5.3%	92
HF2-1/17	108	1	A30	0	0.0%	4
2E7	108	1	A30	1	1.1%	62
33.C9	107	1	L12(2)	7	7.4%	126
3D6	105	1	L12(2)	2	2.1%	34
I-2a	108	1	L8	8	8.4%	70
RF-KL1	97	1	L8	4	4.2%	121
TNF-E7	108	1	A30	9	9.5%	41
TR1.22	108	1	O2	7	7.4%	92
HIV-B35	106	1	O2	2	2.2%	8
H1-b22	106	1	O2	2	2.2%	8
HIV-b27	106	1	O2	2	2.2%	8
HIV-B8	107	1	O2	10	10.8%	8
HIV-b8	107	1	O2	10	10.8%	8
RF-SJ5	95	1	A30	5	5.3%	113
GAL(1)	108	1	A30	6	6.3%	64
R3.5H5G	108	1	O2	6	6.3%	70
HIV-b14	106	1	A20	2	2.2%	8
TNF-E1	105	1	L5	8	8.4%	41
WEA	108	1	A30	8	8.4%	37
EU	108	1	L12(2)	5	5.3%	40
FOG1-G8	108	1	L8	11	11.6%	41
1X7RG1	108	1	L1	8	8.4%	70
BL1	108	1	L8	3	3.2%	72
KUE	108	1	L12(2)	11	11.6%	32
LUNm01	108	1	L12(2)	10	10.5%	6
HIV-b1	106	1	A20	4	4.3%	8
HIV-s4	103	1	O2	2	2.2%	8
CAR	107	1	L12(2)	11	11.7%	79
BR	107	1	L12(2)	11	11.6%	50
CLL PATIENT 10	88	1	O2	0	0.0%	122
CLL PATIENT 12	88	1	O2	0	0.0%	122
KING	108	1	L12(2)	12	12.6%	30
V13	95	1	L24	0	0.0%	46
CLL PATIENT 11	87	1	O2	0	0.0%	122
CLL PATIENT 13	87	1	O2	0	0.0%	122
CLL PATIENT 9	88	1	O12	1	1.1%	122
HIV-B2	106	1	A20	9	9.7%	8
HIV-b2	108	1	A20	9	9.7%	8
CLL PATIENT 5	88	1	A20	1	1.1%	122
CLL PATIENT 1	88	1	L8	2	2.3%	122
CLL PATIENT 2	88	1	L8	0	0.0%	122
CLL PATIENT 7	88	1	L5	0	0.0%	122
CLL PATIENT 8	88	1	L5	0	0.0%	122
HIV-b5	105	1	L5	11	12.0%	8
CLL PATIENT 3	87	1	L8	1	1.1%	122
CLL PATIENT 4	88	1	L9	0	0.0%	122
CLL PATIENT 18	85	1	L9	6	7.1%	122
CLL PATIENT 17	86	1	L12(2)	7	8.1%	122
HIV-b20	107	3	A27	11	11.7%	8
2C12	108	1	L12(2)	20	21.1%	68
1B11	108	1	L12(2)	20	21.1%	68
1H1	108	1	L12(2)	21	22.1%	68
2A12	108	1	L12(2)	21	22.1%	68
CUR	109	3	A27	0	0.0%	66
GLO	109	3	A27	0	0.0%	16
RF-TS1	96	3	A27	0	0.0%	121
GAR′	109	3	A27	0	0.0%	67
FLO	109	3	A27	0	0.0%	66
PIE	109	3	A27	0	0.0%	91
HAH 14.1	109	3	A27	1	1.0%	51
HAH 14.2	109	3	A27	1	1.0%	51
HAH 16.1	109	3	A27	1	1.0%	51
NOV	109	3	A27	1	1.0%	52
33.F12	108	3	A27	1	1.0%	126
8E10	110	3	A27	1	1.0%	25
TH3	109	3	A27	1	1.0%	25
HIC(R)	108	3	A27	0	0.1%	51
SON	110	3	A27	1	1.1%	67
PAY	109	3	A27	1	1.0%	66
GOT	109	3	A27	1	1.0%	67
mAbA6H4C5	109	3	A27	1	1.0%	12
BOR′	109	3	A27	2	2.1%	84
RF-SJ3	96	3	A27	2	2.1%	121
SIE	109	3	A27	2	2.1%	15
ESC	109	3	A27	2	2.1%	98
HEW′	110	3	A27	2	2.1%	98
YES8c	109	3	A27	3	3.1%	33
TI	109	3	A27	3	3.1%	114
mAb113	109	3	A27	3	3.1%	71
HEW	107	3	A27	0	0.0%	94
BRO	106	3	A27	0	0.0%	94
ROB	106	3	A27	0	0.0%	94
NG9	96	3	A27	4	4.2%	11
NEU	109	3	A27	4	4.2%	66
WOL	109	3	A27	4	4.2%	2
35G6	109	3	A27	4	4.2%	59
RF-SJ4	109	3	A11	0	0.0%	88
KAS	109	3	A27	4	4.2%	84
BRA	106	3	A27	1	1.1%	94
HAH	106	3	A27	1	1.1%	94
HIC	105	3	A27	0	0.1%	94
FS-2	109	3	A27	6	6.3%	87
JH′	107	3	A27	6	6.3%	38
EV1-15	109	3	A27	6	6.3%	83
SCA	108	3	A27	6	6.3%	65
mAb112	109	3	A27	6	6.3%	71
SIC	103	3	A27	3	3.3%	94
SA-4A	109	3	A27	6	6.3%	120
SER	108	3	A27	6	6.3%	98
GOL′	109	3	A27	7	7.3%	82
B5G10K	105	3	A27	9	9.7%	125
HG2B10K	110	3	A27	9	9.4%	125
Taykv322	105	3	A27	5	5.4%	52
CLL PATIENT 24	89	3	A27	1	1.1%	122
HIV-b24	107	3	A27	7	7.4%	8
HIV-b6	107	3	A27	7	7.4%	8
Taykv310	99	3	A27	1	1.1%	52
KA3D1	108	3	L6	0	0.0%	85
19.E7	107	3	L6	0	0.0%	126
rsv6L	109	3	A27	12	12.5%	7
Taykv320	98	3	A27	1	1.2%	52
Vh	96	3	L10(2)	0	0.0%	89
LS8	108	3	L6	1	1.1%	109
LS1	108	3	L6	1	1.1%	109
LS2S3-3	107	3	L6	2	2.1%	99
LS2	108	3	L6	1	1.1%	109
LS7	108	3	L6	1	1.1%	109
LS2S3-4d	107	3	L6	2	2.1%	99
LS2S3-4a	107	3	L6	2	2.1%	99
LS4	108	3	L6	1	1.1%	109
LS6	108	3	L6	1	1.1%	109
LS2S3-10a	107	3	L6	2	2.1%	99
Ls2S3-8c	107	3	L6	2	2.1%	99
LS5	108	3	L6	1	1.1%	109
LS2S3-5	107	3	L6	3	3.2%	99
LUNm03	109	3	A27	13	13.5%	6
IARC/BL41	108	3	A27	13	13.7%	55
slkv22	99	3	A27	3	3.5%	13
POP	108	3	L6	4	4.2%	111
LS2S3-10b	107	3	L6	3	3.2%	99
LS2S3-8f	107	3	L6	3	3.2%	99
LS2S3-12	107	3	L6	3	3.2%	99
HIV-B30	107	3	A27	11	11.7%	8
HIV-B20	107	3	A27	11	11.7%	8
HIV-b3	108	3	A27	11	11.7%	8
HIV-s6	104	3	A27	9	9.9%	8
YSE	107	3	L2/L16	1	1.1%	72
POM	109	3	L2/L16	9	9.4%	53
Humkv328	95	3	L2/L16	1	1.1%	19
CLL	109	3	L2/L16	3	3.2%	47
LES	96	3	L2/L16	3	3.2%	38
HIV-s5	104	3	A27	11	12.1%	8
HIV-s7	104	3	A27	11	12.1%	8
slkv1	99	3	A27	7	8.1%	13
Humka31es	95	3	L2/L16	4	4.2%	18
slkv12	101	3	A27	8	9.2%	13
RF-TS2	95	3	L21L16	3	3.2%	121
II-1	109	3	L2/L16	4	4.2%	70
HIV-s3	105	3	A27	13	14.3%	8
RF-TMC1	96	3	L6	10	10.5%	121
GER	109	3	L2/L16	7	7.4%	75
GF4/1.1	109	3	L2/L16	8	8.4%	36
mAb114	109	3	L2/L16	6	6.3%	71
HIV-loop13	109	3	L2/L16	7	7.4%	8
bkv16	86	3	L6	1	1.2%	13
CLL PATIENT 29	86	3	L6	1	1.2%	122
slkv9	98	3	L6	3	3.5%	13
bkv17	99	3	L6	1	1.2%	13
slkv14	99	3	L6	1	1.2%	13
slkv16	101	3	L6	2	2.3%	13
bkv33	101	3	L6	4	4.7%	13
slkv15	99	3	L6	2	2.3%	13
bkv6	100	3	L6	3	3.5%	13
R6B8K	108	3	L2/L16	12	12.6%	125
AL 700	107	3	L2/L16	9	9.5%	117
slkv11	100	3	L2/L16	3	3.5%	13
slkv4	97	3	L6	4	4.8%	13
CLL PATIENT 26	87	3	L2/L16	1	1.1%	122
AL Se124	103	3	L2/L16	9	9.5%	117
slkv13	100	3	L2/L16	6	7.0%	13
bkv7	100	3	L2/L16	5	5.8%	13
bkv22	100	3	L2/L16	6	7.0%	13
CLL PATIENT 27	84	3	L2/L16	0	0.0%	122
bkv35	100	3	L6	8	9.3%	13
CLL PATIENT 25	87	3	L2/L16	4	4.6%	122
slkv3	86	3	L2/L16	7	8.1%	13
slkv7	99	1	O2	7	8.1%	13
HuFd79	111	3	L2/L16	24	24.2%	21
RAD	99	3	A27	9	10.3%	78
CLL PATIENT 28	83	3	L2/L16	4	4.8%	122
REE	104	3	L2/L16	25	27.2%	95
FR4	99	3	A27	8	9.2%	77
MD3.3	92	3	L6	1	1.3%	54
MD3.1	92	3	L6	0	0.0%	54
GA3.6	92	3	L6	2	2.6%	54
M3.5N	92	3	L6	3	2.8%	54
WEI′	82	3	A27	0	0.0%	65
MD3.4	92	3	L2/L16	1	1.3%	54
MD3.2	91	3	L6	3	3.8%	54
VER	97	3	A27	19	22.4%	20
CLL PATIENT 30	78	3	L6	3	3.8%	122
M3.1N	92	3	L2/L16	1	1.3%	54
MD3.6	91	3	L2/L16	0	0.0%	54
MD3.8	91	3	L2/L16	0	0.0%	54
GA3.4	92	3	L6	7	9.0%	54
M3.6N	92	3	A27	0	0.0%	54
MD3.10	92	3	A27	0	0.0%	54
MD3.13	91	3	A27	0	0.0%	54
MD3.7	93	3	A27	0	0.0%	54
MD3.9	93	3	A27	0	0.0%	54
GA3.1	93	3	A27	6	7.6%	54
bkv32	101	3	A27	5	5.7%	13
GA3.5	93	3	A27	5	6.3%	54
GA3.7	92	3	A27	7	8.9%	54
MD3.12	92	3	A27	2	2.5%	54
M3.2N	90	3	L6	6	7.8%	54
MD3.5	92	3	A27	1	1.3%	54
M3.4N	91	3	L2/L16	8	10.3%	54
M3.8N	91	3	L2/L16	7	9.0%	54
M3.7N	92	3	A27	3	3.8%	54
GA3.2	92	3	A27	9	11.4%	54
GA3.8	93	3	A27	4	5.1%	54
GA3.3	92	3	A27	8	10.1%	54
M3.3N	92	3	A27	5	6.3%	54
B6	83	3	A27	8	11.3%	78
E29.1 KAPPA	78	3	L2/L16	0	0.0%	22
SCW	108	1	O8	12	12.6%	31
REI-based CAMPATH-9	107	1	O8	14	14.7%	39
RZ	107	1	O8	14	14.7%	50
BI	108	1	O8	14	14.7%	14
AND	107	1	O2	13	13.7%	69
2A4	109	1	O2	12	12.6%	23
KA	108	1	O8	19	20.0%	107
MEV	109	1	O2	14	14.7%	29
DEE	106	1	O2	13	14.0%	76
OU(IOC)	108	1	O2	18	18.9%	60
HuRSV19VK	111	1	O8	21	21.0%	115
SP2	108	1	O2	17	17.9%	93
BJ26	99	1	O8	21	24.1%	1
NI	112	1	O8	24	24.2%	106
BMA 0310EUCIV2	106	1	L12(1)	21	22.3%	105
CLL PATIENT 6	71	1	A20	0	0.0%	122
BJ19	85	1	O8	16	21.9%	1
GM 607	113	2	A3	0	0.0%	58
R5A3K	114	2	A3	1	1.0%	125
R1C8K	114	2	A3	1	1.0%	125
VK2.R149	113	2	A3	2	2.0%	118
TR1.6	109	2	A3	4	4.0%	92
TR1.37	104	2	A3	5	5.0%	92
FS-1	113	2	A3	6	6.0%	87
TR1.8	110	2	A3	6	6.0%	92
NIM	113	2	A3	8	8.0%	28
Inc	112	2	A3	11	11.0%	35
TEW	107	2	A3	6	6.4%	96
CUM	114	2	O1	7	6.9%	44
HRF1	71	2	A3	4	5.6%	124
CLL PATIENT 19	87	2	A3	0	0.0%	122
CLL PATIENT 20	87	2	A3	0	0.0%	122
MIL	112	2	A3	16	16.2%	26
FR	113	2	A3	20	20.0%	101
MAL-Urine	83	1	O2	6	8.6%	102
Taykv306	73	3	A27	1	1.6%	52
Taykv312	75	3	A27	1	1.6%	52
HIV-b29	93	3	A27	14	17.5%	8
1-185-37	110	3	A27	0	0.0%	119
1-187-29	110	3	A27	0	0.0%	119
TT117	110	3	A27	9	9.4%	63
HIV-loop8	108	3	A27	16	16.8%	8
rsv23L	108	3	A27	16	16.8%	7
HIV-b7	107	3	A27	14	14.9%	8
HIV-b11	107	3	A27	15	16.0%	8
HIV-LC1	107	3	A27	19	20.2%	8
HIV-LC7	107	3	A27	20	21.3%	8
HIV-LC22	107	3	A27	21	22.3%	8
HIV-LC13	107	3	A27	21	22.3%	8
HIV-LC3	107	3	A27	21	22.3%	8
HIV-LC5	107	3	A27	21	22.3%	8
HIV-LC28	107	3	A27	21	22.3%	8
HIV-b4	107	3	A27	22	23.4%	8
CLL PATIENT 31	87	3	A27	15	17.2%	122
HIV-loop2	108	3	L2/L16	17	17.9%	8
HIV-loop35	108	3	L2/L16	17	17.9%	8
HIV-LC11	107	3	A27	23	24.5%	8
HIV-LC24	107	3	A27	23	24.5%	8
HIV-b12	107	3	A27	24	25.5%	8
HIV-LC25	107	3	A27	24	25.5%	8
HIV-b21	107	3	A27	24	25.5%	8
HIV-LC26	107	3	A27	26	27.7%	8
G3D10K	108	1	L12(2)	12	12.6%	125
TT125	108	1	L5	8	8.4%	63
HIV-s2	103	3	A27	28	31.1%	8
265-695	108	1	L5	7	7.4%	3
2-115-19	108	1	A30	2	2.1%	119
rsv13L	107	1	O2	20	21.1%	7
HIV-b18	106	1	O2	14	15.1%	8
RF-KL5	98	3	L6	36	36.7%	97
ZM1-1	113	2	A17	7	7.0%	3
HIV-s8	103	1	O8	16	17.8%	8
K-EV15	95	5	B2	0	0.0%	112
RF-TS3	100	2	A23	0	0.0%	121
HF-21/28	111	2	A17	1	1.0%	17
RPMI6410	113	2	A17	1	1.0%	42
JC11	113	2	A17	1	1.0%	49
O-81	114	2	A17	5	5.0%	45
FK-001	113	4	B3	0	0.0%	81
CD5+.28	101	4	B3	1	1.0%	27
LEN	114	4	B3	1	1.0%	104
UC	114	4	B3	1	1.0%	111
CD5+.5	101	4	B3	1	1.0%	27
CD5+.26	101	4	B3	1	1.0%	27
CD5+.12	101	4	B3	2	2.0%	27
CD5+.23	101	4	B3	2	2.0%	27
CD5+.7	101	4	B3	2	2.0%	27
VJI	113	4	B3	3	3.0%	56
LOC	113	4	B3	3	3.0%	72
MAL	113	4	B3	3	3.0%	72
CD5+.6	101	4	83	3	3.0%	27
H2F	113	4	B3	3	3.0%	70
PB17IV	114	4	B3	4	4.0%	74
CD5+.27	101	4	B3	4	4.0%	27
CD5+.9	101	4	B3	4	4.0%	27
CD5−28	101	4	B3	5	5.0%	27
CD5−.26	101	4	B3	6	5.9%	27
CD5+.24	101	4	B3	6	5.9%	27
CD5+.10	101	4	B3	6	5.9%	27
CD5−.19	101	4	B3	6	5.9%	27
CD5−.18	101	4	B3	7	6.9%	27
CD5−.16	101	4	B3	8	7.9%	27
CD5−.24	101	4	B3	8	7.9%	27
CD5−.17	101	4	B3	10	9.9%	27
MD4.1	92	4	B3	0	0.0%	54
MD4.4	92	4	B3	0	0.0%	54
MD4.5	92	4	B3	0	0.0%	54
MD4.6	92	4	B3	0	0.0%	54
MD4.7	92	4	B3	0	0.0%	54
MD4.2	92	4	B3	1	1.3%	54
MD4.3	92	4	B3	5	6.3%	54
CLL PATIENT 22	87	2	A17	2	2.3%	122
CLL PATIENT 23	84	2	A17	2	2.4%	122

TABLE 2B
rearranged human lambda sequences
					%
				Diff.	diff.
				to	to
		Computed	Germline	germ-	germ-	Refer-
Name 1	aa 2	family 3	gene 4	line 5	line 6	ence 7
WAH	110	1	DPL3	7	7%	68
1B9/F2	112	1	DPL3	7	7%	9
DIA	112	1	DPL2	7	7%	36
mAb67	89	1	DPL3	0	0%	29
HiH2	110	1	DPL3	12	11%	3
NIG-77	112	1	DPL2	9	9%	72
OKA	112	1	DPL2	7	7%	84
KOL	112	1	DPL2	12	11%	40
T2:C5	111	1	DPL5	0	0%	6
T2:C14	110	1	DPL5	0	0%	6
PR-TS1	110	1	DPL5	0	0%	55
4G12	111	1	DPL5	1	1%	35
KIM46L	112	1	HUMLV117	0	0%	8
Fog-B	111	1	DPL5	3	3%	31
9F2L	111	1	DPL5	3	3%	79
mAb111	110	1	DPL5	3	3%	48
PHOX15	111	1	DPL5	4	4%	49
BL2	111	1	DPL5	4	4%	74
NIG-64	111	1	DPL5	4	4%	72
RF-SJ2	100	1	DPL5	6	6%	78
AL EZI	112	1	DPL5	7	7%	41
ZIM	112	1	HUMLV117	7	7%	18
RF-SJ1	100	1	DPL5	9	9%	78
IGLV1.1	98	1	DPL4	0	0%	1
NEW	112	1	HUMLV117	11	10%	42
CB-201	87	1	DPL2	1	1%	62
MEM	109	1	DPL2	6	6%	50
H210	111	2	DPL10	4	4%	45
NOV	110	2	DPL10	8	8%	25
NEI	111	2	DPL10	8	8%	24
AL MC	110	2	DPL11	6	6%	28
MES	112	2	DPL11	8	8%	84
FOG1-A3	111	2	DPL11	9	9%	27
AL NOV	112	2	DPL11	7	7%	28
HMST-1	110	2	DPL11	4	4%	82
HBW4-1	108	2	DPL12	9	9%	52
WH	110	2	DPL11	11	11%	34
11-50	110	2	DPL11	7	7%	82
HBp2	110	2	DPL12	8	8%	3
NIG-84	113	2	DPL11	12	11%	73
VIL	112	2	DPL11	9	9%	58
TRO	111	2	DPL12	10	10%	61
ES492	108	2	DPL11	15	15%	76
mAb216	89	2	DPL12	1	1%	7
BSA3	109	3	DPL16	0	0%	49
THY-29	110	3	DPL16	0	0%	27
PR-TS2	108	3	DPL16	0	0%	55
E29.1	107	3	DPL16	1	1%	13
LAMBDA
mAb63	109	3	DPL16	2	2%	29
TEL14	110	3	DPL16	6	6%	49
6H-3C4	108	3	DPL16	7	7%	39
SH	109	3	DPL16	7	7%	70
AL GIL	109	3	DPL16	8	8%	23
H6-3C4	108	3	DPL16	8	8%	83
V-lambda-2.DS	111	2	DPL11	3	3%	15
8.12 ID	110	2	DPL11	3	3%	81
DSC	111	2	DPL11	3	3%	56
PV11	110	2	DPL11	1	1%	56
33.H11	110	2	DPL11	4	4%	81
AS17	111	2	DPL11	7	7%	56
SD6	110	2	DPL11	7	7%	56
KS3	110	2	DPL11	9	9%	56
PV6	110	2	DPL12	5	5%	56
NGD9	110	2	DPL11	7	7%	56
MUC1-1	111	2	DPL11	11	10%	27
A30c	111	2	DPL10	6	6%	56
KS6	110	2	DPL12	6	6%	56
TEL13	111	2	DPL11	11	10%	49
AS7	110	2	DPL12	6	6%	56
MCG	112	2	DPL12	12	11%	20
U266L	110	2	DPL12	13	12%	77
PR-SJ2	110	2	DPL12	14	13%	55
BOH	112	2	DPL12	11	10%	37
TOG	111	2	DPL11	19	18%	53
TEL16	111	2	DPL11	19	18%	49
No.13	110	2	DPL10	14	13%	52
BO	112	2	DPL12	18	17%	80
WIN	112	2	DPL12	17	16%	11
BUR	104	2	DPL12	15	15%	46
NIG-58	110	2	DPL12	20	19%	69
WEIR	112	2	DPL11	26	25%	21
THY-32	111	1	DPL8	8	8%	27
TNF-H9G1	111	1	DPL8	9	9%	27
mAb61	111	1	DPL3	1	1%	29
LV1L1	98	1	DPL2	0	0%	54
HA	113	1	DPL3	14	13%	63
LA1L1	111	1	DPL2	3	3%	54
RHE	112	1	DPL1	17	16%	22
K1B12L	113	1	DPL8	17	16%	79
LOC	113	1	DPL2	15	14%	84
NIG-51	112	1	DPL2	12	11%	67
NEWM	104	1	DPL8	23	22%	10
MD3-4	106	3	DPL23	14	13%	4
COX	112	1	DPL2	13	12%	84
HiH10	106	3	DPL23	13	12%	3
VOR	112	1	DPL2	16	15%	16
AL POL	113	1	DPL2	16	15%	57
CD4-74	111	1	DPL2	19	18%	27
AMYLOID	102	3	DPL3	15	15%	30
MOL
OST577	108	3	Humlv318	10	10%	4
NIG-48	113	1	DPL3	42	40%	66
CARR	108	3	DPL23	18	17%	19
mAb60	108	3	DPL23	14	13%	29
NIG-68	99	3	DPL23	25	26%	32
KERN	107	3	DPL23	26	25%	59
ANT	106	3	DPL23	17	16%	19
LEE	110	3	DPL23	18	17%	85
CLE	94	3	DPL23	17	17%	19
VL8	98	8	DPL21	0	0%	81
MOT	110	3	Humlv318	23	22%	38
GAR	108	3	DPL23	26	25%	33
32.B9	98	8	DPL21	5	5%	81
PUG	108	3	Humlv318	24	23%	19
T1	115	8	HUMLV801	52	50%	6
RF-TS7	96	7	DPL18	4	4%	60
YM-1	116	8	HUMLV801	51	49%	75
K6H6	112	8	HUMLV801	20	19%	44
K5C7	112	8	HUMLV801	20	19%	44
K5B8	112	8	HUMLV801	20	19%	44
K5G5	112	8	HUMLV801	20	19%	44
K4B8	112	8	HUMLV801	19	18%	44
K6F5	112	8	HUMLV801	17	16%	44
HIL	108	3	DPL23	22	21%	47
KIR	109	3	DPL23	20	19%	19
CAP	109	3	DPL23	19	18%	84
1B8	110	3	DPL23	22	21%	43
SHO	108	3	DPL23	19	18%	19
HAN	108	3	DPL23	20	19%	19
cML23	96	3	DPL23	3	3%	12
PR-SJ1	96	3	DPL23	7	7%	55
BAU	107	3	DPL23	9	9%	5
TEX	99	3	DPL23	8	8%	19
X(PET)	107	3	DPL23	9	9%	51
DOY	106	3	DPL23	9	9%	19
COT	106	3	DPL23	13	12%	19
Pag-1	111	3	Humlv318	5	5%	31
DIS	107	3	Humlv318	2	2%	19
WIT	108	3	Humlv318	7	7%	19
LRH	108	3	Humlv318	12	11%	19
S1-1	108	3	Humlv318	12	11%	52
DEL	108	3	Humlv318	14	13%	17
TYR	108	3	Humlv318	11	10%	19
J.RH	109	3	Humlv318	13	12%	19
THO	112	2	DPL13	38	36%	26
LBV	113	1	DPL3	38	36%	2
WLT	112	1	DPL3	33	31%	14
SUT	112	2	DPL12	37	35%	65

TABLE 2C
rearranged human heavy chain sequences
					%
				Diff.	diff.
		Com-		to	to	Ref-
		puted	Germline	germ-	germ-	er-
Name 1	aa 2	family 3	gene 4	line 5	line 6	ence 7
21/28	119	1	VH1-13-12	0	0.0%	31
BE10	123	1	VH1-13-12	0	0.0%	31
MUC1-1	118	1	VH1-13-6	4	4.1%	42
gF1	98	1	VH1-13-12	10	10.2%	75
VHGL 1.2	98	1	VH1-13-6	2	2.0%	26
HV1L1	98	1	VH1-13-6	0	0.0%	81
RF-TS7	104	1	VH1-13-6	3	3.1%	96
E55 1.A15	106	1	VH1-13-15	1	1.0%	26
HA1L1	126	1	VH1-13-6	7	7.1%	81
UC	123	1	VH1-13-6	5	5.1%	115
WIL2	123	1	VH1-13-6	6	6.1%	55
R3.5H5G	122	1	VH1-13-6	10	10.2%	70
N89P2	123	1	VH1-13-16	11	11.2%	77
mAb113	126	1	VH1-13-6	10	10.2%	71
LS2S3-3	125	1	VH1-12-7	5	5.1%	98
LS2S3-12a	125	1	VH1-12-7	5	5.1%	98
LS2S3-5	125	1	VH1-12-7	5	5.1%	98
LS2S3-12e	125	1	VH1-12-7	5	5.1%	98
LS2S3-4	125	1	VH1-12-7	5	5.1%	98
LS2S3-10	125	1	VH1-12-7	5	5.1%	98
LS2S3-	125	1	VH1-12-7	6	6.1%	98
LS2S3-8	125	1	VH1-12-7	5	5.1%	98
LS2	125	1	VH1-12-7	6	6.1%	113
LS4	105	1	VH1-12-7	6	6.1%	113
LS5	125	1	VH1-12-7	6	6.1%	113
LS1	125	1	VH1-12-7	6	6.1%	113
LS6	125	1	VH1-12-7	6	6.1%	113
LS8	125	1	VH1-12-7	7	7.1%	113
THY-29	122	1	VH1-12-7	0	0.0%	42
1B9/F2	122	1	VH1-12-7	10	10.2%	21
51P1	122	1	VH1-12-1	0	0.0%	105
NEI	127	1	VH1-12-1	0	0.0%	55
AND	127	1	VH1-12-1	0	0.0%	55
L7	127	1	VH1-12-1	0	0.0%	54
L22	124	1	VH1-12-1	0	0.0%	54
L24	127	1	VH1-12-1	0	0.0%	54
L26	116	1	VH1-12-1	0	0.0%	54
L33	119	1	VH1-12-1	0	0.0%	54
L34	117	1	VH1-12-1	0	0.0%	54
L36	118	1	VH1-12-1	0	0.0%	54
L39	120	1	VH1-12-1	0	0.0%	54
L41	120	1	VH1-12-1	0	0.0%	54
L42	125	1	VH1-12-1	0	0.0%	54
VHGL 1.8	101	1	VH1-12-1	0	0.0%	26
783c	127	1	VH1-12-1	0	0.0%	22
X17115	127	1	VH1-12-1	0	0.0%	37
L25	124	1	VH1-12-1	0	0.0%	54
L17	120	1	VH1-12-1	1	1.0%	54
L30	127	1	VH1-12-1	1	1.0%	54
L37	120	1	VH1-12-1	1	1.0%	54
TNF-E7	116	1	VH1-12-1	2	2.0%	42
mAb111	122	1	VH1-12-1	7	7.1%	71
III-2R	122	1	VH1-12-9	3	3.1%	70
KAS	121	1	VH1-12-1	7	7.1%	79
YES8c	122	1	VH1-12-1	8	8.2%	34
RF-TS1	123	1	VH1-12-1	8	8.2%	82
BOR	121	1	VH1-12-8	7	7.1%	79
VHGL 1.9	101	1	VH1-12-1	8	8.2%	26
mAb410.30F305	117	1	VH1-12-9	5	5.1%	52
EV1-15	127	1	VH1-12-8	10	10.2%	78
mAb112	122	1	VH1-12-1	11	11.2%	71
EU	117	1	VH1-12-1	11	11.2%	28
H210	127	1	VH1-12-1	12	12.2%	66
TRANSGENE	104	1	VH1-12-1	0	0.0%	111
CLL2-1	93	1	VH1-12-1	0	0.0%	30
CLL10 13-3	97	1	VH1-12-1	0	0.0%	29
LS7	99	1	VH1-12-7	4	4.1%	113
ALL7-1	87	1	VH1-12-7	0	0.0%	30
CLL3-1	91	1	VH1-12-7	1	1.0%	30
ALL56-1	85	1	VH1-13-8	0	0.0%	30
ALL1-1	87	1	VH1-13-6	1	1.0%	30
ALL4-1	94	1	VH1-13-8	0	0.0%	30
ALL56 15-4	85	1	VH1-13-8	5	5.1%	29
CLL4-1	88	1	VH1-13-1	1	1.0%	30
Au92.1	98	1	VH1-12-5	0	0.0%	49
RF-TS3	120	1	VH1-12-5	1	1.0%	82
Au4.1	98	1	VH1-12-5	1	1.0%	49
HP1	121	1	VH1-13-6	13	13.3%	110
BLI	127	1	VH1-13-15	5	5.1%	72
No.13	127	1	VH1-12-2	19	19.4%	76
TR1.23	122	1	VH1-13-2	23	23.5%	88
S1-1	125	1	VH1-12-2	18	18.4%	76
TR1.10	119	1	VH1-13-12	14	14.3%	88
E55 1.A2	102	1	VH1-13-15	3	3.1%	26
SP2	119	1	VH1-13-6	15	15.3%	89
TNF-H9G1	111	1	VH1-13-18	2	2.0%	42
G3D10H	127	1	VH1-13-16	19	19.4%	127
TR1.9	118	1	VH1-13-12	14	14.3%	88
TR1.8	121	1	VH1-12-1	24	24.5%	88
LUNm01	127	1	VH1-13-6	22	22.4%	9
K1B12H	127	1	VH1-12-7	23	23.5%	127
L3B2	99	1	VH1-13-6	2	2.0%	46
ss2	100	1	VH1-13-6	2	2.0%	46
No.86	124	1	VH1-12-1	20	20.4%	76
TR1.6	124	1	VH1-12-1	19	19.4%	88
ss7	99	1	VH1-12-7	3	3.1%	46
s5B7	102	1	VH1-12-1	0	0.0%	46
s6A3	97	1	VH1-12-1	0	0.0%	46
ss6	99	1	VH1-12-1	0	0.0%	46
L2H7	103	1	VH1-13-12	0	0.0%	46
s6BG8	93	1	VH1-13-12	0	0.0%	46
s6C9	107	1	VH1-13-12	0	0.0%	46
HIV-b4	124	1	VH1-13-12	21	21.4%	12
HIV-b12	124	1	VH1-13-12	21	21.4%	12
L3G5	98	1	VH1-13-6	1	1.0%	46
22	115	1	VH1-13-6	11	11.2%	118
L2A12	99	1	VH1-13-15	3	3.1%	46
PHOX15	124	1	VH1-12-7	20	20.4%	73
LUNm03	127	1	VH1-1X-1	18	18.4%	9
CEA4-8A	129	1	VH1-12-7	1	1.0%	42
M60	121	2	VH2-31-3	3	3.0%	103
H1H10	127	2	VH2-31-5	9	9.0%	4
COR	119	2	VH2-31-2	11	11.0%	91
2-115-19	124	2	VH2-31-11	8	8.1%	124
OU	125	2	VH2-31-14	20	25.6%	92
HE	120	2	VH2-31-13	19	19.0%	27
CLL33 40-1	78	2	VH2-31-5	2	2.0%	29
E55 3.9	88	3	VH3-11-5	7	7.2%	26
MTFC3	125	3	VH3-14-4	21	21.0%	131
MTFC11	125	3	VH3-14-4	21	21.0%	131
MTFJ1	114	3	VH3-14-4	21	21.0%	131
MTFJ2	114	3	VH3-14-4	21	21.0%	131
MTFUJ4	100	3	VH3-14-4	21	21.0%	131
MTFUJ5	100	3	VH3-14-4	21	21.0%	131
MTFUJ2	100	3	VH3-14-4	22	22.0%	131
MTFC8	125	3	VH3-14-4	23	23.0%	131
TD e Vq	113	3	VH3-14-4	0	0.0%	16
rMTF	114	3	VH3-14-4	5	5.0%	131
MTFUJ6	100	3	VH3-14-4	10	10.0%	131
RF-KES	107	3	VH3-14-4	9	9.0%	85
N51P8	126	3	VH3-14-1	9	9.0%	77
TEI	119	3	VH3-13-8	21	21.4%	20
33.H11	115	3	VH3-13-19	10	10.2%	129
SB1/D8	101	3	VH3-1X-8	14	14.0%	2
38P1	119	3	VH3-11-3	0	0.0%	104
BRO′IGM	119	3	VH3-11-3	13	13.4%	19
NIE	119	3	VH3-13-7	15	15.3%	87
3D6	126	3	VH3-13-26	5	5.1%	35
ZM1-1	112	3	VH3-11-3	8	8.2%	5
E55 3.15	110	3	VH3-13-26	0	0.0%	26
gF9	108	3	VH3-13-8	15	15.3%	75
THY-32	120	3	VH3-13-26	3	3.1%	42
RF-KL5	100	3	VH3-13-26	5	5.1%	96
OST577	122	3	VH3-13-13	6	6.1%	5
BO	113	3	VH3-13-19	15	15.3%	10
TT125	121	3	VH3-13-10	15	15.3%	64
2-115-58	127	3	VH3-13-10	11	11.2%	124
KOL	126	3	VH3-13-14	16	16.3%	102
mAb60	118	3	VH3-13-17	14	14.3%	45
RF-AN	106	3	VH3-13-26	8	8.2%	85
BUT	115	3	VH3-11-6	13	13.4%	119
KOI-based	118	3	VH3-13-13	16	16.3%	41
CAMPATH-9
B1	119	3	VH3-13-19	13	13.3%	53
N98P1	127	3	VH3-13-1	13	13.3%	77
TT117	107	3	VH3-13-10	12	12.2%	64
WEA	114	3	VH3-13-12	15	15.3%	40
HIL	120	3	VH3-13-14	14	14.3%	23
s5A10	97	3	VH3-13-14	0	0.0%	46
s5D11	98	3	VH3-13-7	0	0.0%	46
s6C8	100	3	VH3-13-7	0	0.0%	46
s6H12	98	3	VH3-13-7	0	0.0%	46
VH10.7	119	3	VH3-13-14	16	16.3%	128
HIV-loop2	126	3	VH3-13-7	16	16.3%	12
HIV-loop35	126	3	VH3-13-7	16	16.3%	12
TRO	122	3	VH3-13-1	13	13.3%	61
SA-4B	123	3	VH3-13-1	15	15.3%	125
L2B5	98	3	VH3-13-13	0	0.0%	46
s6E11	95	3	VH3-13-13	0	0.0%	46
s6H7	100	3	VH3-13-13	0	0.0%	46
ss1	102	3	VH3-13-13	0	0.0%	46
ss8	94	3	VH3-13-13	0	0.0%	46
DOB	120	3	VH3-13-26	21	21.4%	116
THY-33	115	3	VH3-13-15	20	20.4%	42
NOV	118	3	VH3-13-19	14	14.3%	38
rsv13H	120	3	VH3-13-24	20	20.4%	11
L3G11	98	3	VH3-13-20	2	2.0%	46
L2E8	99	3	VH3-13-19	0	0.0%	46
L2D10	101	3	VH3-13-10	1	1.0%	46
L2E7	98	3	VH3-13-10	1	1.0%	46
L3A10	100	3	VH3-13-24	0	0.0%	46
L2E5	97	3	VH3-13-2	1	1.0%	46
BUR	119	3	VH3-13-7	21	21.4%	67
s4D5	107	3	VH3-11-3	1	1.0%	46
19	116	3	VH3-13-16	4	4.1%	118
s5D4	99	3	VH3-13-1	0	0.0%	46
s6A8	100	3	VH3-13-1	0	0.0%	46
HIV-loop13	123	3	VH3-13-12	17	17.3%	12
TR1.32	112	3	VH3-11-8	18	18.6%	88
L2B10	97	3	VH3-11-3	1	1.0%	46
TR1.5	114	3	VH3-11-8	21	21.6%	88
s6H9	101	3	VH3-13-25	0	0.0%	46
8	112	3	VH3-13-1	6	6.1%	118
23	115	3	VH3-13-1	6	6.1%	118
7	115	3	VH3-13-1	4	4.1%	118
TR1.3	120	3	VH3-11-8	20	20.6%	88
18/2	125	3	VH3-13-10	0	0.0%	32
18/9	125	3	VH3-13-10	0	0.0%	31
30P1	119	3	VH3-13-10	0	0.0%	106
HF2-1/17	125	3	VH3-13-10	0	0.0%	8
A77	109	3	VH3-13-10	0	0.0%	44
B19.7	108	3	VH3-13-10	0	0.0%	44
M43	119	3	VH3-13-10	0	0.0%	103
1/17	125	3	VH3-13-10	0	0.0%	31
18/17	125	3	VH3-13-10	0	0.0%	31
E54 3.4	109	3	VH3-13-10	0	0.0%	26
LAMBDA-VH26	98	3	VH3-13-10	1	1.0%	95
E54 3.8	111	3	VH3-13-10	1	1.0%	26
GL16	106	3	VH3-13-10	1	1.0%	44
4G12	125	3	VH3-13-10	1	1.0%	56
A73	106	3	VH3-13-10	2	2.0%	44
AL1.3	111	3	VH3-13-10	3	3.1%	117
3.A290	118	3	VH3-13-10	2	2.0%	108
Ab18	127	3	VH3-13-8	2	2.0%	100
E54 3.3	105	3	VH3-13-10	3	3.1%	26
35G6	121	3	VH3-13-10	3	3.1%	57
A95	107	3	VH3-13-10	5	5.1%	44
Ab25	128	3	VH3-13-10	5	5.1%	100
N87	126	3	VH3-13-10	4	4.1%	77
ED8.4	99	3	VH3-13-10	6	6.1%	2
RF-KL1	122	3	VH3-13-10	6	6.1%	82
AL1.1	112	3	VH3-13-10	2	2.0%	117
AL3.11	102	3	VH3-13-10	1	1.0%	117
32.B9	127	3	VH3-13-8	6	6.1%	129
TK1	109	3	VH3-13-10	2	2.0%	117
POP	123	3	VH3-13-10	8	8.2%	115
9F2H	127	3	VH3-13-10	9	9.2%	127
VD	115	3	VH3-13-10	9	9.2%	10
Vh38Cl.10	121	3	VH3-13-10	8	8.2%	74
Vh38Cl.9	121	3	VH3-13-10	8	8.2%	74
Vh38Cl.8	121	3	VH3-13-10	8	8.2%	74
63P1	120	3	VH3-11-8	0	0.0%	104
60P2	117	3	VH3-11-8	0	0.0%	104
AL3.5	90	3	VH3-13-10	2	2.0%	117
GF4/1.1	123	3	VH3-13-10	10	10.2%	39
Ab21	126	3	VH3-13-10	12	12.2%	100
TD d Vp	118	3	VH3-13-17	2	2.0%	16
Vh38Cl.4	119	3	VH3-13-10	8	8.2%	74
Vh38Cl.5	119	3	VH3-13-10	8	8.2%	74
AL3.4	104	3	VH3-13-10	1	1.0%	117
FOG1-A3	115	3	VH3-13-19	2	2.0%	42
HA3D1	117	3	VH3-13-21	1	1.0%	81
E54 3.2	112	3	VH3-13-24	0	0.0%	26
mAb52	128	3	VH3-13-12	2	2.0%	51
mAb53	128	3	VH3-13-12	2	2.0%	51
mAb56	128	3	VH3-13-12	2	2.0%	51
mAb57	128	3	VH3-13-12	2	2.0%	51
mAb58	128	3	VH3-13-12	2	2.0%	51
mAb59	128	3	VH3-13-12	2	2.0%	51
mAb105	128	3	VH3-13-12	2	2.0%	51
mAb107	128	3	VH3-13-12	2	2.0%	51
E55 3.14	110	3	VH3-13-19	0	0.0%	26
F13-28	106	3	VH3-13-19	1	1.0%	94
mAb55	127	3	VH3-13-18	4	4.1%	51
YSE	117	3	VH3-13-24	6	6.1%	72
E55 3.23	106	3	VH3-13-19	2	2.0%	26
RF-TS5	101	3	VH3-13-1	3	3.1%	85
N42P5	124	3	VH3-13-2	7	7.1%	77
FOG1-H6	110	3	VH3-13-16	7	7.1%	42
O-81	115	3	VH3-13-19	11	11.2%	47
HIV-s8	122	3	VH3-13-12	11	11.2%	12
mAb114	125	3	VH3-13-19	12	12.2%	71
33.F12	116	3	VH3-13-2	4	4.1%	129
4B4	119	3	VH3-1X-3	0	0.0%	101
M26	123	3	VH3-1X-3	0	0.0%	103
VHGL 3.1	100	3	VH3-1X-3	0	0.0%	26
E55 3.13	113	3	VH3-1X-3	1	1.0%	26
SB5/D6	101	3	VH3-1X-6	3	3.0%	2
RAY4	101	3	VH3-1X-6	3	3.0%	2
82-D V-D	106	3	VH3-1X-3	5	5.0%	112
MAL	129	3	VH3-1X-3	5	5.0%	72
LOC	123	3	VH3-1X-6	5	5.0%	72
LSF2	101	3	VH3-1X-6	11	11.0%	2
HIB RC3	100	3	VH3-1X-6	11	11.0%	1
56 P1	119	3	VH3-13-7	0	0.0%	104
M72	122	3	VH3-13-7	0	0.0%	103
M74	121	3	VH3-13-7	0	0.0%	103
E54 3.5	105	3	VH3-13-7	0	0.0%	26
2E7	123	3	VH3-13-7	0	0.0%	63
2P1	117	3	VH3-13-7	0	0.0%	104
RF-SJ2	127	3	VH3-13-7	1	1.0%	83
PR-TS1	114	3	VH3-13-7	1	1.0%	85
KIM46H	127	3	VH3-13-13	0	0.0%	18
E55 3.6	108	3	VH3-13-7	2	2.0%	26
E55 3.10	107	3	VH3-13-13	1	1.0%	26
3.B6	114	3	VH3-13-13	1	1.0%	108
E54 3.6	110	3	VH3-13-13	1	1.0%	26
FL2-2	114	3	VH3-13-13	1	1.0%	80
RF-SJ3	112	3	VH3-13-7	2	2.0%	85
E55 3.5	105	3	VH3-13-14	1	1.0%	26
BSA3	121	3	VH3-13-13	1	1.0%	73
HMST-1	119	3	VH3-13-7	3	3.1%	130
RF-TS2	126	3	VH3-13-13	4	4.1%	82
E55 3.12	109	3	VH3-13-15	0	0.0%	26
19.E7	126	3	VH3-13-14	3	3.1%	129
11-50	119	3	VH3-13-13	6	6.1%	130
E29.1	120	3	VH3-13-15	2	2.0%	25
E55 3.16	108	3	VH3-13-7	6	6.1%	26
TNF-E1	117	3	VH3-13-7	7	7.1%	42
RF-SJ1	127	3	VH3-13-13	6	6.1%	83
FOG1-A4	116	3	VH3-13-7	8	8.2%	42
TNF-A1	117	3	VH3-13-15	4	4.1%	42
PR-SJ2	107	3	VH3-13-14	8	8.2%	85
HN.14	124	3	VH3-13-13	10	10.2%	33
CAM′	121	3	VH3-13-7	12	12.2%	65
HIV-B8	125	3	VH3-13-7	9	9.2%	12
HIV-b27	125	3	VH3-13-7	9	9.2%	12
HIV-b8	125	3	VH3-13-7	9	9.2%	12
HIV-s4	125	3	VH3-13-7	9	9.2%	12
HIV-B26	125	3	VH3-13-7	9	9.2%	12
HIV-B35	125	3	VH3-13-7	10	10.2%	12
HIV-b18	125	3	VH3-13-7	10	10.2%	12
HIV-b22	125	3	VH3-13-7	11	11.2%	12
HIV-b13	125	3	VH3-13-7	12	12.2%	12
333	117	3	VH3-14-4	24	24.0%	24
1H1	120	3	VH3-14-4	24	24.0%	24
1B11	120	3	VH3-14-4	23	23.0%	24
CLL30 2-3	86	3	VH3-13-19	1	1.0%	29
GA	110	3	VH3-13-7	19	19.4%	36
JeB	99	3	VH3-13-14	3	3.1%	7
GAL	110	3	VH3-13-19	10	10.2%	126
K6H6	119	3	VH3-1X-6	18	18.0%	60
K4B8	119	3	VH3-1X-6	18	18.0%	60
K5B8	119	3	VH3-1X-6	18	18.0%	60
K5C7	119	3	VH3-1X-6	19	19.0%	60
K5G5	119	3	VH3-1X-6	19	19.0%	60
K6F5	119	3	VH3-1X-6	19	19.0%	60
AL3.16	98	3	VH3-13-10	1	1.0%	117
N86P2	98	3	VH3-13-10	3	3.1%	77
N54P6	95	3	VH3-13-16	7	7.1%	77
LAMBDA	126	4	VH4-11-2	0	0.0%	3
HT112-1
HY18	121	4	VH4-11-2	0	0.0%	43
mAb63	126	4	VH4-11-2	0	0.0%	45
FS-3	105	4	VH4-11-2	0	0.0%	86
FS-5	111	4	VH4-11-2	0	0.0%	86
FS-7	107	4	VH4-11-2	0	0.0%	86
FS-8	110	4	VH4-11-2	0	0.0%	86
PR-TS2	105	4	VH4-11-2	0	0.0%	85
RF-TMC	102	4	VH4-11-2	0	0.0%	85
mAb216	122	4	VH4-11-2	1	1.0%	15
mAb410.7.F91	122	4	VH4-11-2	1	1.0%	52
mAbA6H4C5	124	4	VH4-11-2	1	1.0%	15
Ab44	127	4	VH4-11-2	2	2.1%	100
6H-3C4	124	4	VH4-11-2	3	3.1%	59
FS-6	108	4	VH4-11-2	6	6.2%	86
FS-2	114	4	VH4-11-2	6	6.2%	84
HIG1	126	4	VH4-11-2	7	7.2%	62
FS-4	105	4	VH4-11-2	8	8.2%	86
SA-4A	123	4	VH4-11-2	9	9.3%	125
LES-C	119	4	VH4-11-2	10	10.3%	99
DI	78	4	VH4-11-9	16	16.5%	58
Ab26	126	4	VH4-31-4	8	8.1%	100
TS2	124	4	VH4-31-12	15	15.2%	110
265-695	115	4	VH4-11-7	16	16.5%	5
WAH	129	4	VH4-31-13	19	19.2%	93
268-D	122	4	VH4-11-8	22	22.7%	6
58P2	118	4	VH4-11-8	0	0.0%	104
mAb67	128	4	VH4-21-4	1	1.0%	45
4.L39	115	4	VH4-11-8	2	2.1%	108
mF7	111	4	VH4-31-13	3	3.0%	75
33.C9	122	4	VH4-21-5	7	7.1%	129
Pag-1	124	4	VH4-11-16	5	5.2%	50
B3	123	4	VH4-21-3	8	8.2%	53
IC4	120	4	VH4-11-8	6	6.2%	70
C6B2	127	4	VH4-31-12	4	4.0%	48
N78	118	4	VH4-11-9	11	11.3%	77
B2	109	4	VH4-11-8	12	12.4%	53
WRD2	123	4	VH4-11-12	6	6.2%	90
mAb426.4.2F20	126	4	VH4-11-8	2	2.1%	52
E54 4.58	115	4	VH4-11-8	1	1.0%	26
WRD6	123	4	VH4-11-12	10	10.3%	90
mAb426.12.3F1.4	122	4	VH4-11-9	4	4.1%	52
E54 4.2	108	4	VH4-21-6	2	2.0%	26
WIL	127	4	VH4-31-13	0	0.0%	90
COF	126	4	VH4-31-13	0	0.0%	90
LAR	122	4	VH4-31-13	2	2.0%	90
WAT	125	4	VH4-31-13	4	4.0%	90
mAb61	123	4	VH4-31-13	5	5.1%	45
WAG	127	4	VH4-31-4	0	0.0%	90
RF-SJ4	108	4	VH4-31-12	2	2.0%	85
E54 4.4	110	4	VH4-11-7	0	0.0%	26
E55 4.A1	108	4	VH4-11-7	0	0.0%	26
PR-SJ1	103	4	VH4-11-7	1	1.0%	85
E54 4.23	111	4	VH4-11-7	1	1.0%	26
CLL7 7-2	97	4	VH4-11-12	0	0.0%	29
37P1	95	4	VH4-11-12	0	0.0%	104
ALL52 30-2	91	4	VH4-31-12	4	4.0%	29
EBV-21	98	5	VH5-12-1	0	0.0%	13
CB-4	98	5	VH5-12-1	0	0.0%	13
CLL-12	98	5	VH5-12-1	0	0.0%	13
L3-4	98	5	VH5-12-1	0	0.0%	13
CLL11	98	5	VH5-12-1	0	0.0%	17
CORD3	98	5	VH5-12-1	0	0.0%	17
CORD4	98	5	VH5-12-1	0	0.0%	17
CORD8	98	5	VH5-12-1	0	0.0%	17
CORD9	98	5	VHS-12-1	0	0.0%	17
CD+1	98	5	VH5-12-1	0	0.0%	17
CD+3	98	5	VH5-12-1	0	0.0%	17
CD+4	98	5	VH5-12-1	0	0.0%	17
CD-1	98	5	VH5-12-1	0	0.0%	17
CD-5	98	5	VH5-12-1	0	0.0%	17
VERG14	98	5	VH5-12-1	0	0.0%	17
PBL1	98	5	VH5-12-1	0	0.0%	17
PBL10	98	5	VH5-12-1	0	0.0%	17
STRAb SA-1A	127	5	VH5-12-1	0	0.0%	125
DOB′	122	5	VH5-12-1	0	0.0%	97
VERG5	98	5	VH5-12-1	0	0.0%	17
PBL2	98	5	VH5-12-1	1	1.0%	17
Tu16	119	5	VH5-12-1	1	1.0%	49
PBL12	98	5	VH5-12-1	1	1.0%	17
CD+2	98	5	VH5-12-1	1	1.0%	17
CORD10	98	5	VH5-12-1	1	1.0%	17
PBL9	98	5	VH5-12-1	1	1.0%	17
CORD2	98	5	VH5-12-1	2	2.0%	17
PBL6	98	5	VH5-12-1	2	2.0%	17
CORD5	98	5	VH5-12-1	2	2.0%	17
CD-2	98	5	VH5-12-1	2	2.0%	17
CORD1	98	5	VH5-12-1	2	2.0%	17
CD-3	98	5	VH5-12-1	3	3.1%	17
VERG4	98	5	VH5-12-1	3	3.1%	17
PBL13	98	5	VH5-12-1	3	3.1%	17
P8L7	98	5	VH5-12-1	3	3.1%	17
HAN	119	5	VH5-12-1	3	3.1%	97
VERG3	98	5	VH5-12-1	3	3.1%	17
PBL3	98	5	VH5-12-1	3	3.1%	17
VERG7	98	5	VH5-12-1	3	3.1%	17
PBL5	94	5	VH5-12-1	0	0.0%	17
CD-4	98	5	VH5-12-1	4	4.1%	17
CLL10	98	5	VH5-12-1	4	4.1%	17
PBL11	98	5	VH5-12-1	4	4.1%	17
CORD6	98	5	VH5-12-1	4	4.1%	17
VERG2	98	5	VH5-12-1	5	5.1%	17
83P2	119	5	VH5-12-1	0	0.0%	103
VERG9	98	5	VH5-12-1	6	6.1%	17
CLL6	98	5	VH5-12-1	6	6.1%	17
PBL8	98	5	VH5-12-1	7	7.1%	17
Ab2022	120	5	VH5-12-1	3	3.1%	100
CAV	127	5	VH5-12-4	0	0.0%	97
HOW′	120	5	VH5-12-4	0	0.0%	97
PET	127	5	VH5-12-4	0	0.0%	97
ANG	121	5	VH5-12-4	0	0.0%	97
KER	121	5	VH5-12-4	0	0.0%	97
5.M13	118	5	VH5-12-4	0	0.0%	107
Au2.1	118	5	VH5-12-4	1	1.0%	49
WS1	126	5	VH5-12-1	9	9.2%	110
TD Vn	98	5	VH5-12-4	1	1.0%	16
TEL13	116	5	VH5-12-1	9	9.2%	73
E55 5.237	112	5	VH5-12-4	2	2.0%	26
VERG1	98	5	VH5-12-1	10	10.2%	17
CD4-74	117	5	VH5-12-1	10	10.2%	42
257-D	125	5	VH5-12-1	11	11.2%	6
CLL4	98	5	VH5-12-1	11	11.2%	17
CLL8	98	5	VH5-12-1	11	11.2%	17
Ab2	124	5	VH5-12-1	12	12.2%	120
Vh383ex	98	5	VH5-12-1	12	12.2%	120
CLL3	98	5	VH5-12-2	11	11.2%	17
Au59.1	122	5	VH5-12-1	12	12.2%	49
TEL16	117	5	VH5-12-1	12	12.2%	73
M61	104	5	VH5-12-1	0	0.0%	103
TuO	99	5	VH5-12-1	5	5.1%	49
P2-51	122	5	VH5-12-1	13	13.3%	121
P2-54	122	5	VH5-12-1	11	11.2%	121
P1-56	119	5	VH5-12-1	9	9.2%	121
P2-53	122	5	VH5-12-1	10	10.2%	121
P1-51	123	5	VH5-12-1	19	19.4%	121
P1-54	123	5	VH5-12-1	3	3.1%	121
P3-69	127	5	VH5-12-1	4	4.1%	121
P3-9	119	5	VH5-12-1	4	4.1%	121
1-185-37	125	5	VH5-12-4	0	0.0%	124
1-187-29	125	5	VH5-12-4	0	0.0%	124
P1-58	128	5	VH5-12-4	10	10.2%	121
P2-57	118	5	VH5-12-4	3	3.1%	121
P2-55	123	5	VH5-12-1	5	5.1%	121
P2-56	123	5	VH5-12-1	20	20.4%	121
P2-52	122	5	VH5-12-1	11	11.2%	121
P3-60	122	5	VH5-12-1	8	8.2%	121
P1-57	123	5	VH5-12-1	4	4.1%	121
P1-55	122	5	VH5-12-1	14	14.3%	121
MD3-4	128	5	VH5-12-4	12	12.2%	5
P1-52	121	5	VH5-12-1	11	11.2%	121
CLL5	98	5	VH5-12-1	13	13.3%	17
CLL7	98	5	VH5-12-1	14	14.3%	17
L2F10	100	5	VH5-12-1	1	1.0%	46
L3B6	98	5	VH5-12-1	1	1.0%	46
VH6.A12	119	6	VH6-35-1	13	12.9%	122
s5A9	102	6	VH6-35-1	1	1.0%	46
s6G4	99	6	VH6-35-1	1	1.0%	46
ss3	99	6	VH6-35-1	1	1.0%	46
6-1G1	101	6	VH6-35-1	0	0.0%	14
F19L16	107	6	VH6-35-1	0	0.0%	68
L16	120	6	VH6-35-1	0	0.0%	69
M71	121	6	VH6-35-1	0	0.0%	103
ML1	120	6	VH6-35-1	0	0.0%	69
F19ML1	107	6	VH6-35-1	0	0.0%	68
15P1	127	6	VH6-35-1	0	0.0%	104
VH6.N1	121	6	VH6-35-1	0	0.0%	122
VH6.N11	123	6	VH6-35-1	0	0.0%	122
VH6.N12	123	6	VH6-35-1	0	0.0%	122
VH6.N2	125	6	VH6-35-1	0	0.0%	122
VH6.N5	125	6	VH6-35-1	0	0.0%	122
VH6.N6	127	6	VH6-35-1	0	0.0%	122
VH6.N7	126	6	VH6-35-1	0	0.0%	122
VH6.N8	123	6	VH6-35-1	0	0.0%	122
VH6.N9	123	6	VH6-35-1	0	0.0%	122
VH6.N10	123	6	VH6-35-1	0	0.0%	122
VH6.A3	123	6	VH6-35-1	0	0.0%	122
VH6.A1	124	6	VH6-35-1	0	0.0%	122
VH6.A4	120	6	VH6-35-1	0	0.0%	122
E55 6.16	116	6	VH6-35-1	0	0.0%	26
E55 6.17	120	6	VH6-35-1	0	0.0%	26
E55 6.6	120	6	VH6-35-1	0	0.0%	26
VHGL 6.3	102	6	VH6-35-1	0	0.0%	26
CB-201	118	6	VH6-35-1	0	0.0%	109
VH6.N4	122	6	VH6-35-1	0	0.0%	122
E54 6.4	109	6	VH6-35-1	1	1.0%	26
VH6.A6	126	6	VH6-35-1	1	1.0%	122
E55 6.14	120	6	VH6-35-1	1	1.0%	26
E54 6.6	107	6	VH6-35-1	1	1.0%	26
E55 6.10	112	6	VH6-35-1	1	1.0%	26
E54 6.1	107	6	VH6-35-1	2	2.0%	26
E55 6.13	120	6	VH6-35-1	2	2.0%	26
E55 6.3	120	6	VH6-35-1	2	2.0%	26
E55 6.7	116	6	VH6-35-1	2	2.0%	26
E55 6.2	120	6	VH6-35-1	2	2.0%	26
E55 6.X	111	6	VH6-35-1	2	2.0%	26
E55 6.11	111	6	VH6-35-1	3	3.0%	26
VH6.A11	118	6	VH6-35-1	3	3.0%	122
A10	107	6	VH6-35-1	3	3.0%	68
E55 6.1	120	6	VH6-35-1	4	4.0%	26
FK-001	124	6	VH6-35-1	4	4.0%	65
VH6.A5	121	6	VH6-35-1	4	4.0%	122
VH6.A7	123	6	VH6-35-1	4	4.0%	122
HBp2	119	6	VH6-35-1	4	4.0%	4
Au46.2	123	6	VH6-35-1	5	5.0%	49
A431	106	6	VH6-35-1	5	5.0%	68
VH6.A2	120	6	VH6-35-1	5	5.0%	122
VH6.A9	125	6	VH6-35-1	8	7.9%	122
VH6.A8	118	6	VH6-35-1	10	9.9%	122
VH6-FF3	118	6	VH6-35-1	2	2.0%	123
VH6.A10	126	6	VH6-35-1	12	11.9%	122
VH6-EB10	117	6	VH6-35-1	3	3.0%	123
VH6-E6	119	6	VH6-35-1	6	5.9%	123
VH6-FE2	121	6	VH6-35-1	6	5.9%	123
VH6-EE6	116	6	VH6-35-1	6	5.9%	123
VH6-FD10	118	6	VH6-35-1	6	5.9%	123
VH6-EX8	113	6	VH6-35-1	6	5.9%	123
VH6-FG9	121	6	VH6-35-1	8	7.9%	123
VH6-E5	116	6	VH6-35-1	9	8.9%	123
VH6-EC8	122	6	VH6-35-1	9	8.9%	123
VH6-E10	120	6	VH6-35-1	10	9.9%	123
VH6-FF11	122	6	VH6-35-1	11	10.9%	123
VH6-FD2	115	6	VH6-35-1	11	10.9%	123
CLL10 17-2	88	6	VH6-35-1	4	4.0%	29
VH6-BB11	94	6	VH6-35-1	4	4.0%	123
VH6-B41	93	6	VH6-35-1	7	6.9%	123
JU17	102	6	VH6-35-1	3	3.0%	114
VH6-BD9	96	6	VH6-35-1	11	10.9%	123
VH6-BB9	94	6	VH6-35-1	12	11.9%	123

TABLE 3A
assignment of rearrangee V kappa sequences to their germline counterparts
Family 1	Name	Rearranged 2	Sum
1	Vk1-1	28	119 entries
1	Vk1-2	0
1	Vk1-3	1
1	Vk1-4	0
1	Vk1-5	7
1	Vk1-6	0
1	Vk1-7	0
1	Vk1-8	2
1	Vk1-9	9
1	Vk1-10	0
1	Vk1-11
1	Vk1-12	7
1	Vk1-13
1	Vk1-14	7
1	Vk1-15	2
1	Vk1-16	2
1	Vk1-17	16
1	Vk1-18	1
1	Vk1-19	33
1	Vk1-20	1
1	Vk1-21	1
1	Vk1-22	0
1	Vk1-23	0
2	Vk2-1	0	25 entries
2	Vk2-2	1
2	Vk2-3	0
2	Vk2-4	0
2	Vk2-5	0
2	Vk2-6	16
2	Vk2-7	0
2	Vk2-8	0
2	Vk2-9	1
2	Vk2-10	0
2	Vk2-11	7
2	Vk2-12	0
3	Vk3-1	1	192 entries
3	Vk3-2	0
3	Vk3-3	35
3	Vk3-4	115
3	Vk3-5	0
3	Vk3-6	0
3	Vk3-7	1
3	Vk3-8	40
4	Vk4-1	33	33 entries
5	Vk5-1	1	1 entry
6	Vk6-1	0	0 entries
6	Vk6-2	0
7	Vk7-1	0	0 entries

TABLE 3B
assignment of
rearranged V lambda sequences to their germline counterparts
Family 1	Name	Rearranged 2	Sum
1	DPL1	1	42 entries
1	DPL2	14
1	DPL3	6
1	DPL4	1
1	HUMLV117	4
1	DPL5	13
1	DPL6	0
1	DPL7	0
1	DPL8	3
1	DPL9	0
2	DPL10	5	43 entries
2	VLAMBDA 2.1	0
2	DPL11	23
2	DPL12	15
2	DPL13	0
2	DPL14	0
3	DPL16	10	38 entries
3	DPL23	19
3	Humlv318	9
7	DPL18	1	1 entries
7	DPL19	0
8	DPL21	2	8 entries
8	HUMLV801	6
9	DPL22	0	0 entries
unassigned	DPL24	0	0 entries
10	gVLX-4.4	0	0 entries

TABLE 3C
assignment of rearranged V heavy chain sequences
to their germline counterparts
	Family 1	Name	Rearranged 2	Sum
	1	VH1-12-1	38
	1	VH1-12-8	2
	1	VH1-12-2	2
	1	VH1-12-9	2
	1	VH1-12-3	0
	1	VH1-12-4	0
	1	VH1-12-5	3
	1	VH1-12-6	0
	1	VH1-12-7	23
	1	VH1-13-1	1
	1	VH1-13-2	1
	1	VH1-13-3	0
	1	VH1-13-4	0
	1	VH1-13-5	0
	1	VH1-13-6	17
	1	VH1-13-7	0
	1	VH1-13-8	3
	1	VH1-13-9	0
	1	VH1-13-10	0
	1	VH1-13-11	0
	1	VH1-13-12	10
	1	VH1-13-13	0
	1	VH1-13-14	0
	1	VH1-13-15	4
	1	VH1-13-16	2
	1	VH1-13-17	0
	1	VH1-13-18	1
	1	VH1-13-19	0
	1	VH1-1X-1	1	110 entries
	2	VH2-21-1	0
	2	VH2-31-1	0
	2	VH2-31-2	1
	2	VH2-31-3	1
	2	VH2-31-4	0
	2	VH2-31-5	2
	2	VH2-31-6	0
	2	VH2-31-7	0
	2	VH2-31-14	1
	2	VH2-31-8	0
	2	VH2-31-9	0
	2	VH2-31-10	0
	2	VH2-31-11	1
	2	VH2-31-12	0
	2	VH2-31-13	1	7 entries
	3	VH3-11-1	0
	3	VH3-11-2	0
	3	VH3-11-3	5
	3	VH3-11-4	0
	3	VH3-11-5	1
	3	VH3-11-6	1
	3	VH3-11-7	0
	3	VH3-11-8	5
	3	VH3-13-1	9
	3	VH3-13-2	3
	3	VH3-13-3	0
	3	VH3-13-4	0
	3	VH3-13-5	0
	3	VH3-13-6	0
	3	VH3-13-7	32
	3	VH3-13-8	4
	3	VH3-13-9	0
	3	VH3-13-10	46
	3	VH3-13-11	0
	3	VH3-13-12	11
	3	VH3-13-13	17
	3	VH3-13-14	8
	3	VH3-13-15	4
	3	VH3-13-16	3
	3	VH3-13-17	2
	3	VH3-13-18	1
	3	VH3-13-19	13
	3	VH3-13-20	1
	3	VH3-13-21	1
	3	VH3-13-22	0
	3	VH3-13-23	0
	3	VH3-13-24	4
	3	VH3-13-25	1
	3	VH3-13-26	6
	3	VH3-14-1	1
	3	VH3-14-4	15
	3	VH3-14-2	0
	3	VH3-14-3	0
	3	VH3-1X-1	0
	3	VH3-1X-2	0
	3	VH3-1X-3	6
	3	VH3-1X-4	0
	3	VH3-1X-5	0
	3	VH3-1X-6	11
	3	VH3-1X-7	0
	3	VH3-1X-8	1
	3	VH3-1X-9	0	212 entries
	4	VH4-11-1	0
	4	VH4-11-2	20
	4	VH4-11-3	0
	4	VH4-11-4	0
	4	VH4-11-5	0
	4	VH4-11-6	0
	4	VH4-11-7	5
	4	VH4-11-8	7
	4	VH4-11-9	3
	4	VH4-11-10	0
	4	VH4-11-11	0
	4	VH4-11-12	4
	4	VH4-11-13	0
	4	VH4-11-14	0
	4	VH4-11-15	0
	4	VH4-11-16	1
	4	VH4-21-1	0
	4	VH4-21-2	0
	4	VH4-21-3	1
	4	VH4-21-4	1
	4	VH4-21-5	1
	4	VH4-21-6	1
	4	VH4-21-7	0
	4	VH4-21-8	0
	4	VH4-21-9	0
	4	VH4-31-1	0
	4	VH4-31-2	0
	4	VH4-31-3	0
	4	VH4-31-4	2
	4	VH4-31-5	0
	4	VH4-31-6	0
	4	VH4-31-7	0
	4	VH4-31-8	0
	4	VH4-31-9	0
	4	VH4-31-10	0
	4	VH4-31-11	0
	4	VH4-31-12	4
	4	VH4-31-13	7
	4	VH4-31-14	0
	4	VH4-31-15	0
	4	VH4-31-16	0
	4	VH4-31-17	0
	4	VH4-31-18	0
	4	VH4-31-19	0
	4	VH4-31-20	0	57 entries
	5	VH5-12-1	82
	5	VH5-12-2	1
	5	VH5-12-3	0
	5	VH5-12-4	14	97 entries
	6	VH6-35-1	74	74 entries

TABLE 4A
Analysis of V kappa subgroup 1
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16
A		1							1				102		1
B			1			1
C														1
D	64
E	8		14												1
F									1	6				1
G																105
H
I		65													4
K			1
L		6		21							96		1
M	1			66
N
P								103		1		2			1
Q			62			88					1
R
S							89		102	80		103		103
T		1			88					18
V		1	9								8		2		98
W
X	1
Y
—
unknown (?)
not sequenced	31	31	18	18	17	16	16	2	1
sum of seq 2	74	74	87	87	88	89	89	103	104	105	105	105	105	105	105	105
oomcaa 3	64	65	62	66	88	88	89	103	102	80	96	103	102	103	98	105
mcaa 4	D	I	Q	M	T	Q	S	P	S	S	L	S	A	S	V	G
rel. oomcaa 5	86%	88%	71%	76%	100%	99%	100%	100%	98%	76%	91%	98%	97%	98%	93%	100%
pos occupied 6	4	5	5	2	1	2	1	1	3	4	3	2	3	3	5	1
	Framework I	CDRI
amino acid 1	17	18	19	20	21	22	23	24	25	26	27	A	B	C	D
A			1	1		1			103
B											1
C							105
D	101
E	2							1	1		2
F					2
G										1
H											1
I			6	4	101	1
K								2			1
L								1
M
N										1
P
Q								20			100
R		94						81
S		5		1						102
T		6		99		103			1	1
V			98		2
W
X	1
Y	1
—												105	105	105	105
unknown (?)
not sequenced
sum of seq 2	105	105	105	105	105	105	105	105	105	105	105	105	105	105	105
oomcaa 3	101	94	98	99	101	103	105	81	103	102	100	105	105	105	105
mcaa 4	D	R	V	T	I	T	C	R	A	S	Q	—	—	—	—
rel. oomcaa 5	96%	90%	93%	94%	96%	98%	100%	77%	98%	97%	95%	100%	100%	100%	100%
pos occupied 6	4	3	3	4	3	3	1	5	3	4	5	1	1	1	1
	CDRI	Framework II
amino acid 1	E	F	28	29	30	31	32	33	34	35	36	37	38	39	40
A					1	1		1	42
B												1	1
C							1
D			25		1	5	7					1
E							1					2
F				1	1		7				6
G			25		7	3			4
H					1	2	2		1			2
I				98	1	4			1
K						7								95
L					2	1		101
M
N			6		16	42			50
P															102
Q												98	103	2
R					16	3	2							3	1
S			41	2	57	32	3	1	1						1
T			7			4			4					1
V			1	4	1			1
W							21			104
X									1
Y					1		60				98
—	105	105
unknown (?)														3
not sequenced						1	1	1	1	1	1	1	1	1	1
sum of seq 2	105	105	105	105	105	104	104	104	104	104	104	104	104	104	104
oomcaa 3	105	105	41	98	57	42	60	101	50	104	98	98	103	95	102
mcaa 4	—	—	S	I	S	N	Y	L	N	W	Y	Q	Q	K	P
rel. oomcaa 5	100%	100%	39%	93%	54%	40%	58%	97%	48%	100%	94%	94%	99%	91%	98%
pos occupied 6	1	1	6	4	12	11	9	4	8	1	2	5	2	4	3
	Framework II	CDR II
amino acid 1	41	42	43	44	45	46	47	48	49	50	51	52	53	54	55
A			94							50	95
B
C
D										21	1	1	1
E	1	3			1	1				1		1			33
F						1			3			1
G	100		1							9	2
H									2						1
I		1				1		100					1
K		95			86					16			2		5
L		1				89	103							101
M								2
N					10					2		1	25
P				104						1					1
Q		1			1										62
R					3	3							1	1	2
S					1				5	1	1	99	41	2
T		3			1					1	4	1	31
V			9			9					1		1
W
X					1								1
Y									92	1
—
unknown (?)	3
not sequenced	1	1	1	1	1	1	2	3	3	2	1	1	1	1	1
sum of seq 2	104	104	104	104	104	104	103	102	102	103	104	104	104	104	104
oomcaa 3	100	95	94	104	86	89	103	100	92	50	95	99	41	101	62
mcaa 4	G	K	A	P	K	L	L	I	Y	A	A	S	S	L	Q
rel. oomcaa 5	96%	91%	90%	100%	83%	86%	100%	98%	90%	49%	91%	95%	39%	97%	60%
pos occupied 6	2	6	3	1	8	6	1	2	4	10	6	6	9	3	6
	CDR	Framework III
	II
amino acid 1	56	57	58	59	60	61	62	63	64	65	66	67	68	69	70
A	3										2	1	1	1
B				1
C
D	1														67
E													1		30
F			1				103					3
G	2	105							105	4	101		102
H															3
I	3		4				1	3
K	1					1									1
L								1
M														1
N	6
P	1			101	2
Q										1
R	1					103		1		1	1			2
S	68			2	103			98		96		100
T	19			1		1		2		3				101
V			99				1								1
W
X			1								1		1		2
Y												1			1
—
unknown (?)
not sequenced
sum of seq 2	105	105	105	105	105	105	105	105	105	105	105	105	105	105	105
oomcaa 3	68	105	99	101	103	103	103	98	105	96	101	100	102	101	67
mcaa 4	S	G	V	P	S	R	F	S	G	S	G	S	G	T	D
rel. oomcaa 5	65%	100%	94%	96%	98%	98%	98%	93%	100%	91%	96%	95%	97%	96%	64%
pos occupied 6	10	1	4	4	2	3	3	5	1	5	4	4	4	4	7
	Framework III
amino acid 1	71	72	73	74	75	76	77	78	79	80	81	82	83	84	85
A		3				1				2				101	1
B					1				3		2
C
D						1					16	101
E											83
F	102	1	21										73
G							4				1			2
H
I					99	5							17
K
L			81					103	1				1
M															1
N						7	4								1
P										97					1
Q									97
R						2	1		2
S		2		1		86	94			4			1
T		98		102		2	1								97
V	1		2		4			1					11		1
W
X				1							1	2
Y	1
—
unknown (?)
not sequenced	1	1	1	1	1	1	1	1	2	2	2	2	2	2	3
sum of seq 2	104	104	104	104	104	104	104	104	103	103	103	103	103	103	102
oomcaa 3	102	98	81	102	99	86	94	103	97	97	83	101	73	101	97
mcaa 4	F	T	L	T	I	S	S	L	Q	P	E	D	F	A	T
rel. oomcaa 5	98%	94%	78%	98%	95%	83%	90%	99%	94%	94%	81%	98%	71%	98%	95%
pos occupied 6	3	4	3	3	3	7	5	2	4	3	5	2	5	2	6
	Framework III	CDR III
amino acid 1	86	87	88	89	90	91	92	93	94	95	A	B	C	D	E	F
A					1	7	1		5	1
B				2	3
C			102
D							23	5	1
E							1	1		1	1
F		7				3			13
G						1		1	2	1		1
H		1		4	6	7	3	1
I							4	1	2	1
K	1				7		1
L				7		6	2		18	2
M
N						6	31	19	1
P									1	82	6
Q				90	86	1	2
R						1		2	2
S	1					27	3	58	5	10
T						3	1	15	25
V									5
W									1
X
Y	101	93				42	32	1	23
—										3	82	88	89	89	89	89
unknown (?)		1
not sequenced	2	3	3	2	2	1	1	1	1	4	16	16	16	16	16	16
sum of seq 2	103	102	102	103	103	104	104	104	104	101	89	89	89	89	89	89
oomcaa 3	101	93	102	90	86	42	32	58	25	82	82	88	89	89	89	89
mcaa 4	Y	Y	C	Q	Q	Y	Y	S	T	P	—	—	—	—	—	—
rel. oomcaa 5	98%	91%	100%	87%	83%	40%	31%	56%	24%	81%	92%	99%	100%	100%	100%	100%
pos occupied 6	3	3	1	4	5	11	12	10	14	8	3	2	1	1	1	1
	CDR III	Framework IV
amino acid 1	96	97	98	99	100	101	102	103	104	105	106	A	107	108	sum
A	1														627
B					1					1					19
C															209
D	1									15					459
E					2					65					258
F	6		86								2				451
G				87	29	87								2	894
H	2	1													40
I	5								1		72				606
K	1	1						77					79		480
L	18	1	1						22	4	2				793
M		1									5				77
N	1										1		2		232
P	6				7									1	620
Q	1				48					1					865
R	6							6					2	70	413
S	2	2													1636
T	2	82					87	3					2		1021
V	2							1	63		3				440
W	15														141
X															14
Y	16														564
—	4	1										85		1	1250
unknown (?)															7
not sequenced	16	16	18	18	18	18	18	18	19	19	20	20	20	31	589
sum of seq 2	89	89	87	87	87	87	87	87	86	86	85	85	85	74
oomcaa 3	18	82	86	87	48	87	87	77	63	65	72	85	79	70
mcaa 4	L	T	F	G	G	G	T	K	V	E	I	—	K	R
rel. oomcaa 5	20%	92%	99%	100%	55%	100%	100%	89%	73%	76%	85%	100%	93%	95%
pos occupied 6	17	7	2	1	5	1	1	4	3	5	6	1	4	4

TABLE 4B
Analysis of V kappa subgroup 2
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18
A
B
C
D	14
E	3																15
F									1	1
G																22
H
I		8
K
L		3		1					17		18				6
M				15
N
P								18				18			15			22
Q						18											7
R
S							18			17
T					17									21
V		6	17	1									18
W
X
Y
—
unknown (?)					1
not sequenced	5	5	5	5	4	4	4	4	4	4	4	4	4	1	1
sum of seq 2	17	17	17	17	18	18	18	18	18	18	18	18	18	21	21	22	22	22
oomcaa 3	14	8	17	15	17	18	18	18	17	17	18	18	18	21	15	22	15	22
mcaa 4	D	I	V	M	T	Q	S	P	L	S	L	P	V	T	P	G	E	P
rel. oomcaa 5	82%	47%	100%	88%	94%	100%	100%	100%	94%	94%	100%	100%	100%	100%	71%	100%	68%	100%
pos occupied 6	2	3	1	3	1	1	1	1	2	2	1	1	1	1	2	1	2	1
	Framework I	CDRI
amino acid 1	19	20	21	22	23	24	25	26	27	A	B	C	D	E	F	28	29	30
A	22
B
C					22
D													1			9		1
E
F																		2
G														1			22
H													16
I			22
K						1
L									1		22	13
M												1
N																10		7
P
Q				1					21
R						21								2
S		22		21			22	22		22				19		1
T
V												8
W													1
X																1		1
Y													4			1		11
—															22
unknown (?)
not sequenced
sum of seq 2	22	22	22	22	22	22	22	22	22	22	22	22	22	22	22	22	22	22
oomcaa 3	22	22	22	21	22	21	22	22	21	22	22	13	16	19	22	10	22	11
mcaa 4	A	S	I	S	C	R	S	S	Q	S	L	L	H	S	—	N	G	Y
rel. oomcaa 5	100%	100%	100%	95%	100%	95%	100%	100%	95%	100%	100%	59%	73%	86%	100%	45%	100%	50%
pos occupied 6	1	1	1	2	1	2	1	1	2	1	1	3	4	3	1	5	1	5
	CDRI		Framework II
amino acid 1	31	32	33	34	35	36	37	38	39	40	41	42	43	44	45	46	47
A
B
C
D	1			11
E															1
F						7
G											22
H		1		1
I																1
K	1								15
L			22				16									14	21
M
N	12			9
P										22				21
Q							6	22				22			12
R									7						8	7
S													21
T	8
V																	1
W					22
X				1
Y		21				15
—
unknown (?)
not sequenced													1	1	1
sum of seq 2	22	22	22	22	22	22	22	22	22	22	22	22	21	21	21	22	22
oomcaa 3	12	21	22	11	22	15	16	22	15	22	22	22	21	21	12	14	21
mcaa 4	N	Y	L	D	W	Y	L	Q	K	P	G	Q	S	P	Q	L	L
rel. oomcaa 5	55%	95%	100%	50%	100%	68%	73%	100%	68%	100%	100%	100%	100%	100%	57	64%	95%
pos occupied 6	4	2	1	4	1	2	2	1	2	1	1	1	1	1	3	3	2
	Frame-
	work II	CDR II	Framework III
amino acid 1	48	49	50	51	52	53	54	55	56	57	58	59	60	61	62	63	64	65
A								14
B
C
D								7					22				1
E
F															21
G				12				1		22							21
H
I	22
K			5
L			14	1
M
N						18
P												22
Q			1
R			1				22							20				1
S				2	22	2			22					1		22		21
T						1								1
V				6							22				1
W
X
Y		21				1
—
unknown (?)
not sequenced		1	1	1
sum of seq 2	22	21	21	21	22	22	22	22	22	22	22	22	22	22	22	22	22	22
oomcaa 3	22	21	14	12	22	18	22	14	22	22	22	22	22	20	21	22	21	21
mcaa 4	I	Y	L	G	S	N	R	A	S	G	V	P	D	R	F	S	G	S
rel. oomcaa 5	100%	100%	67%	57%	100%	82%	100%	64%	100%	100%	100%	100%	100%	91%	95%	100%	95%	95%
pos occupied 6	1	1	4	4	1	4	1	3	1	1	1	1	1	3	2	1	2	2
	Framework III
amino acid 1	66	67	68	69	70	71	72	73	74	75	76	77	78	79	80	81	82	83
A															20
B
C
D			1		22											1	21
E														19		20
F						22
G	22		21											1
H
I									1	21
K									19
L								21	1
M
N
P															1
Q														1
R												20
S		22									20	1
T				22			21				1
V													21					21
W
X
Y
—
unknown (?)							1
not sequenced								1	1	1	1	1	1	1	1	1	1	1
sum of seq 2	22	22	22	22	22	22	22	21	21	21	21	21	21	21	21	21	21	21
oomcaa 3	22	22	21	22	22	22	21	21	19	21	20	20	21	19	20	20	21	21
mcaa 4	G	S	G	T	D	F	T	L	K	I	S	R	V	E	A	E	D	V
rel. oomcaa 5	100%	100%	95%	100%	100%	100%	95%	100%	90%	100%	95%	95%	100%	90%	95%	95%	100%	100%
pos occupied 6	1	1	2	1	1	1	1	1	3	1	2	2	1	3	2	2	1	1
	Framework III	CDR III
amino acid 1	84	85	86	87	88	89	90	91	92	93	94	95	A	B	C	D	E	F
A								14			1
B							1			1
C					21
D
E
F
G	21							6			1		2
H								1		7
I		1									1
K									12			2
L		1				21
M
N
P											2	16	1
Q							20			13
R									1
S											3	2
T									8		7
V		19
W											6
X
Y			21	21
—													14	17	17	17	17	17
unknown (?)
not sequenced	1	1	1	1	1	1	1	1	1	1	1	2	5	5	5	5	5	5
sum of seq 2	21	21	21	21	21	21	21	21	21	21	21	20	17	17	17	17	17	17
oomcaa 3	21	19	21	21	21	21	20	14	12	13	7	16	14	17	17	17	17	17
mcaa 4	G	V	Y	Y	C	M	Q	A	L	Q	T	P	—	—	—	—	—	—
rel. oomcaa 5	100%	90%	100%	100%	100%	100%	95%	67%	57%	62%	33%	80%	82%	100%	100%	100%	100%	100%
pos occupied 6	1	3	1	1	1	1	2	3	3	3	7	3	3	1	1	1	1	1
	Framework III	Framework IV
amino acid 1	96	97	98	99	100	101	102	103	104	105	106	A	107	108	sum
A															71
B										1					3
C															43
D															112
E										13					71
F	1		17												72
G				17	2	16				1					233
H															26
I	3										14				94
K								12					13		66
L	2								11						219
M															37
N															56
P	1														159
Q	1				14										159
R								4						12	126
S															325
T		17					16								140
V									5						146
W	2														31
X															3
Y	7														123
—												13			134
unknown (?)															2
not sequenced	5	5	5	5	6	6	6	6	6	7	8	9	9	10	211
sum of seq 2	17	17	17	17	16	16	16	16	16	15	14	13	13	12
oomcaa 3	7	17	17	17	14	16	16	12	11	13	14	13	13	12
mcaa 4	Y	T	F	G	Q	G	T	K	L	E	I	—	K	R
rel. oomcaa 5	41%	100%	100%	100%	88%	100%	100%	75%	69%	87%	100%	100%	100%	100%
pos occupied 6	7	1	1	1	2	1	1	2	2	3	1	1	1	1

TABLE 4C
Analysis of V kappa subgroup 3
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16
A		5					2		27						1
B	1
C												2
D	2								14
E	76		27
F		1												1
G	1								82						1	152
H										1
I		75
K	3
L		4	1	104			1				150		129		1
M	5			13
N														5
P								124							147
Q						123
R					1
S							119		3	1		150	1	141
T		2			117					147				5	1
V		1	89	1			1				1		22		1
W
X
Y
—
unknown (?)
not sequenced
sum of seq 2	88	88	117	118	118	123	123	124	126	149	151	152	152	152	152	152
oomcaa 3	76	75	89	104	117	123	119	124	82	147	150	150	129	141	147	152
mcaa 4	E	I	V	L	T	Q	S	P	G	T	L	S	L	S	P	G
rel. oomcaa 5	86%	85%	76%	88%	99%	100%	97%	100%	65%	99%	99%	99%	85%	93%	97%	100%
pos occupied 6	6	6	3	3	2	1	4	1	4	3	2	2	3	4	6	1
	Framework I	CDR I
amino acid 1	17	18	19	20	21	22	23	24	25	26	27	A	B	C	D	E
A			178	2					166	1
B
C							181			1
D	6
E	146	1									1
F					7	1
G	1	1							1	1		1
H											17
I		1		5	2
K		1						5
L					173						1	1
M
N												9
P
Q											159
R		175						176		1	1	10
S						180			7	175		87
T		1		174					7	2		1
V		1	4	1					1			1
W								1
X
Y						1					1
—												72	182	182	182	182
unknown (?)											1
not sequenced
sum of seq 2	153	181	182	182	182	182	181	182	182	181	181	182	182	182	182	182
oomcaa 3	146	175	178	174	173	180	181	176	166	175	159	87	182	182	182	182
mcaa 4	E	R	A	T	L	S	C	R	A	S	Q	S	—	—	—	—
rel. oomcaa 5	95%	97%	98%	96%	95%	99%	100%	97%	91%	97%	88%	48%	100%	100%	100%	100%
pos occupied 6	3	7	2	4	3	3	1	3	5	5	6	8	1	1	1	1
	CDR I	Framework II
amino acid 1	F	28	29	30	31	32	33	34	35	36	37	38	39	40	41	42
A				1	1			181
B
C
D			1	1	2	1
E						1							1			1
F		1				7				1
G			2	7	3	1		2						1	184
H			1			2			1		12	1	1
I		24	4	1	1
K				1	1								153
L		8	1			1	176					3				2
M
N			3	12	25	32
P					1									170
Q					1	1					183	167	1			181
R			10	3	18	16		1			1		27	5
S		72	86	151	118	4								5
T		1	1	3	8	1							1
V		76	68		1		7					3		2
W			5						185
X
Y				1	1	115				183
—	182
unknown (?)											1
not sequenced
sum of seq 2	182	182	182	181	181	182	183	184	185	185	185	185	184	184	184	184
oomcaa 3	182	76	86	151	118	115	186	181	185	183	183	167	153	170	184	181
mcaa 4	—	V	S	S	S	Y	L	A	W	Y	Q	Q	K	P	G	Q
rel. oomcaa 5	100%	42%	47%	83%	65%	63%	96%	98%	100%	99%	99%	90%	83%	92%	100%	98%
pos occupied 6	1	6	11	10	13	12	2	3	1	10 3	2	4	6	6	1	3
			Framework
	Framework II	CDR II	III
amino acid 1	43	44	45	46	47	48	49	50	51	52	53	54	55	56	57	58
A	176							4	147				176	1
B
C									1
D								43					2		4
E
F				1		1	4
G								125					2	10	179
H							9		1
I						178								1		168
K			1								7	1
L		1		179	174	1
M						3					1
N			1					1			53			2
P	5	184								2			2	2
Q							1
R			182					1			4	180
S							3	6	4	179	74	1		5
T	3								11	2	44			164		2
V				3	9			3	19				3			15
W							1					1
X
Y							165								2
—
unknown (?)			1
not sequenced
sum of seq 2	184	185	185	183	183	183	183	183	183	183	183	183	185	185	185	185
oomcaa 3	176	184	182	179	174	178	165	125	147	179	74	180	176	164	179	168
mcaa 4	A	P	R	L	L	I	Y	G	A	S	S	R	A	T	G	I
re. oomcaa 5	96%	99%	98%	98%	95%	97%	90%	68%	80%	98%	40%	98%	95%	89%	97%	91%
pos occupied 6	3	2	3	3	2	4	6	7	6	3	6	4	5	7	3	3
	Framework III
amino acid 1	59	60	61	62	63	64	65	66	67	68	69	70	71	72	73	74
A		68						3		5	3	1		3
B
C
D		112				1						152
E								1		1		30
F				183									183		2
G						184	3	178		177
H		1
I				1										1		3
K			1
L				1											182
M								1
N		1												1
P	177
Q												1
R			182		2		1				2
S	7				180		179		185		3			7		2
T	1		2		3		2				177			172		179
V		3						1		1
W										1
X
Y													1
—
unknown (?)								1
not sequenced
sum of seq 2	185	185	185	185	185	185	185	185	185	185	185	184	184	184	184	184
oomcaa 3	117	112	182	183	180	184	179	178	185	177	177	152	183	172	182	179
mcaa 4	P	D	R	F	S	F	S	G	S	G	T	D	F	T	L	T
rel. oomcaa 5	96%	61%	98%	99%	97%	99%	97%	96%	100%	96%	96%	83%	99%	93%	99%	97%
pos occupied 6	3	5	3	3	3	2	4	5	1	5	4	4	2	5	2	3
	Framework III	CDR III
amino acid 1	75	76	77	78	79	80	81	82	83	84	85	86	87	88	89	90
A							3			174
B					1
C									2				1	182
D			1				3	182
E					149		175									2
F		1							178		2	1	4
G			3					1		2
H											1				1	7
I	178							1	1		9
K							1
L				178		1			1		7		1			1
M										1	5
N	1	5
P						149
Q					34									1	181	155
R		1	111							3						1
S		169	65			34			1				2
T		8	4							1						8
V	4			6					1	3	159					7
W
X
Y	1										1	183	176		1	2
—
unknown (?)
not sequenced
sum of seq 2	184	184	184	184	184	184	182	184	184	184	184	184	184	183	183	183
oomcaa 3	178	169	111	178	149	149	175	182	178	174	159	183	176	182	181	155
mcaa 4	I	S	R	L	E	P	E	D	F	A	V	Y	Y	C	Q	Q
rel. oomcaa 5	97%	92%	60%	97%	81%	96%	99%	97%	95%	86%	99%	96%	99%	99%	85%
pos occupied 6	4	5	5	2	3	3	4	3	6	6	7	2	5	2	3	8
	CDR III	Framework IV
amino acid 1	91	92	93	94	95	A	B	C	D	E	F	96	97	98	99	100
A		1	8	3	3											1
B
C	2			1								2
D		8	5										1
E		2										1
F	5		2									7		166
G	1	104	15		1	1	2					1			166	41
H	4	1										2
I			1			1						4
K			2			1						1				1
L				2	7	5						42
M		1			1	2
N		28	71									1
P				1	139	24						7	2			9
Q	1		1		3	1						3				114
R	34	2	3		2	2						19
S	2	33	58	102	15	2						1	8
T		2	13	1	1	2						1	154
V					3	1						2
W				69								24
X
Y	134	1	1									43
—			3	3	7	127	167	169	169	169	169	8	1	1	1	1
unknown (?)
not sequenced						14	14	14	14	14	14	14	17	16	16	16
sum of seq 2	183	183	183	182	182	169	169	169	169	169	169	169	166	167	167	167
oomcaa 3	134	104	71	102	139	127	167	169	169	169	169	43	154	166	166	114
mcaa 4	Y	G	N	S	P	—	—	—	—	—	—	Y	T	F	G	Q
rel. oomcaa 5	73%	57%	39%	56%	76%	75%	99	100%	100%	100%	100%	25%	93%	99%	99%	68%
pos occupied 6	8	11	13	8	11	12	2	1	1	1	1	18	5	2	2	6
	Framework IV
amino acid 1	101	102	103	104	105	106	A	107	108	sum
A										1345
B										2
C										375
D					23					564
E			3		141					759
F						6				765
G	166								1	1804
H					1					64
I						143				803
K			152					157		489
L				54		1			2	1596
M						3				36
N		1						3		255
P		1		1						1147
Q			1		1					1314
R			9			2		4	134	1326
S		2								2629
T		162	1					1		1593
V				111		11				646
W										287
X
Y			1							1014
—	1	1	1	1	1	1	166	1	1	2151
unknown (?)										4
not sequenced	16	16	15	16	16	16	17	17	45	337
sum of seq 2	167	167	168	167	167	167	166	166	138
oomcaa 3	166	162	152	111	141	143	166	157	134
mcaa 4	G	T	K	V	E	I	—	K	R
rel. oomcaa 5	99%	97%	90%	66%	84%	86%	100%	95%	97%
pos occupied 6	2	5	7	4	5	7	1	5	4

TABLE 4D
Analysis of V kappa subgroup 4
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18
A												24					1
B
C										1						1
D	25								26
E																	25
F
G												1				24
H
I		26
K						1
L				1							26				26
M				24
N	1
P								26				1
Q			1			25
R																		26
S							26			25				26		1
T					26
V			25	1									26
W
X
Y
—
unknown (?)
not sequenced	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7
sum of seq 2	26	26	26	26	26	26	26	26	26	26	26	26	26	26	26	26	26	26
oomcaa 3	25	26	25	24	26	25	26	26	26	25	26	24	26	26	26	24	25	26
mcaa 4	D	I	V	M	T	Q	S	P	D	S	L	A	V	S	L	G	E	R
rel. oomcaa 5	96%	100%	96%	92%	100%	96%	100%	100%	100%	96%	100%	92%	100%	100%	100%	92%	96%	100%
pos occupied 6	2	1	2	3	1	2	1	1	1	2	1	3	1	1	1	3	2	1
	Framework I	CDR I
amino acid 1	18	20	21	22	23	24	25	26	27	A	B	C	D	E	F	28	29	30
A	26						1				1
B
C					33
D											1		1			1
E
F
G
H
I			26								1
K						33										2		30
L											2	31
M
N				26												30	31	1
P							1								1
Q									32									1
R									1								1	1
S							31	33		33				32	32		1
T		26												1
V											28	2
W
X
Y													32
—
unknown (?)
not sequenced	7	7	7	7
sum of seq 2	26	26	26	26	33	33	33	33	33	33	33	33	33	33	33	33	33	33
oomcaa 3	26	26	26	26	33	33	31	33	32	33	28	31	32	32	32	30	31	30
mcaa 4	A	T	I	N	C	K	S	S	Q	S	V	L	Y	S	S	N	N	K
rel. oomcaa 5	100%	100%	100%	100%	100%	100%	94%	100%	97%	100%	85%	94%	97%	97%	97%	91%	94%	91%
pos occupied 6	1	1	1	1	1	1	3	1	2	1	5	2	2	2	2	3	3	4
	CDR I	Framework II
amino acid 1	31	32	33	34	35	36	37	38	39	40	41	42	43	44	45	46	47	48
A				32						2
B
C
D
E											1
F
G											32
H						2
I																		32
K									33						32
L			33													29	33
M																		1
N	33
P										31			31	33
Q							32	33				32
R							1					1			1
S													2
T				1
V																4
W					33
X
Y		33				31
—
unknown (?)
not sequenced
sum of seq 2	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33
oomcaa 3	33	33	33	32	33	31	32	33	33	31	32	32	31	33	32	29	33	32
mcaa 4	N	Y	L	A	W	Y	Q	Q	K	P	G	Q	P	P	K	L	L	I
rel. oomcaa 5	100%	100%	100%	97%	100%	94%	97%	100%	100%	94%	97%	97%	94%	100%	97%	98%	100%	97%
pos occupied 6	1	1	1	2	1	2	2	1	1	2	2	2	2	1	2	2	1	2
	Frame-
	work II	CDR II	Framework III
amino acid 1	49	50	51	52	53	54	55	56	57	58	59	60	61	62	63	64	65	66
A			30
B
C
D												33
E							32
F														33
G									33						1	33		33
H
I					1
K
L
M
N					2
P				1							33		1
Q
R						33							32
S			1	31	1			33							32		33
T			2	1	29
V							1			33
W		33
X
Y	33
—
unknown (?)
not sequenced
sum of seq 2	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33
oomcaa 3	33	33	30	31	29	33	32	33	33	33	33	33	32	33	32	33	33	33
mcaa 4	Y	W	A	S	T	R	E	S	G	V	P	D	R	F	S	G	S	G
rel. oomcaa 5	100%	100%	91%	94%	98%	100%	97%	100%	100%	100%	100%	100%	97%	100%	97%	100%	100%	100%
pos occupied 6	1	1	3	3	4	1	2	1	1	1	1	1	2	1	2	1	1	1
	Framework III
amino acid 1	67	68	69	70	71	72	73	74	75	76	77	78	79	80	81	82	83	84
A														33				32
B
C
D				32												33
E															33
F					32
G		33		1														1
H
I									33
K
L							33					32
M												1
N										2	1
P
Q													32
R													1
S	33									30	32
T			33			33		33		1
V					1												33
W
X
Y
—
unknown (?)
not sequenced
sum of seq 2	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33	33
oomcaa 3	33	33	33	32	32	33	33	33	33	30	32	32	32	33	33	33	33	32
mcaa 4	S	G	T	D	F	R	L	T	I	S	S	L	Q	A	E	D	V	A
rel. oomcaa 5	100%	100%	100%	97%	97%	100%	100%	100%	100%	91%	97%	97%	97%	100%	100%	100%	100%	97%
pos occupied 6	1	1	1	2	2	1	1	1	1	3	2	2	2	1	1	1	1	2
	Framework III	CDR III
amino acid 1	85	86	87	88	89	90	91	92	93	94	95	A	B	C	D	E	F	96
A										1
B
C				33
D								1	1
E
F			1					1
G									2
H			1		3
I										2
K
L						1		2		1	3							1
M
N									4	4
P										1	29	1						4
Q					30	32					1							1
R									1			1						2
S							2		23	2								1
T									2	22
V	33
W																		2
X
Y		33	31				31	29										1
—												13	15	15	15	15	15	3
unknown (?)
not sequenced												18	18	18	18	18	18	18
sum of seq 2	33	33	33	33	33	33	33	33	33	33	33	15	15	15	15	15	15	15
oomcaa 3	33	33	31	33	30	32	31	29	23	22	29	13	15	15	15	15	15	4
mcaa 4	V	Y	Y	X	Q	Q	Y	Y	S	T	P	—	—	—	—	—	—	P
rel. oomcaa 5	100%	100%	94%	100%	91%	97%	94%	98%	70%	67%	88%	87%	100%	100%	100%	100%	100%	27%
pos occupied 6	1	1	3	1	2	2	2	4	6	7	3	3	1	1	1	1	1	8
	CDR III	Framework IV
	amino acid 1	97	98	99	100	101	102	103	104	105	106	A	107	108	sum
	A														183
	B
	C														68
	D														154
	E									14					105
	F		15												82
	G			15	4	15									228
	H														6
	I										14				135
	K							14					13		158
	L								4						258
	M	1													27
	N												1		136
	P						1								195
	Q				11				1						264
	R							1		1			1	11	116
	S	2									1				499
	T	12					14								236
	V								9						196
	W								1						69
	X
	Y														254
	—											15			106
	unknown (?)
	not sequenced	18	18	18	18	18	18	18	18	18	18	18	18	22	518
	sum of seq 2	15	15	15	15	15	15	15	15	15	15	15	15	11
	oomcaa 3	12	15	15	11	15	14	14	9	14	14	15	13	11
	mcaa 4	T	F	G	Q	G	R	K	V	E	I	—	K	R
	rel. oomcaa 5	80%	100%	100%	73%	100%	93%	93%	60%	93%	93%	100%	87%	100%
	pos occupied 6	3	1	1	2	1	2	2	4	2	2	1	3	1

TABLE 5A
Analysis of V lambda subgroup 1
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12
A											19
B
C
D
E
F
G
H	2
I			1								1
K
L			1	41							1
M
N
P							41	41
Q	22		1			41
R
S		39							41			41
T					41
V		1	38								20
W
X
Y
Z	16
—										41
unknown (?)
not sequenced	2	2	1	1	1	1	1	1	1	1	1	1
sum of seq 2	40	40	41	41	41	41	41	41	41	41	41	41
oomcaa 3	22	39	38	41	41	41	41	41	41	41	20	41
mcaa 4	Q	S	V	L	T	Q	P	P	S	—	V	S
rel. oomcaa 5	55%	98%	93%	100%	100%	100%	100%	100%	100%	100%	49%	100%
pos occupied 6	3	2	4	1	1	1	1	1	1	1	4	1
	Framework I
amino acid 1	13	14	15	16	17	18	19	20	21	22	23
A	18	20						2
B
C											42
D
E						1
F
G	22			42
H
I								1	41
K						14
L									1
M
N
P		1	41
Q					42
R						25
S			1			1		1		42
T		19				1		38
V	1	1					42
W
X
Y
Z
—
unknown (?)
not sequenced	1	1
sum of seq 2	41	41	42	42	42	42	42	42	42	42	42
oomcaa 3	22	20	41	42	42	25	42	38	41	42	42
mcaa 4	G	A	P	G	Q	R	V	T	I	S	C
rel. oomcaa 5	54%	49%	98%	100%	100%	60%	100%	90%	98%	100%	100%
pos occupied 6	3	4	2	1	1	5	1	4	2	1	1
	CDRI
amino acid 1	24	25	26	27	D	E	28	29	30	31	A	32	33	34
A				1				2	2			1
B
C
D						3			3	1		3		1
E									1
F	1				1						1	1
G		42	3	1			2	39	4	2
H										2		2		2
I						1	37							1
K						1			1
L							1
M							1
N				2	1	37			13	31	2		1	9
P												1
Q												1
R			1	1					5
S	38		34	34	38				13	1	1	3		19
T	3		4	3	2			1		1		7		2
V							1					2	40
W
X
Y										4	1	20		7
Z
—											36
unknown (?)
not sequenced											1	1	1	1
sum of seq 2	42	42	42	42	42	42	42	42	42	42	41	41	41	41
oomcaa 3	38	42	34	34	38	37	37	39	13	31	36	20	40	19
mcaa 4	S	G	S	S	S	N	I	G	N	N	—	Y	V	S
rel. oomcaa 5	90%	100%	81%	81%	90%	88%	88%	93%	31%	74%	88%	49%	98%	46%
pos occupied 6	3	1	4	6	4	4	5	3	8	7	5	10	2	7
	Framework II
amino acid 1	35	36	37	38	39	40	41	42	43	44	45	46	47	48	49
A								4	40
B
C
D							1
E											2
F		1			4										1
G							39
H		1	1	6	1										1
I														40
K								1			35
L				1	31							41	40
M								1						1
N											1
P						42	1			42
Q			39	34
R			2		1		1				4
S									1
T								36	1
V				1	5							1	2	1
W	42
X
Y		40													40
Z
—
unknown (?)
not sequenced
sum of seq 2	42	42	42	42	42	42	42	42	42	42	42	42	42	42	42
oomcaa 3	42	40	39	34	31	42	39	36	40	42	35	41	40	40	40
mcaa 4	W	Y	Q	Q	L	P	G	T	A	P	K	L	L	I	Y
rel. oomcaa 5	100%	95%	93%	81%	74%	100%	93%	86%	95%	100%	83%	98%	95%	95%	95%
pos occupied 6	1	3	3	4	5	1	4	4	3	1	4	2	2	3	3
	CDR II
amino acid 1	50	51	52	53	54	55	56	A	B	C	D	E
A			1			1
B
C
D	13	10	8
E	5			1
F
G	1
H				1
I	1
K	1	1		18
L				1	1		1
M				1
N	3	28	30	2
P						38
Q				15
R	7			2	40
S	9	2	3	1		2	40
T	1
V
W					1
X
Y	1	1
Z
—								41	41	41	41	42
unknown (?)
not sequenced						1	1
sum of seq 2	42	42	42	42	42	41	41	41	41	41	41	42
oomcaa 3	13	28	30	18	40	38	40	41	41	41	41	42
mcaa 4	D	N	N	K	R	P	S	—	—	—	—	—
rel. oomcaa 5	31%	67%	71%	43%	95%	93%	98%	100%	100%	100%	100%	100%
pos occupied 6	10	5	4	9	3	3	2	1	1	1	1	1
	Framework III
amino acid 1	57	58	59	60	61	62	63	64	65	66	A	B	67	68	69	70	71
A								5						1	3		41
B
C
D				38										1
E
F						38
G	41			2				36						40
H				1
I		17				3
K										38
L			1
M
N
P			38
Q
R					42					4
S			2				42		42				42		1	42
T								1							38
V		24				1											1
W
X
Y
Z
—											42	42
unknown (?)
not sequenced	1	1	1	1
sum of seq 2	41	41	41	41	42	42	42	42	42	42	42	42	42	42	42	42	42
oomcaa 3	41	24	38	38	42	38	42	36	42	38	42	42	42	40	38	42	41
mcaa 4	G	V	P	D	R	F	S	G	S	K	—	—	S	G	T	S	A
rel. oomcaa 5	100%	59%	93%	93%	100%	90%	100%	86%	100%	90%	100%	100%	100%	95%	90%	100%	98%
pos occupied 6	1	2	3	3	1	3	1	3	1	2	1	1	1	3	3	1	2
	Framework III
amino acid 1	72	73	74	75	76	77	78	79	80	81	82	83	84	85	86	87	88
A			24						2				38	1
B
C																	42
D										1	41			37
E								1		24		42		1
F																2
G			17		1	42				15
H								1						2		1
I				41										1
K
L		42					41
M
N											1
P									2
Q								31
R								8
S	24				20				20				1
T	18				21				17				3
V			1	1			1		1
W								1		2
X
Y															42	39
Z
—
unknown (?)
not sequenced
sum of seq 2	42	42	42	42	42	42	42	42	42	42	42	42	42	42	42	42	42
oomcaa 3	24	42	24	41	21	42	41	31	20	24	41	42	38	37	42	39	42
mcaa 4	S	L	A	I	T	G	L	Q	S	E	D	E	A	D	Y	Y	C
rel. oomcaa 5	57%	100%	57%	98%	50%	100%	98%	74%	48%	57%	98%	100%	90%	88%	100%	93%	100%
pos occupied 6	2	1	3	2	3	1	2	5	5	4	2	1	3	5	1	3	1
	CDR III
amino acid 1	89	90	91	92	93	94	95	A	B	C	D	E	F	96
A	22	15			1				16					4
B
C
D				39	17			7
E									1					1
F							1
G	14				1				17	1				5
H										1
I								1
K								1
L	1						37			1
M
N				2	2			9	1
P							1							6
Q	3
R						5	1	2						2
S		4			17	35		18		1				1
T		22			1	1		1
V	1				1		1		2					9
W			38											7
X
Y			3		1									3
Z
—								2	4	35	39	38	38	1
unknown (?)
not sequenced	1	1	1	1	1	1	1	1	1	3	3	3	3	3
sum of seq 2	41	41	41	41	41	41	41	41	41	39	39	38	38	39
oomcaa 3	22	22	38	39	17	35	37	18	17	35	39	38	38	9
mcaa 4	A	T	W	D	D	S	L	S	G	—	—	—	—	V
rel. oomcaa 5	54%	54%	93%	95%	41%	85%	90%	44%	41%	90%	100%	100%	100%	23%
pos occupied 6	5	3	2	2	8	3	5	8	6	5	1	1	1	10
	Framework IV
amino acid 1	97	98	99	100	101	102	103	104	105	106	A	107	108	sum
A	1													285
B
C														84
D														224
E				1										81
F		36												87
G	1		36	31	36							26		559
H														25
I	1													188
K							30							141
L	1							25			34			344
M	1													5
N							1							176
P													1	296
Q							3				1		18	251
R							1					2		156
S				1								2		720
T				3		36	1		36					359
V	34							11		36	1			282
W												1		92
X
Y														202
Z														16
—														524
unknown (?)
not sequenced	3	4	4	6	6	6	6	6	6	6	6	10	22	141
sum of seq 2	39	36	36	36	36	36	36	36	36	36	36	31	19
oomcaa 3	34	36	36	31	36	36	30	25	36	36	34	26	18
mcaa 4	V	F	G	G	G	T	K	L	T	V	L	G	Q
rel. oomcaa 5	87%	100%	100%	86%	100%	100%	83%	69%	100%	100%	94%	84%	95%
pos occupied 6	6	1	1	4	1	1	5	2	1	1	3	4	2

TABLE 5B
Analysis of V lambda subgroup 2
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12
A			35					30			6
B
C
D
E
F
G
H	2
I			1
K
L				40
M
N
P							42	6
Q	22		4			41
R								6	1
S		41							40			42
T					42				1
V		1	2								36
W
X
Y
Z	16
—										42
unknown (?)						1
not sequenced	3	1	1	3	1	1	1	1	1	1	1	1
sum of seq 2	40	42	42	40	42	42	42	42	42	42	42	42
oomcaa 3	22	41	35	40	42	41	42	30	40	42	36	42
mcaa 4	Q	S	A	L	T	Q	P	A	S	—	V	S
rel. oomcaa 5	55%	98%	83%	100%	100%	98%	100%	71%	95%	100%	86%	100%
pos occupied 6	3	2	4	1	1	1	1	3	3	1	2	1
	Framework I
amino acid 1	13	14	15	16	17	18	19	20	21	22	23
A	1	1
B
C											42
D				1
E
F									1
G	42			42
H					1
I							28		41
K
L			3				1		1
M
N
P			40
Q					42
R
S		42				43				42
T								43
V							14
W
X
Y
Z
—
unknown (?)
not sequenced										1	1
sum of seq 2	43	43	43	43	43	43	43	43	43	42	42
oomcaa 3	42	42	40	42	42	43	28	43	41	42	42
mcaa 4	G	S	P	G	Q	S	I	T	I	S	C
rel. oomcaa 5	98%	98%	93%	98%	98%	100%	65%	100%	95%	100%	100%
pos occupied 6	2	2	2	2	2	1	3	1	3	1	1
	CDRI
amino acid 1	24	25	26	27	D	E	28	29	30	31	A	32	33	34
A	3		1						1			1
B
C					1					1
D						39		1	4		5
E											1
F									1			4
G		43		1				39	26
H				1							1	1
I	1						6
K											4
L												4
M
N				1	3	4		1	4	3	28
P				1
Q
R					1				2
S	3		3	35	38				5	1	2	4	1	42
T	36		39	3				1		1
V							37						41
W
X
Y				1				1		37		29
Z
—											1
unknown (?)											1
not sequenced													1	1
sum of seq 2	43	43	43	43	43	43	43	43	43	43	43	43	42	42
oomcaa 3	36	43	39	35	38	39	37	39	26	37	28	29	41	42
mcaa 4	T	G	T	S	S	D	V	G	G	Y	N	Y	V	S
rel. oomcaa 5	84%	100%	91%	81%	88%	91%	86%	91%	60%	86%	65%	67%	98%	100%
pos occupied 6	4	1	3	7	4	2	2	5	7	5	7	6	2	1
	Framework II
amino acid 1	35	36	37	38	39	40	41	42	43	44	45	46	47	48	49
A						1	4		40
B
C
D					1		2
E
F		2													7
G							36
H				2	34
I								1				1	9	43
K								40			41
L				1	1							38	6
M													26
N					2
P						41				43
Q			41	39							2
R			1					1
S						1									2
T								1
V							1		3			4	2
W	43
X
Y		41			5										34
Z
—
unknown (?)			1	1
not sequenced
sum of seq 2	43	43	43	43	43	43	43	43	43	43	43	43	43	43	43
oomcaa 3	43	41	41	39	34	41	36	40	40	43	41	38	26	43	34
mcaa 4	W	Y	Q	Q	H	P	G	K	A	P	K	L	M	I	Y
rel. oomcaa 5	100%	95%	95%	91%	79%	95%	84%	93%	93%	100%	95%	88%	60%	100%	79%
pos occupied 6	1	2	2	3	5	3	4	4	2	1	2	3	4	1	3
	CDR II
amino acid 1	50	51	52	53	54	55	56	A	B	C	D	E
A
B
C
D	20	1	2	1
E	20			2
F		1
G	2	2		1
H				1
I			1
K			1	21
L
M			1
N	1		8	12
P						43
Q
R			2		43
S			21	3			43
T			7
V		39
W
X
Y				2
Z
—								43	43	43	43	43
unknown (?)
not sequenced
sum of seq 2	43	43	43	43	43	43	43	43	43	43	43	43
oomcaa 3	20	39	21	21	43	43	43	43	43	43	43	43
mcaa 4	D	V	S	K	R	P	S	—	—	—	—	—
rel. oomcaa 5	47%	91%	49%	49%	100%	100%	100%	100%	100%	100%	100%	100%
pos occupied 6	4	4	8	8	1	1	1	1	1	1	1	1
	Framework III
amino acid 1	57	58	59	60	61	62	63	64	65	66	A	B	67	68	69	70	71
A								2						3		1	43
B
C									1
D				17										1	2
E
F						42
G	43	1						41						39
H				2
I		3
K										42					1
L				1		1
M
N				19											38
P			15
Q
R					43					1
S			28	2			43		42				42			1
T															1	41
V		39
W
X
Y				2
Z
—											43	43
unknown (?)															1
not sequenced													1
sum of seq 2	43	43	43	43	43	43	43	43	43	43	43	43	42	43	43	43	43
oomcaa 3	43	39	28	19	43	42	43	41	42	42	43	43	42	39	38	41	43
mcaa 4	G	V	S	N	R	F	S	G	S	K	—	—	S	G	N	T	A
rel. oomcaa 5	100%	91%	65%	44%	100%	98%	100%	95%	98%	98%	100%	100%	100%	91%	88%	95%	100%
pos occupied 6	1	3	2	6	1	2	1	2	2	2	1	1	1	3	4	3	1
	Framework III
amino acid 1	72	73	74	75	76	77	78	79	80	81	82	83	84	85	86	87	88
A									36				43
B
C																	43
D										3	42			39
E						1				38		43
F																3
G						42				1
H														2
I				35
K
L		43					43
M
N										1	1			1
P									2
Q								41
R								2
S	43				42											1
T			43		1				2
V				8					3
W
X
Y															43	39
Z
—
unknown (?)														1
not sequenced
sum of seq 2	43	43	43	43	43	43	43	43	43	43	43	43	43	43	43	43	43
oomcaa 3	43	43	43	35	42	42	43	41	36	38	42	43	43	39	43	39	43
mcaa 4	S	L	T	I	S	G	L	Q	A	E	D	E	A	D	Y	Y	C
rel. oomcaa 5	100%	100%	100%	81%	98%	98%	100%	95%	84%	88%	98%	100%	100%	91%	100%	91%	100%
pos occupied 6	1	1	1	2	2	2	1	2	4	4	2	1	1	3	1	3	1
	CDR III
amino acid 1	89	90	91	92	93	94	95	A	B	C	D	E	F	96
A	2	1		21		1								1
B
C	11
D					3	1	2							1
E				1	1
F			3				1		1					5
G				1	21	3	4							1
H			1
I				1	1		1	2						1
K							3
L									1	1				6
M														1
N						5	7	5						1
P					1				4
Q							1	2
R				2		3			1					5
S	30	41			12	23	14	9						1
T				16	4	4	3	21
V				1										11
W														5
X
Y			39			1	6							4
Z
—							1	3	36	42	43	43	43
unknown (?)						2
not sequenced		1						1
sum of seq 2	43	42	43	43	43	43	43	42	43	43	43	43	43	43
oomcaa 3	30	41	39	21	21	23	14	21	36	42	43	43	43	11
mcaa 4	S	S	Y	A	G	S	S	T	—	—	—	—	—	V
rel. oomcaa 5	70%	98%	91%	49%	49%	53%	33%	50%	84%	98%	100%	100%	100%	26%
pos occupied 6	3	2	3	7	7	8	11	6	5	2	1	1	1	13
	Framework IV
amino acid 1	97	98	99	100	101	102	103	104	105	106	A	107	108	sum
A	1			1										280
B
C														99
D														188
E														107
F		42												113
G			42	33	42							19		567
H														48
I	7								1					184
K							36							189
L	5							28			40			264
M	1													29
N							1							146
P														238
Q							1						14	250
R				1			2					4		121
S									1			2		831
T				7		41			40					398
V	28							14		42	1			327
W														48
X
Y							1							285
Z														16
—														555
unknown (?)														8
not sequenced	1	1	1	1	1	2	2	1	1	1	2	15	28	80
sum of seq 2	42	42	42	42	42	41	41	42	42	42	41	25	14
oomcaa 3	28	42	42	33	42	41	36	28	40	42	40	19	14
mcaa 4	V	F	G	G	G	T	K	L	T	V	L	G	Q
rel. oomcaa 5	67%	100%	100%	79%	100%	100%	88%	67%	95%	100%	98%	76%	100%
pos occupied 6	5	1	1	4	1	1	5	2	3	1	2	3	1

TABLE 5C
Analysis of V lambda subgroup 3
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19
A					1		1	2	7					20	1				27
B
C
D			5				10
E			20										1			1
F	1	1										1			1
G			1													37
H
I
K																	2
L				37							4		1		9
M
N
P							26	35	1						27				1
Q	4		4			38											36
R
S	13	14			1		1		28			37		18
T					36			1										38
V			8	1					2		34		36						10
W
X
Y		23
Z
—
unknown (?)
not
sequenced
sum of seq 2	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38
oomcaa 3	20	23	20	37	36	38	26	35	28	28	34	37	36	20	27	37	36	38	27
mcaa 4	—	Y	E	L	T	Q	P	P	S	—	V	S	V	A	P	G	Q	T	A
rel. oomcaa 5	53%	61%	53%	97%	95%	100%	68%	92%	74%	100%	89%	97%	95%	53%	71%	97%	95%	100%	71%
pos	4	3	5	2	3	1	4	3	4	1	2	2	3	2	4	2	2	1	3
occupied 6
			Frame-
			work
	Framework I	CDR I	II
amino	20	21	22	23	24	25	26	27	D	E	28	29	30	31	A	32	33	34	35
acid 1
A			1					5					1	1			21	3
B
C				38														5
D							30	1					10			3		1
E							2	2				1	3	6
F														1		2
G					9	38		1				23	4
H							1									2		9
I		38									9			1
K								7					2	13
L											28
M	1													1
N			2				4	9			1		2			1		2
P			1									3
Q					10									4
R	25							2				10	1				1
S	9		1		19			10					11	2		8		14
T	3		33					1				1	4
V																1	15
W																			38
X
Y							1							8		20	1	4
Z
—									38	38					37
unknown
(?)
not															1	1
sequenced
sum of	38	38	38	38	38	38	38	38	38	38	38	38	38	37	37	37	38	38	38
seq 2
oomcaa 3	25	38	33	38	19	38	30	10	38	38	28	23	11	13	37	20	21	14	38
mcaa 4	R	I	T	C	S	G	D	S	—	—	L	G	S	K	—	Y	A	S	W
rel.	66%	100%	87%	100%	50%	100%	79%	26%	100%	100%	74%	61%	29%	35%	100%	54%	55%	37%	100%
oomcaa 5
pos	4	1	5	1	3	1	5	9	1	1	3	5	9	9	1	7	4	7	1
occupied 6
	Framework II	CDR II
amino acid 1	36	37	38	39	40	41	42	43	44	45	46	47	48	49	50	51	52	53	54
A								23								1		1
B
C
D															9	22	2	8
E			1												5	3		3
F	3													2			1
G						36									9	2
H							1							1	3			1
I										1			28				1
K				32											2	6	1	13
L			2							6	33	1
M											1		1
N																1	19	9
P					36		1		38
Q		37	35	1			36								9			1
R		1		4		2									1	1		1	38
S				1	2			14									10	1
T																2	4
V								1		31	4	37	9
W
X
Y	35													35
Z
—
unknown (?)
not
sequenced
sum of seq 2	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38
oomcaa 3	35	37	35	32	36	36	36	23	38	31	33	37	28	35	9	22	19	13	38
mcaa 4	Y	Q	Q	K	P	G	Q	A	P	V	L	V	I	Y	D	D	N	K	R
rel. oomcaa 5	92%	97%	92%	84%	95%	95%	95%	61%	100%	82%	87%	97%	74%	92%	24%	58%	50%	34%	100%
pos	2	2	3	4	2	2	3	3	1	3	3	2	3	3	7	8	7	9	1
occupied 6
	CDR II	Framework III
amino acid 1	55	56	A	B	C	D	E	57	58	59	60	61	62	63	64	65	66	A	B
A		1
B
C
D											9
E											27
F													38
G								38							38
H
I									37
K
L
M
N																	21
P	37	1								36
Q
R												38
S	1	36								1				38		38	12
T																	5
V
W
X
Y
Z
—			38	38	38	38	38											38	38
unknown (?)											1
not									1	1	1
sequenced
sum of seq 2	38	38	38	38	38	38	38	38	37	37	37	38	38	38	38	38	38	38	38
oomcaa 3	37	36	38	38	38	38	38	38	37	36	27	38	38	38	38	38	21	38	38
mcaa 4	P	S	—	—	—	—	—	G	I	P	E	R	F	S	G	S	N	—	—
rel. oomcaa 5	97%	95%	100%	100%	100%	100%	100%	100%	100%	97%	73%	100%	100%	100%	100%	100%	55%	100%	100%
pos	2	3	1	1	1	1	1	1	1	2	2	1	1	1	1	1	3	1	1
occupied 6
	Framework III
amino acid 1	67	68	69	70	71	72	73	74	75	76	77	78	79	80	81	82	83	84	85
A				1	36	1		1				11	1	34				38
B
C
D																38			37
E													10		14		38		1
F
G		37									28				10
H			1
I						1		1	37	1					1
K			1
L							38								2
M															10
N			28							1
P
Q		1											25
R										1	10		1
S	37		2			11				23				1
T	1		6	37		25		36		12		13		2
V					2				1			14	1	1	1
W
X
Y
Z
—
unknown (?)
not
sequenced
sum of seq 2	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38	38
oomcaa 3	37	37	28	37	36	25	38	36	37	23	28	14	25	34	14	38	38	38	37
mcaa 4	S	G	N	T	A	T	L	T	I	S	G	V	Q	A	E	D	E	A	D
rel. oomcaa 5	97	97	74	97	95	66	100	95	97	61	74	37	66	89	37	100	100	100	97
pos	2	2	5	2	2	4	1	3	2	5	2	3	5	4	6	1	1	1	2
occupied 6
			Framework
	Framework III	CDR III	IV
amino acid 1	86	87	88	89	90	91	92	93	94	95	A	B	C	D	E	F	96	97	98
A					13	3	2			1	2						4
B
C			38
D							32	1	1		6
E				1								2					2
F		2						2											35
G									3	14	3			1			3	1
H												12	1
I																		4
K											1
L				1				1		1		1	1				4	2
M									1								1	1
N				10			2	1	2		10	1
P									1				3				1
Q				25						1	1
R						10		1	2			2
S				1	14	1		28	26	13		1				1
T						1		3		7	2
V					11												18	28
W						23											1
X
Y	38	36					1		1		1	3	1				3
Z
—											10	15	31	36	37	36		1
unknown (?)
not							1	1	1	1	2	1	1	1	1	1	1	1	3
sequenced
sum of seq 2	38	38	38	38	38	38	37	37	37	37	36	37	37	37	37	37	37	37	35
oomcaa 3	38	36	38	25	14	23	32	28	26	14	10	15	31	36	37	36	18	28	35
mcaa 4	Y	Y	C	Q	S	W	D	S	S	G	N	—	—	—	—	—	V	V	F
rel. oomcaa 5	100%	95%	100%	66%	37%	61%	86%	76%	70%	38%	28%	41%	84%	97%	100%	97%	49%	76%	100%
pos	1	2	1	5	3	5	4	7	8	6	9	8	5	2	1	2	9	6	1
occupied 6
	Framework IV
amino acid 1	99	100	101	102	103	104	105	106	A	107	108	sum
A												265
B
C										1		82
D												225
E					2							145
F												90
G	35	31	35							24		461
H												32
I												160
K					30							110
L						28			33			233
M												17
N												126
P									1			249
Q											7	275
R					2							154
S										2		501
T		4		35			35					347
V						7		35				308
W												62
X
Y												211
Z
—												603
unknown (?)												1
not	3	3	3	3	4	3	3	3	4	11	28	89
sequenced
sum of seq 2	35	35	35	35	34	35	35	35	34	27	7
oomcaa 3	35	31	35	35	30	28	35	35	33	24	7
mcaa 4	G	G	G	T	K	L	T	V	L	G	Q
rel. oomcaa 5	100%	89%	100%	100%	88%	80%	100%	100%	97%	89%	100%
pos	1	2	1	1	3	2	1	1	2	3	1
occupied 6

TABLE 6A
Analysis of V heavy chain subgroup 1A
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	20
A					1	14			60							24	1
B
C
D
E	1				2	1		2		64
F
G								58	1						64
H			2
I		2
K		2										57	64						60
L			2	59							3
M		1
N												6
P														63
Q	53		56		2	45
R												1							3
S							60		3					1		40	63
T																			1
V	2	55		1	55						61							64		64
W
X
Y
Z	3
—
unknown (?)
not sequenced	11	10	10	10	10	10	10	10	6	6	6	6	6	6	6	6	6	6	6	6
sum of seq 2	59	60	60	60	60	60	60	60	64	64	64	64	64	64	64	64	64	64	64	64
oomcaa 3	53	55	56	59	55	45	60	58	60	64	61	57	64	63	64	40	63	64	60	64
mcaa 4	Q	V	Q	L	V	Q	S	G	A	E	V	K	K	P	G	S	S	V	K	V
rel. oomcaa 5	90	92	93	98	92	75	100	97	94	100	95	89	100	98	100	63	98	100	94	100
	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%
pos occupied 6	4	4	3	2	4	3	1	2	3	1	2	3	1	2	1	2	2	1	3	1
			Framework
	Framework I	CDR I	II
amino acid 1	21	22	23	24	25	26	27	28	29	30	31	A	B	32	33	34	35	36	37	38
A				62				1							41
B
C		63
D							1
E
F									69					3		3
G				1		69	41		1						23
H										1				1			1
I								1								61	1		1
K			63							1	1
L															1	2
M																4
N										2	5						4
P															1
Q
R		1	1							1	1									70
S	63				68		1			40	60			2			60
T	1			2				68		25	3				3		4
V															1				69
W																		70
X
Y							27							64
Z
—												70	70
unknown (?)
not sequenced	6	6	6	5	2	1
sum of seq 2	64	64	64	65	68	69	70	70	70	70	70	70	70	70	70	70	70	70	70	70
oomcaa 3	63	63	63	62	68	69	41	68	69	40	60	70	70	64	41	61	60	70	69	70
mcaa 4	S	C	K	A	S	G	G	T	F	S	S	—	—	Y	A	I	S	W	V	R
rel. oomcaa 5	98	98	98	95	100	100	59	97	99	57	86	100	100	91	59	87	86	100	99	100
	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%
pos occupied 6	2	2	2	3	1	1	4	3	2	6	5	1	1	4	6	4	5	1	2	1
	Framework II	CDR II
amino acid 1	39	40	41	42	43	44	45	46	47	48	49	50	51	52	A	B	C	53	54	55
A		70									1				5
B
C
D								1
E								69
F													2					3	39
G			1	68		69			1		69	39			1					68
H			1
I													65	38				34
K
L				1			68			1		1						2	4
M										67				2				4
N														4				3	22
P			68				1								44
Q	69				69													1	1	1
R	1			1		1						4						1
S					1				1	1				22					1	1
T													1	2	4			1	3
V										1			2	2	16			1
W							1		67			26
X
Y									1									20
Z
—																70	70
unknown (?)
not sequenced
sum of seq 2	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70
oomcaa 3	69	70	68	68	69	69	68	69	67	67	69	39	65	38	44	70	70	34	39	68
mcaa 4	Q	A	P	G	Q	G	L	E	W	M	G	G	I	I	P	—	—	I	F	G
rel. oomcaa 5	99	100	97	97	99	99	97	99	96	96	99	56	93	54	63	100	100	49	56	97
	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%
pos occupied 6	2	1	3	3	2	2	3	2	4	4	2	4	4	6	5	1	1	10	6	3
	CDR II	Framework III
amino acid 1	56	57	58	59	60	61	62	63	64	65	66	67	68	69	70	71	72	73	74	75
A	1	34			69											43
B
C
D	15		1							2							70
E									1									33
F				1				48				3		4
G	1						3			67
H			1
I	4												1	44				1
K	1		2	1			47		1		1							8
L	1	1						22				2		1		3
M														21
N	9		59				18
P	1	7
Q	1	1				70			64
R	2						2		1		69							1
S		1	2		1										5				70
T	34	26	4						3				66		65	24		27		67
V										1		65	3							3
W
X
Y			1	68
Z
—
unknown (?)
not sequenced
sum of seq 2	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70
oomcaa 3	34	34	59	68	69	70	47	48	64	67	69	65	66	44	65	43	70	33	70	67
mcaa 4	T	A	N	Y	A	Q	K	F	Q	G	R	V	T	I	T	A	D	E	S	T
rel. oomcaa 5	49	49	84	97	99	100	67	69	91	96	99	93	94	63	93	61	100	47	100	96
	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%
pos occupied 6	11	6	7	3	2	1	4	2	5	3	2	3	3	4	2	3	1	5	1	2
	Framework III
amino acid 1	76	77	78	79	80	81	82	A	B	C	83	84	85	86	87	88	89	90	91	92
A			64			1						3			1	70
B
C																				70
D						2							26	70
E						64							44
F																	1	1	2
G									1
H				1				1
I		1					3	1	1								2
K											3
L					3		63			70							2
M					67										1		1
N	4							1	16
P
Q				1		3
R	3							23	1		62
S	62		1					41	49			67			1
T	1	69	2					3	2		4				67
V			3				4				1						64
W
X
Y				68														69	68
Z
—
unknown (?)
not sequenced
sum of seq 2	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70	70
oomcaa 3	62	69	64	68	67	64	63	41	49	70	62	67	44	70	67	70	64	69	68	70
mcaa 4	S	T	A	T	M	E	L	S	S	L	R	S	E	D	T	A	V	Y	Y	C
rel. oomcaa 5	89	99	91	97	96	91	90	59	70	100	89	96	63	100	96	100	91	99	97	100
	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%
pos occupied 6	4	2	4	3	2	4	3	6	6	1	4	2	2	1	4	1	5	2	2	1
	CDR III
amino acid 1	93	94	95	96	97	98	99	100	A	B	C	D	E	F	G	H	I	J	K	101
A	66	2	16		1	1	1	4	1	2	2	1	1		1	1	1	2		1
B
C					1	1	16	2		1	1	7	2	1
D			16	5	3		3	5	4	3	4			1	1	14				59
E			9				2			1			1			1
F					1	3		2		3	1	2		2	1				28	2
G		2	14	13	20	10	14	5	20	15	16	3	3	4	15	1	1	7
H										1	1	1		1
I				2	5	2	2		2	2	1	1			1
K		5			2	1			1
L		1	4	4	2	5	2	1	1		4	2		1			1		1
M			1		2		1		1			1	1						10
N				2	2	1	2	1	2	2	2	2			1	1	4
P				20	3		1	3	2	2	2	4	2	1	4	1		1		1
Q				1			1		1	1	1
R		55	1	5	7	8	1	4		2		1		16
S		1	1	5	5	5	5	21	5	11	8	4	3		2	1		2		1
T	1	3	3	5	4	1	3	4	2	5	2		1			1	1
V	3		3	2	4	3	3	3	4	2	2	2	1	2	1
W				1	1	3	1	1			2		3				1	5	1
X
Y		1		2	3	20	5	4	9	1	2	11	20	10	6	9	10	7	1
Z
—				1	2	2	3	6	11	11	14	23	26	26	31	34	46	39	21	1
unknown (?)													1		1	1		2	3
not sequenced			2	2	2	4	4	4	4	5	5	5	5	5	5	5	5	5	5	5
sum of seq 2	70	70	68	68	68	66	66	66	66	65	65	65	65	65	65	65	65	65	65	65
oomcaa 3	66	55	16	20	20	20	16	21	20	15	16	23	26	26	31	34	46	39	28	59
mcaa 4	A	R	A	P	G	Y	C	S	G	—	—	—	—	—	—	—	—	—	F	D
rel. oomcaa 5	94	79	24	29	29	30	24	32	30	23	25	35	40	40	48	52	71	60	43	91
	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%	%
pos occupied 6	3	8	10	14	18	15	18	15	15	17	17	15	12	11	11	10	8	7	6	6
	Framework IV
amino acid 1	102	103	104	105	106	107	108	109	110	111	112	113	sum
A													670
B
C													165
D		1	1										308
E	1	1											297
F	2												226
G			58		59	1	1						928
H				1									14
I	3								4				286
K				3		1							325
L	3			1			40	1					386
M	1						3						189
N				1									176
P	5											1	238
Q				52									494
R				1									351
S											53	51	972
T						54	11	1	51		1		736
V	15		1				1	54		54		1	599
W		59		1									243
X
Y	34		1										542
Z													3
—	1												578
unknown (?)													8
not sequenced	5	9	9	10	11	14	14	14	15	16	16	17	406
sum of seq 2	65	61	61	60	59	56	56	56	55	54	54	53
oomcaa 3	34	59	58	52	59	54	40	54	51	54	53	51
mcaa 4	Y	W	G	Q	G	T	L	V	T	V	S	S
rel. oomcaa 5	52%	97%	95%	87%	100%	96%	71%	96%	93%	100%	98%	96%
pos occupied 6	9	3	4	7	1	3	5	3	2	1	2	3

TABLE 6B
Analysis of V heavy chain subgroup 1B
amino	Framework I
acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	20	21	22	23	24	25	26	27	28	29	30
A									32							34								30
B
C																						35
D
E		1			5	1				35													3
F																											2		39
G								27							35									1		40				1
H			1											1
I																				1								1		1
K		3	1									34	33						33				28
L			3	26	1																								1
M				1	1
N																											1			1
P									1					33			1
Q	21		20			26																	2
R	1											1	2										2					2
S							27									1	34				35				40			5		2
T									1					1					2					3				32		34
V	3	21			20						35							35		34				1			1			1
W
X
Y																											36
Z
—
unknown
(?)
not	15	15	15	13	13	13	13	13	6	5	5	5	5	5	5	5	5	5	5	5	5	5	5	5
sequenced
sum of	25	25	25	27	27	27	27	27	34	35	35	35	35	35	35	35	35	35	35	35	35	35	35	35	40	40	40	40	40	40
seq 2
oomcaa 3	21	21	20	26	20	26	27	27	32	35	35	34	33	33	35	34	34	35	33	34	35	35	28	30	40	40	36	32	39	34
mcaa 4	Q	V	Q	L	V	Q	S	G	A	E	V	K	K	P	G	A	S	V	K	V	S	C	K	A	S	G	Y	T	F	T
rel.	84%	84%	80%	96%	74%	96%	100%	100%	94%	100%	100%	97%	94%	94%	100%	97%	97%	100%	94%	97%	100%	100%	80%	86%	100%	100%	90%	80%	98%	85%
oomcaa 5
pos.	3	3	4	2	4	2	1	1	3	1	1	2	2	3	1	2	2	1	2	2	1	1	4	4	1	1	4	4	2	6
occupied 6
amino	CDRI	Framework II
acid 1	31	A	B	32	33	34	35	36	37	38	39	40	41	42	43	44	45	46	47	48	49	50
A	2				6							39				1					1
B
C
D	1				5		1			1
E	1													1				39
F				2	2												2
G	14				1					1				39		28					39	1
H				3	1		34
I						9														3
K															1
L	1					5			2				1				37
M						23														37		2
N	3					1	3
P					1							1	34				1
Q	1				1		1			1	39				39			1
R				1						37	1					10						4
S	15			2	1								1			1
T					1								4
V	1				2	2			38
W								40											40			33
X
Y	1			32	19		1
Z
—		40	40
unknown
(?)
not
sequenced
sum of	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40
seq 2
oomcaa 3	15	40	40	32	19	23	34	40	38	37	39	39	34	39	39	28	37	39	40	37	39	33
mcaa 4	S	—	—	Y	Y	M	H	W	V	R	Q	A	P	G	Q	G	L	E	W	M	G	W
rel.	38%	100%	100%	810%	48%	58%	85%	100%	95%	93%	98%	98%	85%	98%	98%	70%	93%	98%	100%	93%	98%	83%
oomcaa 5
pos.	10	1	1	5	11	5	5	1	2	4	2	2	4	2	2	4	3	2	1	2	2	4
occupied 6
amino	CDR II
acid 1	51	52	A	B	C	53	54	55	56	57	58	59	60	61	62	63	64	65	66
A			7			1			1	2			27	2
B
C
D		1					1		1									4
E						1	1		2		2			1				1
F	1					1						4				39
G			1			9	1	39	15		6		1					34
H						2					1	1
I	34									1	1
K							1		2	2	8				36		1
L	1													1		1
M	4
N		35				20	12	1	17		18				1
P			31
Q														36			37
R						3	1				2				1		2		37
S		2				1	20		1			2	11		1
T		1					3			35	2		1		1
V		1	1						1
W																			3
X
Y						2						33
Z
—				40	40
unknown
(?)
not
sequenced
sum of	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40
seq 2
oomcaa 3	34	35	31	40	40	20	20	39	17	35	18	33	27	36	36	39	37	34	37
mcaa 4	I	N	P	—	—	N	S	G	N	T	N	Y	A	Q	K	F	Q	G	R
rel.
oomcaa 5	85%	88%	78%	100%	100%	50%	50%	98%	43%	88%	45%	83%	68%	90%	90%	98%	93%	85%	93%
pos.	4	5	4	1	1	9	8	2	8	4	8	4	4	4	5	2	3	4	2
occupied 6
amino	Framework III
acid 1	67	68	69	70	712	72	73	74	75	76	77	78	79	80	81	82	A	B	C	83	84	85	86	87	88	89	90	91	92
A	1				2				12			35									1	2			40
B
C																													37
D						35				1					4							19	40			1
E					1										35							19
F			3									1									2							2	1
G															1		1	2
H						1
I	1	1	13						22		1															1
K					1															1
L			1											2		39			39							2			1
M			23				1		1					37		1										2
N						4				7							1	2
P								3													1							1
Q
R					34		1			4							2	16		37
S					1			37		27			1				35	20		1	36						1	1
T		39		40	1		38		5	1	39						1			1				40
V	38											4		1					1							33
W
X
Y													39														38	35
Z
—
unknown
(?)
not																										1	1	1	1
sequenced
sum of	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	40	39	39	39	39
seq 2
oomcaa 3	38	39	23	40	34	35	38	37	22	27	39	35	39	37	35	39	35	20	39	37	36	19	40	40	40	33	38	35	37
mcaa 4	V	T	M	T	R	D	T	S	I	S	T	A	Y	M	E	L	S	S	L	R	S	D	D	T	A	V	Y	Y	C
rel.	95%	98%	58%	100%	85%	88%	95%	93%	55%	68%	98%	88%	98%	93%	88%	98%	88%	50%	98%	93%	90%	48%	100%	100%	100%	85%	97%	90%	95%
oomcaa 5
pos.	3	2	4	1	6	3	3	2	4	5	2	3	2	3	3	2	5	4	2	4	4	3	1	1	1	5	2	4	3
occupied 6
amino	CDR III
acid 1	93	94	95	96	97	98	99	100	A	B	C	D	E	F	G	H	I	J	K	101
A	37	1	6		1	1		2	3	1	3		1					5
B
C		1				3				2	1
D			7		5	2	3	1	5	4		1		2	2	1	2			27
E			2		1			1	1		2		1		1
F				1	1	3			2	1	1	1	1					2	15
G		1	7	7	5	5	9	4	7	1	3		2	2	1		1	3		1
H			1				2			1	1
I		1		1	1	3	1	1	1	1	1	1							1
K		1			1				1	1		1		1			1
L			2	4	4	4	3			1	2	1	1	2		1			2
M				2		1	1								1				4
N					1			1		1	1	1			3		1			1
P				6	4				1	1		3	2				1
Q					1							1	2	1
R	1	31		5	1	1	3					1		1				1
S		1	3	3	1	4	3	6	3	2	2	1		1
T		2	1	1	2	2	1	5	1	1	1		1			1		1
V	1		7	1	1		1	3	1	2		1			1	2	1			1
W			1		1		2	2		1	1					1		4
X
Y				5	5	4	2	3		4	3	3	2	1	2	5	6	2
Z
—				1	1	4	6	8	10	11	14	20	23	25	25	25	23	18	11	6
unknown																			3
(?)
not	1	1	3	3	3	3	3	3	4	4	4	4	4	4	4	4	4	4	4	4
sequenced
sum of	39	39	37	37	37	37	37	37	36	36	36	36	36	36	36	36	36	36	36	36
seq 2
oomcaa 3	37	31	7	7	5	5	9	8	10	11	14	20	23	25	25	25	23	18	15	27
mcaa 4	A	R	D	G	D	G	G	—	—	—	—	—	—	—	—	—	—	—	F	D
rel.	95%	79%	19%	19%	14%	14%	24%	22%	28%	31%	39%	56%	64%	69%	69%	69%	64%	50%	42%	75%
oomcaa 5
pos.	3	8	10	12	18	13	13	12	12	17	14	13	10	9	8	7	8	8	5	5
occupied 6
amino	Framework IV
acid 1	102	103	104	105	106	107	108	109	110	111	112	113	sum
A													340
B
C													79
D	2												179
E				1									159
F	1												130
G			27		26					1			450
H	1												51
I	7								3				113
K				2									194
L							12			1			204
M							2						144
N	1												138
P	1			1									128
Q				23									253
R							1						247
S	3								1		18	18	432
T						21	6		16		1		390
V	6							21		18			342
W		29											158
X
Y	11												294
Z
—	3												394
unknown													3
(?)
not	4	11	13	13	14	19	19	19	20	20	21	22	458
sequenced
sum of	36	29	27	27	26	21	21	21	20	20	19	18
seq 2
oomcaa 3	11	29	27	23	26	21	12	21	16	18	18	18
mcaa 4	Y	W	G	Q	G	T	L	V	T	V	S	S
rel.	31%	100%	100%	85%	100%	100%	57%	100%	80%	90%	95%	100%
oomcaa 5
pos.	10	1	1	4	1	1	4	1	3	3	2	1
occupied 6

TABLE 6C
Analysis of V heavy chain subgroup 2
amino	Framework I
acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	20	21	22	23	24	25	26	27	28	29	30
A										3																		1
B
C																						7
D
E	1					6										2
F																								3			6		1
G								6																		7
H
I		1
K					3								6		1
L				6							6							6		6				2			1		6
M
N							1
P							1		6					6			1
Q	2															4
R					2
S							4																1		6			6		6
T			6		1					2					5		5		6		6		6							1
V		5								1		6												2
W
X
Y																									1
Z	3
—
unknown
(?)
not	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1
sequenced
sum of	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	7	7	7	7	7	7	7	7	7
seq 2
oomcaa 3	3	5	6	6	3	6	4	6	6	3	6	6	6	6	5	4	5	6	6	6	6	7	6	3	6	7	6	6	6	6
mcaa 4	Z	V	T	L	K	E	S	G	P	A	L	V	K	P	T	Q	T	L	T	L	T	C	T	F	S	G	F	S	L	S
rel.	50%	83%	100%	100%	50%	100%	67%	100%	100%	50%	100%	100%	100%	100%	83%	67%	83%	100%	100%	100%	100%	100%	86%	43%	86%	100%	86%	86%	86%	86%
oomcaa 5
pos.	3	2	1	1	3	1	3	1	1	3	1	1	1	1	2	2	2	1	1	1	1	1	2	3	2	1	2	2	2	2
occupied 6
amino	CDRI	Framework II
acid 1	31	A	B	32	33	34	35	36	37	38	39	40	41	42	43	44	45	46	47	48	49	50
A		1			1											6					7
B
C					2
D		1
E																		7
F
G			4		3		3					1		7		1
H																						2
I			1						7
K															6
L																	7			7		2
M				5
N	2
P												5	7
Q											6
R			2		1					7	1				1							2
S	2	4					4					1
T	3	1
V				2		7
W								7											7			1
X
Y
Z
—
unknown
(?)
not
sequenced
sum of	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7
seq 2
oomcaa 3	3	4	4	5	3	7	4	7	7	7	6	5	7	7	6	6	7	7	7	7	7	2
mcaa 4	T	S	G	M	G	V	S	W	I	R	Q	P	P	G	K	A	L	E	W	L	A	H
rel.	43%	57%	57%	710%	43%	100%	57%	100%	100%	100%	86%	71%	100%	100%	86%	86%	100%	100%	100%	100%	100%	29%
oomcaa 5
pos.	3	4	3	2	4	1	2	1	1	1	2	3	1	1	2	2	1	1	1	1	1	4
occupied 6
amino	CDR II
acid 1	51	52	A	B	C	53	54	55	56	57	58	59	60	61	62	63	64	65	66
A
B
C
D		2					3	6	5
E									1								1
F		2								1		1
G
H								1				1
I	6
K									1	6							4
L	1	1														7
M
N							3
P														2
Q
R											2			1			2		7
S						2					2		6		7			4
T														4				3
V
W						4						1
X		1				1	1						1
Y		1	1								3	4
Z
—			6	7	7
unknown
(?)
not
sequenced
sum of	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7
seq 2
oomcaa 3	6	2	6	7	7	4	3	6	5	6	3	4	6	4	7	7	4	4	7
mcaa 4	I	D	—	—	—	W	D	D	D	K	Y	Y	S	T	S	L	K	S	R
rel.
oomcaa 5	86%	29%	86%	100%	100%	57%	43%	86%	71%	86%	43%	57%	86%	57%	100%	100%	57%	57%	100%
pos.	2	5	2	1	1	3	3	2	3	2	3	4	2	3	1	1	3	2	1
occupied 6
amino	Framework III
acid 1	67	68	69	70	712	72	73	74	75	76	77	78	79	80	81	82	A	B	C	83	84	85	86	87	88	89	90	91	92
A																						1			5
B
C																													7
D						6	1													6			7
E
F														1
G																									2
H
I			6												2		1
K					6				6
L	7													6
M																7			5
N						1				5								6		1
P																					7
Q											7
R					1				1
S		1		5				7		2
T		6		2			6								5		5							7		7
V			1									7	7						1			6
W
X
Y																											7	7
Z
—																	1	1	1
unknown
(?)
not
sequenced
sum of	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7	7
seq 2
oomcaa 3	7	6	6	5	6	6	6	7	6	5	7	7	7	6	5	7	5	6	5	6	7	6	7	7	5	7	7	7	7
mcaa 4	L	T	I	S	K	D	T	S	K	N	Q	V	V	L	T	M	T	N	M	D	P	V	D	T	A	T	Y	Y	C
rel.	100%	86%	86%	71%	86%	86%	86%	100%	86%	71%	100%	100%	100%	86%	71%	100%	71%	86%	71%	86%	100%	86%	100%	100%	71%	100%	100%	100%	100%
oomcaa 5
pos.	1	2	2	2	2	2	2	1	2	2	1	1	1	2	2	1	3	2	3	2	1	2	1	1	2	1	1	1	1
occupied 6
amino	CDR III
acid 1	93	94	95	96	97	98	99	100	A	B	C	D	E	F	G	H	I	J	K	101
A	5							1	2	1
B
C
D																				6
E								2			1
F																			3
G						1	1		1	2	1	1	1	1
H		1		1
I			3			2
K							1
L								1		1									1
M								1											2
N				1	2												1
P				1	1		1		1
Q			1
R		6	1			1			1
S				1		1	1
T				1			1		1
V	2		1	1			1	1			1
W						1									1			1
X
Y					2						1	2	1	1	1			2
Z
—										2	2	3	4	4	4	6	5	3
unknown
(?)
not			1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1
sequenced
sum of	7	7	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6	6
seq 2
oomcaa 3	5	6	3	1	2	2	1	2	2	2	2	3	4	4	4	6	5	3	3	6
mcaa 4	A	R	I	H	N	I	G	E	A	—	—	—	—	—	—	—	—	—	F	D
rel.	71%	86%	50%	17%	33%	33%	17%	33%	33%	33%	33%	50%	67%	67%	67%	100%	83%	50%	50%	100%
oomcaa 5
pos.	2	2	4	6	4	5	6	5	5	4	5	3	3	3	3	1	2	3	3	1
occupied 6
amino	Framework IV
acid 1	102	103	104	105	106	107	108	109	110	111	112	113	sum
A									1				35
B
C													16
D													43
E													21
F													18
G			6		6								55
H													6
I													29
K				1			1						42
L	1						3						78
M													20
N													23
P	1						1						41
Q				3									23
R				2									41
S											6	3	82
T						6	1		5				102
V	3							6		6			68
W		6											29
X													4
Y	1												35
Z													3
—													56
unknown
(?)
not	1	1	1	1	1	1	1	1	1	1	1	4	54
sequenced
sum of	6	6	6	6	6	6	6	6	6	6	6	3
seq 2
oomcaa 1	3	6	6	3	6	6	3	6	5	6	6	3
mcaa 4	V	W	G	Q	G	T	L	V	T	V	S	S
rel.	50%	100%	100%	50%	100%	100%	50%	100%	83%	100%	100%	100%
oomcaa 5
pos.	4	1	1	3	1	1	4	1	2	1	1	1
occupied 6

TABLE 6D
Analysis of V heavy chain subgroup 3
	Framework I
amino
acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	20	21	22	23	24	25	26	27	28	29	30
A					1		1			12		1		3	1								183	192		1
B			1			1							1
C																					1	209
D	1					1				16																				7
E	110		9		15	166			9				8		2	8							8			3		1
F											4						1	1			1						201		201
G								181	193	174		1			202	134								2		207				3
H			5										4																	1
I												9											2				3	17	1
K		5	3										26						15											4
L		1	5	176	43						140			1				205		201							6		3
M		12		1														1										1
N										1																		10		10
P													1	194									1					2
Q	41		138	1	3	12							162					1
R			6										4			62			191											11
S							178			2				8			206				207		4	2	209			15		174
T							1									4	1		2				4	4			1	163
V	5	147		1	118						62	195								8			7	9				1	6
W															1
X
Y
Z	8
—
unknown
(?)
not	47	47	45	33	32	32	32	31	10	7	6	6	6	6	6	4	4	4	4	3	3	3	3	3	3	1	1	2	1	2
sequenced
sum of	165	165	167	179	180	180	180	181	202	205	206	206	206	206	206	208	208	208	208	209	209	209	209	209	209	211	211	210	211	210
seq 2
oomcaa 3	110	147	138	176	118	166	178	181	193	174	140	195	162	194	202	134	206	205	191	201	207	209	183	192	209	207	201	163	201	174
mcaa 4	E	V	Q	L	V	E	S	G	G	G	L	V	Q	P	G	G	S	L	R	L	S	C	A	A	S	G	F	T	F	S
rel.	67%	89%	83%	98%	66%	92%	99%	100%	96%	85%	68%	95%	79%	94%	98%	64%	99%	99%	92%	96%	99%	100%	88%	92%	100%	98%	95%	78%	95%	83%
oomcaa 5
pos	5	4	7	4	5	4	3	1	2	5	3	4	7	4	4	4	3	4	3	2	3	1	7	5	1	3	4	8	4	7
occupied 6
	CDRI	Framework II
amino
acid 1	31	A	B	32	33	34	35	36	37	38	39	40	41	42	43	44	45	46	47	48	49	50
A	1			17	80		1			1		187		1		1					77	42
B																		3
C												1		1
D	26			3	7		2													1
E	1				10									1	1			198
F				5																		7
G	13				31		1					2		209		207					33	11
H				4			88															1
I	1			1	15			12
K	7										1				202
L	3					3			2	3	1	2	1				211			5		12
M						193																1
N	35			8	3		34															13
P				1			1					4	191				1
Q											209		1		1			7
R	7									207		7			8	1
S	103			17	8		72					3	14			3			1		102	11
T	9				15		10					4	5									3
V	2				7	1			197			2						3		204		49
W					30			212											210			1
X	1
Y	1			154	19		3												1			22
Z
—		210	210
unknown
(?)
not	2			2	2				1	1	1
sequenced
sum of	210	210	210	210	210	212	212	212	211	211	211	212	212	212	212	212	212	212	212	212	212	212
seq 2
oomcaa 3	103	210	210	154	80	193	88	212	197	207	209	187	191	209	202	207	211	198	210	204	102	49
mcaa 4	S	—	—	Y	A	M	H	W	V	R	Q	A	P	G	K	G	L	E	W	V	S	V
rel.	49%	100%	100%	73%	38%	91%	42%	100%	93%	98%	99%	88%	90%	99%	95%	98%	100%	93%	99%	96%	48%	23%
oomcaa 5
pos	14	1	1	9	10	4	9	1	3	3	3	9	5	4	4	4	2	5	3	3	3	15
occupied 6
	CDR II
amino
acid 1	51	52	A	B	C	53	54	55	56	57	58	59	60	61	62	63	64	65	66
A		1	2		14		7		9	1	2		174	33
B			1						1	2
C						1
D			7			94	8	3	11		17			160
E		3	2	1		2		1	8	3	2			1			2
F	1	2	1				1	8	1		3	2
G		10	46			4	163	85	5	1	5		4	5			212	1
H			1						1		4
I	191		1					1	3	37	2					8
K	1	37	2	30		3	1		1	61							199		8
L	1							1	1	1		1
M	1								8		2		1
N		7	9	2		13	11	1	51		4			2			2
P			1			1			1	1			6	8	18		1
Q			10						3	2							2		2
R	1	17	5	1		2		16	5	4			5				6		201
S	9	118	43		1	74	17	82	48		11		4		193
T	5	4	2		13	12	3	3	42	97	5		7
V	2		1		6					2			10	2		204
W		8	6								2
X						4		3	4		1			1
Y		5	58					8	9		151	210			1
Z
—			14	178	178	2	1	1
unknown
(?)
not
sequenced
sum of	212	212	212	212	212	212	212	212	212	212	212	212	212	212	212	212	212	212	212
seq 2
oomcaa 3	191	118	58	178	178	94	163	85	51	97	151	210	174	160	193	204	199	212	201
mcaa 4	I	S	Y	—	—	D	G	G	N	T	Y	Y	A	D	S	V	K	G	R
rel.	90%	56%	27%	84%	84%	44%	77%	40%	24%	46%	71%	99%	82%	75%	91%	96%	94%	100%	95%
oomcaa 5
pos	9	11	19	5	5	12	9	12	19	12	15	2	9	8	3	2	6	1	4
occupied 6
	Framework III
amino
acid 1	67	68	69	70	71	72	73	74	75	76	77	78	79	80	81	82	A	B	C	83	84	85	86	87	88	89	90	91	92
A		1						57			1	8						1		149	1		1	207
B															2
C									1	210
D						199	38		2	2			1				10		5	15	209
E						6			4						5	1		190
F	207												13							1		15
G																	1	4	1	1	6			4	1
H										1			1		2		2		1							1
I		14	208				1				2	2				3	1	1		8					2
K									186	6							3	30
L	1		1									188		209		3	1		212							18
M					1				2		10	3		2		205					2		1
N						5	170		2	188					3		181	10		1		1
P											1		9
Q									7						199				1
R					211				1	1							2	8	177
S	2	7		211				153	8	10	56		3				6	186		1			1
T		189		1							142				1		4	2	3	28			207		1
V	1		3					1				11		1		1		9					187
W										1
X						2	2			4							1				1
Y	1	1											194								211	194
Z
—
unknown
(?)
not							1	1					1	1	1	1	1	1
sequenced
sum of	212	212	212	212	212	212	211	121	212	212	212	212	212	212	212	212	212	212	212	212	212	212	212	211	211	211	211	211	211
seq 2
oomcaa 3	207	189	208	211	211	199	170	153	186	188	142	188	194	209	199	205	181	186	212	177	149	190	209	207	207	187	211	194	210
mcaa 4	F	T	I	S	R	D	N	S	K	N	T	L	Y	L	Q	M	N	S	L	R	A	E	D	T	A	V	Y	Y	C
rel.	98%	89%	98%	100%	100%	94%	81%	73%	88%	89%	67%	89%	92%	99%	94%	97%	85%	88%	100%	83%	70%	90%	99%	98%	98%	89%	100%	92%	100%
oomcaa 5
pos	5	5	3	2	2	4	4	3	8	7	6	5	5	3	6	4	11	7	1	5	10	4	4	4	2	7	1	4	2
occupied 6
	CDR III
amino
acid 1	93	94	95	96	97	98	99	100	A	B	C	D	E	F	G	H	I	J	K	101
A	173	2	15	9	11	7	13	7	9	6	2	3	5	5		9		13		2
B
C		5	2		1	13	5		1	2	11	3		2					1
D		2	54	7	6	11	7	10	4	2	3	10	3	3	1		3	2		146
E			11	2	11	6	3	1	13		1	1								1
F		1		9	6	3	5	4	5	5	6	3	5	7	2		1	1	65	1
G	2	8	34	26	35	34	17	35	17	14	23	10	5	1	5	3	2	32		6
H				3	11	3	4	3	2	9	2		1	3	1	2	8	1
I			4	15	10	6	11	4	4	3	1	3	10	3	3	2		1	2
K		60	4	3	5	2	11			3	1
L		1	6	11	7	26	13	4	12	8	2	6	3	10	3				2	1
M				6	1		1	2								1			32
N		2	20	4	3	4	6	4	3	2	2	6				2	5			2
P	1	3	4	29	10	6	5	5	6	9	8	2	3	2	1		3		9
Q		5	3	9	2	4		1	1	1	1	1					1
R		103	9	30	19	4	10	9	7	5	5	2	3	1		1		2		4
S		3	9	8	11	16	28	27	25	24	8	11	9	3		2	3	1	1	1
T	25	15	7	6	20	6	12	9	17	17	1	2	5	1	9	3	1
V	10	1	7	7	15	13	7	15	4	3	6	2	12		1	1	1	1
W			3	4	3	6	5	6	7	2	4				1		6	10
X									1											1
Y			12	9	8	16	14	17	5	8	18	20	13	20	25	28	32	28
Z
—			1	3	4	12	21	35	54	73	87	102	110	126	135	134	120	91	71	21
unknown												3	2	1	1			3	2
(?)
not	1	1	7	12	13	14	14	14	14	15	19	21	22	23	23	23	25	25	26	25
sequenced
sum of	211	211	205	200	199	198	198	198	197	196	192	190	189	188	188	188	186	186	185	186
seq 2
oomcaa 3	173	103	54	30	35	34	28	35	54	73	87	102	110	126	135	134	120	91	71	146
mcaa 4	A	R	D	R	G	G	S	G	—	—	—	—	—	—	—	—	—	—	—	—
rel.	82%	49%	26%	15%	18%	17%	14%	18%	27%	37%	45%	54%	58%	67%	72%	71%	65%	49%	38%	78%
oomcaa 5
pos	20	20	19	20	19	20	17	14	14	12	12	13	12	8	11
occupied 6
	Framework IV
	amino
	acid 1	102	103	104	105	106	107	108	109	110	111	112	113	sum
	A	1		1			2							1767
	B				1									13
	C													470
	D	2												1121
	E					1								832
	F	2												807
	G			140		130		1						2743
	H	4												179
	I	15								1	1			651
	K				13									933
	L	10			1			91				2	1881
	M							6						496
	N	1					1							844
	P	17					1	1						568
	Q				111									949
	R				8									1413
	S	7	1									118	110	3009
	T						123	27		122			1	1426
	V	34		1			1		125		119			185
	W		158											686
	X													26
	Y	82												1598
	Z													8
	—	9	2	2	2	2	2	2	2	2	2	1	1	203
	unknown													12
	(?)
	not	27	50	67	75	78	81	83	84	86	89	92	97	1650
	sequenced
	sum of	184	161	144	136	133	130	128	127	125	122	119	114
	seq 2
	oomcaa 3	82	158	140	111	130	123	91	125	122	119	118	110
	mcaa 4	Y	W	G	Q	G	T	L	V	T	V	S	S
	rel.	45%	98%	97%	82%	98%	95%	71%	98%	98%	98%	99%	96%
	oomcaa 5
	pos	12	3	4	6	3	6	6	2	3	3	2	4
	occupied 6

TABLE 6D
Analysis of V heavy chain subgroup 4
	Framework I
amino
acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	20	21	22	23	24	25	26	27	28	29	30
A										19					1			1		1				22
B
C																						53
D																							1
E						32										44
F																									1				22
G								54	1	53						2										53	53
H			4		2																						1
I																							1					1	32
K												1	54						1
L		7		54							53	19		1				53		50
M
N																														1
P									33					51	1					2								3
Q	52		50		51	20										7
R	1																									1				3
S							33								52				52				2		35			51	1	52
T									1								52				53		29
V		47				1						34								1				55		1			1
W							20
X
Y																									19		1
Z	1
—
unknown
(?)
not	3	3	3	3	4	4	4	3	3	4	4	3	3	4	4	4	4	4	3	4	4	4	2	2	2	2	2	2	1	1
sequenced
sum of	54	54	54	54	53	53	53	54	54	53	53	54	54	53	53	53	53	53	54	53	53	53	55	55	55	55	55	55	56	56
seq 2
oomcaa 3	52	47	50	54	51	32	33	54	33	53	53	34	54	51	52	44	52	53	52	50	53	53	29	55	35	53	53	51	32	52
mcaa 4	Q	V	Q	L	Q	E	S	G	P	G	L	V	K	P	S	E	T	L	S	L	T	C	T	V	S	G	G	S	I	S
rel.	96%	87%	93%	100%	96%	60%	62%	100%	61%	100%	100%	63%	100%	96%	98%	83%	98%	100%	96%	94%	100%	100%	53%	100%	64%	96%	96%	93%	57%	93%
oomcaa 5
pos	3	2	2	1	2	3	2	1	4	1	1	3	1	3	2	3	2	1	3	3	1	1	5	1	3	3	3	3	4	3
occupied 6
	CDRI	Framework II
amino
acid 1	31	A	B	32	33	34	35	36	37	38	39	40	41	42	43	44	45	46	47	48	49	50
A				1									8	1
B
C					1
D	4	1	1	1			1
E														1				56				22
F				1	1				1													1
G	21	3	4				8							55		55					56	1
H				2								2
I									51											54		1
K															54
L									1			1					55			2
M
N	1		2	2			1
P												50	49				2
Q	1										56							1				1
R	2		1							57					3	2						9
S	25	5	9	1			44		1			3										7
T	2	1					3				1	1
V									3											1
W		1			2	56		57										56
X
Y				48	52														1			15
Z
—		45	39
unknown
(?)
not	1			1	1	1
sequenced
sum of	56	56	56	56	56	56	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57
seq 2
oomcaa 3	25	45	39	48	52	56	44	57	51	57	56	50	49	55	54	55	55	56	56	54	56	22
mcaa 4	S	—	—	Y	Y	W	S	W	I	R	Q	P	P	G	K	G	L	E	W	I	G	E
rel.	45%	80%	70%	86%	93%	100%	77%	100%	89%	100%	98%	88%	86%	96%	95%	96%	96%	98%	98%	95%	98%	39%
oomcaa 5
pos	7	6	6	7	4	1	5	1	5	1	2	5	2	3	2	2	2	2	2	3	2	8
occupied 6
	CDR II
amino
acid 1	51	52	A	B	C	53	54	55	56	57	58	59	60	61	62	63	64	65	66
A										1									1
B
C
D		1				1					2
E
F		1										3
G						1		57	1									1
H						24					2
I	54								1	1
K													1				53
L														1		55
M
N		21							2		40		53
P														54		1
Q
R		1							2								3		56
S		1					52		49		1		2		56			56
T						8	5		1	54	1			1			1
V	3								1	1
W
X
Y		32				23					11	54
Z
—			57	57	57
unknown
(?)
not													1	1	1	1
sequenced
sum of	57	57	57	57	57	57	57	57	57	57	57	57	56	56	56	56	57	57	57
seq 2
oomcaa 3	54	32	57	57	57	24	52	57	49	54	40	54	53	54	56	55	53	56	56
mcaa 4
rel.	95%	56%	100%	100%	100%	42%	91%	100%	86%	95%	70%	95%	95%	96%	100%	98%	93%	98%	98%
oomcaa 5
pos	2	6	1	1	1	5	2	1	7	4	6	2	3	3	1	2	3	2	2
occupied 6
	Framework III
amino
acid 1	67	68	69	70	71	72	73	74	75	76	77	78	79	80	81	82	A	B	C	83	84	85	86	87	88	89	90	91	92
A		1			1			1				1												55	57			57
B
C																													57
D	1					55								01									57
E						1									1
F							1					54						1
G																	1
H
I	1	1	48		3							1					1			3
K							1		51	3					46		2
L	1				3				1		3	1		55		53			2							1
M			7				2								1	1			1							1
N		2							1	54					3		3	1
P
Q						1					54			1	1
R									2						2		2				1
S		1		56			1	57				1	57		2	1	44	55		1				2				1
T		51		1			52								1		4			53				55
V	53		2	50				1							2			54		1				55
W
X
Y																											57	56
Z
—
unknown
(?)
not	1	1
sequenced
sum of	56	56	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57	57
seq 2
oomcaa 3	53	51	48	56	50	55	52	57	51	54	54	54	57	55	46	53	44	55	54	53	55	57	57	55	57	55	57	56	57
mcaa 4	V	T	I	S	V	D	T	S	K	N	Q	F	S	L	K	L	S	S	V	T	A	A	D	T	A	V	Y	Y	C
rel.	95%	91%	84%	98%	88%	96%	91%	100%	89%	95%	95%	95%	100%	96%	81%	93%	77%	96%	95%	93%	96%	100%	100%	96%	100%	96%	100%	98%	100%
oomcaa 5
pos	4	5	3	2	4	3	5	1	6	2	2	4	1	3	8	4	7	3	3	3	3	1	1	2	1	3	1	2	1
occupied 6
	CDR III
amino
acid 1	93	94	95	96	97	98	99	100	A	B	C	D	E	F	G	H	I	J	K	101
A	56		3	3	3	2	5	4	2	2	4		2	1		1	1	12
B
C					1				1
D			6		5	5	5	4	3	2	4	3	1		1	2	1			41
E			6	1	1	2	1			1	3	1	2	1
F				4	1	1		2	3	2	2		1	1					31
G			25	9	10	8	10	11	4	7	7	6	1	1	1	2	1	9
H			1				1						1			1				2
I				1		2	4	1	3	2	3		1						1
K			2	1						2	2			1
L			2	6	7	3	5	3	2	4	1	5	3	3		1
M				1	4		3	1		2	1								9
N				3					2	1	1	5	1	1			2
P				4	5	3	1	1	2	1	1	1	2	3	1	2	1
Q					1	1		1			1	1			3					1
R		54	4	12	2	5	5	3	2	3	1	2			2	1
S		1	1	4	8	8	1	2	5	7	4	2	1	1	1
T		1	1	2	1	3	4	4	3	3			1	1	1
V	1	1	4	2	2	5	4	4	7	3	1	2	1
W			1	2	1	2	2	4	5	1	1	2		2	1		3	2
X
Y				1	4	5	3	6	4	2	3	4	8	4	8	3	5	8		2
Z
—						1	2	4	6	9	11	16	23	27	29	34	31	14	4
unknown														1			1	1	1
(?)
not			1	1	1	1	1	2	3	3	6	7	8	9	9	10	11	11	11	11
sequenced
sum of	57	57	56	56	56	56	56	55	54	54	51	50	49	48	48	47	46	46	46	46
seq 2
oomcaa 3	56	54	25	12	10	8	10	11	7	9	11	16	23	27	29	34	31	14	31	41
mcaa 4	A	R	G	R	G	G	G	G	V	—	—	—	—	—	—	—	—	—	F	D
rel.	98%	95%	45%	21%	18%	14%	18%	20%	13%	17%	22%	32%	47%	56%	60%	72%	67%	30%	67%	89%
oomcaa 5
pos	2	4	12	16	16	16	16	16	16	18	18	13	15	13	10	9	8	5	4	4
occupied 6
	Framework IV
	amino
	acid 1	102	103	104	105	106	107	108	109	110	111	112	113	sum
	A						1			1				332
	B
	C													113
	D													210
	E													176
	F													135
	G			41		40	1							674
	H	1								1				45
	I	9					1							282
	K				3									278
	L	4						19						540
	M							9						43
	N						1							204
	P	3			2							2	281
	Q				29									334
	R	1			4		1						250
	S	1			1						36	33	986
	T				1		33	8		34				532
	V	12							36		36			488
	W		46											267
	X
	Y	16												455
	Z													1
	—													466
	unknown													4
	(?)
	not	10	11	16	17	17	20	20	21	21	21	21	22	426
	sequenced
	sum of	47	46	41	40	40	37	37	36	36	36	36	35
	seq 2
	oomcaa 3	16	46	41	29	40	33	19	36	34	36	36	33
	mcaa 4	Y	W	G	Q	G	T	L	V	T	V	S	S
	rel.	34%	100%	100%	73%	100%	89%	51%	100%	94%	100%	100%	94%
	oomcaa 5
	pos	8	1	1	6	1	5	4	1	3	1	1	2
	occupied 6

TABLE 6F
Analysis of V heavy chain subgroup 5
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18
A					1			1	89		1			1
B
C							1
D										2
E	88	1			2				4	93						92
F																	1
G	1							92							94
H
I
K												94	94
L		1		91		2												95
M											3
N
P				1					1					94
Q	3		92		1	90										3
R						1						1	1		1
S							92										94
T
V		90			89				1		91
W
X
Y
Z
—
unknown (?)
not sequenced	5	5	5	5	4	4	4	4	2	2	2	2	2	2	2	2	2	2
sum of seq 2	92	92	92	92	93	93	93	93	95	95	95	95	95	95	95	95	95	95
oomcaa 3	88	90	92	91	89	90	92	92	89	93	91	94	94	94	94	92	94	95
mcaa 4	E	V	Q	L	V	Q	S	G	A	E	V	K	K	P	G	E	S	L
rel. oomcaa 5	96%	98%	100%	99%	96%	97%	99%	99%	94%	98%	96%	99%	99%	99%	99%	97%	99%	100%
pos occupied 6	3	3	1	2	4	3	2	2	4	2	3	2	2	2	2	2	2	1
	Framework I	CDRI
amino acid 1	19	20	21	22	23	24	25	26	27	28	29	30	31	A	B	32
A						3	2					4
B
C				96						1			1
D										2			2
E								2					1
F							3		6		97					2
G						92		93					1
H													1			4
I		96										4
K	77				89					1
L
M	1				1
N					1					2		4	14			2
P							1
Q	1				4
R	17				1			1		2
S			94			1	90			84		10	61			2
T			2							5		75	16
V
W
X
Y									90							87
Z
—														97	97
unknown (?)
not sequenced	1	1	1	1	1	1	1	1	1
sum of seq 2	98	96	96	96	96	96	96	96	96	97	97	97	97	97	97	97
oomcaa 3	77	96	94	96	89	92	90	93	90	84	97	75	61	97	97	87
mcaa 4	K	I	S	C	K	G	S	G	Y	S	F	T	S	—	—	Y
rel. oomcaa 5	80%	100%	98%	100%	93%	96%	94%	97%	94%	87%	100%	77%	63%	100%	100%	90%
pos occupied 6	4	1	2	1	5	3	4	3	2	7	1	5	8	1	1	5
	CDRI	Framework II
amino acid 1	33	34	35	36	37	38	39	40	41	42	43	44	45	46	47	48	49	50
A			8		1				1			1
B
C
D			1
E											3			97
F																		1
G			72							97		96					95
H						1
I		93														1		75
K								1			94
L	1				2								94			2		2
M		1			1			92								89
N
P						1			96				2
Q							97						1
R	1					95		1									1	14
S	2		15															1
T		2	1					1										3
V		1			93			2								5	1	1
W	93			97											94
X
Y															3
Z
—
unknown (?)
not sequenced
sum of seq 2	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97
oomcaa 3	93	93	72	97	93	95	97	92	96	97	94	96	94	97	94	89	95	75
mcaa 4	W	I	G	W	V	R	Q	M	P	G	K	G	L	E	W	M	G	I
rel. oomcaa 5	96%	96%	74%	100%	96%	98%	100%	95%	99%	100%	97%	99%	97%	100%	97%	92%	98%	77%
pos occupied 6	4	4	5	1	4	3	1	5	2	1	2	2	3	1	2	4	3	7
	CDR II
amino acid 1	51	52	A	B	C	53	54	55	56	57	58	59	60	61	62	63
A			1			2	1			6					1
B
C		1				1							1
D		14				8	93		77
E							2		3
F		2										2				91
G						69	1		1
H		3	1
I	92									4	1					1
K											2
L	1													1		4
M	1
N									2		14	2
P		1	93					1						95	1
Q
R						1					78
S			1			16		96	2	2			95	1	95	1
T	1		1							85	2		1
V	2											1
W
X
Y		76							12			92
Z
—				97	97
unknown (?)
not sequenced
sum of seq 2	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97
oomcaa 3	92	76	93	97	97	69	93	96	77	85	78	92	95	95	95	91
mcaa 4	I	Y	P	—	—	G	D	S	D	T	R	Y	S	P	S	F
rel. oomcaa 5	95%	78%	96%	100%	100%	71%	96%	99%	79%	88%	80%	95%	98%	98%	98%	94%
pos occupied 6	5	6	5	1	1	6	4	2	6	4	5	4	3	3	3	4
	CDR II	Framework III
amino acid 1	64	65	66	67	68	69	70	71	72	73	74	75	76	77	78	79	80	81
A								88						1	91
B
C		1
D		2							97							1
E	2									2								1
F				1		3										1
G		94
H			15															3
I				3		88						91
K										93
L							2										96
M						3						1
N													7
P	1										1				1
Q	91		81							1								93
R	3		1			1				1			1
S					1		95				96	1	87	2	1	1
T					96							4	2	94	2
V				93		2		9							2		1
W
X
Y																94
Z
—
unknown (?)
not sequenced
sum of seq 2	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97	97
oomcaa 3	91	94	81	93	96	88	95	88	97	93	96	91	87	94	91	94	96	93
mcaa 4	Q	G	Q	V	T	I	S	A	D	K	S	I	S	T	A	Y	L	Q
rel. oomcaa 5	94%	97%	84%	96%	99%	91%	98%	91%	100%	96%	99%	94%	90%	97%	94%	97%	99%	96%
pos occupied 6	4	3	3	3	2	5	2	2	1	4	2	4	4	3	5	4	2	3
	Framework III	CDR III
amino acid 1	82	A	B	C	83	84	85	86	87	88	89	90	91	92	93	94	95	96
A					1	96				93					92		1	1
B
C	1													95
D								96										3
E					1												1	1
F												2	6
G		3	1							4							1	9
H																	10	1
I									2		9							3
K					91						1					1	1	1
L				97							2						11	2
M											84
N		2	2						2									1
P																	5	1
Q																1	3	2
R	1	1	3		3											92	7	9
S		90	91				96		5							1	1	3
T		1			1	1	1		88		1				1		1	3
V								1							2		2	4
W	95																1
X
Y												94	89					1
Z
—
unknown (?)
not sequenced												1	2	2	2	2	52	52
sum of seq 2	97	97	97	97	97	97	97	97	97	97	97	96	95	95	95	95	45	45
oomcaa 3	95	90	91	97	91	96	96	96	88	93	84	94	89	95	92	92	11	9
mcaa 4	W	S	S	L	K	A	S	D	T	A	M	Y	Y	C	A	R	L	G
rel. oomcaa 5	98%	93%	94%	100%	94%	99%	99%	99%	91%	96%	87%	98%	94%	100%	97%	97%	24%	20%
pos occupied 6	3	5	4	1	5	2	2	2	4	2	5	2	2	1	3	4	13	16
	CDR III
amino acid 1	97	98	99	100	A	B	C	D	E	F	G	H	I	J	K	101
A	2		3	4	3	2		1			1			4		2
B
C		1	1	1			2		1
D	3	3	3	1	2	1	1	2		2	1	1	2			37
E	1	2			1	1				1			1
F	1		3			3	2		1						26
G	11	12	12	5	2	4	3	10	2	1				5
H		2			1	1		1
I		2	2	1	1	4	1	1		1	1
K		1	3	1								2
L	3	1	1	2	5		1		1		1
M	2	1	1		1	1	1	1							10
N		2		1	1	2			1					2
P	4	3	1	2				1	1	1	1
Q		1	1	4	2	1	2									3
R	2	2		2	1		2
S	2	6	4	4	5	3	5	3	2	2			1		1
T	2	1	2	6	3	3	6	1		1
V	4		1		1	2			1
W	2	1					1		2		1		1	1
X
Y	6	3	6	9	8	7	2	1	2	6	8	9	9	10		1
Z
—		1	1	2	8	10	16	23	30	30	31	32	30	22	7
unknown (?)									1			1	1	1
not sequenced	52	52	52	52	52	52	52	52	52	52	52	52	52	52	53	52
sum of seq 2	45	45	45	45	45	45	45	45	45	45	45	45	45	45	44	45
oomcaa 3	11	12	12	9	8	10	16	23	30	30	31	32	30	22	26	37
mcaa 4	G	G	G	Y	Y	—	—	—	—	—	—	—	—	—	F	D
rel. oomcaa 5	24%	27%	27%	20%	18%	22%	36%	51%	67%	67%	69%	71%	67%	49%	59%	82%
pos occupied 6	14	18	16	15	16	15	14	11	11	9	8	4	6	6	4	5
	Framework IV
	amino acid 1	102	103	104	105	106	107	108	109	110	111	112	113	Sum
	A												1	611
	B
	C													205
	D	1												458
	E				1									404
	F	2												256
	G			41		41								1065
	H													44
	I	9								2				588
	K				3									650
	L	2						25	1					549
	M							8						303
	N													64
	P	2					1					1		414
	Q				34									612
	R				3									351
	S	2										40	39	1545
	T	1					40	8		39				604
	V	11							40		41			594
	W		43											432
	X
	Y	13												738
	Z
	—	2												635
	unknown (?)													4
	not sequenced	52	54	56	56	56	56	56	56	56	56	56	57	1678
	sum of seq 2	45	43	41	41	41	41	41	41	41	41	41	40
	oomcaa 3	13	43	41	34	41	40	25	40	39	41	40	39
	mcaa 4	Y	W	G	Q	G	T	L	V	T	V	S	S
	rel. oomcaa 5	29%	100%	100%	83%	100%	98%	61%	98%	95%	100%	98%	98%
	pos occupied 6	10	1	1	4	1	2	3	2	2	1	2	2

TABLE 6G
Analysis of V heavy chain subgroup 6
	Framework I
amino acid 1	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18
A												1
B
C
D
E
F
G								52		67
H
I
K													68
L				52							68	1						67
M
N
P									68					67
Q	52		52		51	52										68
R					1					1
S							52							1	68
T																	68
V		52										66						1
W
X
Y
Z
—
unknown (?)
not sequenced	22	22	22	22	22	22	22	22	6	6	6	6	6	6	6	6	6	6	6	6
sum of seq 2	52	52	52	52	52	52	52	52	68	68	68	68	68	68	68	68	68	68	68	68
oomcaa 3	52	52	52	52	51	52	52	52	68	67	68	66	68	67	68	68	68	67	66	68
mcaa 4	Q	V	Q	L	Q	Q	S	G	P	G	L	V	K	P	S	Q	T	L	S	L
rel. oomcaa 5	100%	100%	100%	100%	98%	100%	100%	100%	100%	99%	100%	97%	100%	99%	100%	100%	100%	99%	97%	100%
pos occupied 6	1	1	1	1	2	1	1	1	1	2	1	3	1	2	1	1	1	2	3	1
	Framework I	CDRI
amino acid 1	19	20	21	22	23	24	25	26	27	28	29	30	31	A	B	32
A			1		67											66
B
C				68
D									68				1
E
F												2				1
G					1			69							3	1
H
I						64								2
K														3
L	1	68
M
N									1				2	66
P	1
Q
R													2	1
S	66		1			1	69			69		68	66		67
T			67										2	1	4
V					1	4					70					6
W				1
X
Y														1
Z
—
unknown (?)													1
not sequenced	6		5	5	5	5	5	5	5	5	4	4
sum of seq 2	6		69	69	69	69	69	69	69	69	70	70	74	74	74	74
oomcaa 3			67	68	67	64	69	69	68	69	70	68	66	66	67	66
mcaa 4			T	C	A	I	S	G	D	S	V	S	S	N	S	A
rel. oomcaa 5			97%	99%	97%	93%	100%	100%	99%	100%	100%	97%	89%	89%	91%	89%
pos occupied 6			3	2	3	3	1	1	2	1	1	2	5	6	3	4
	CDRI	Framework II
amino acid 1	33	34	35	36	37	38	39	40	41	42	43	44	45	46	47	48	49	50
A	67									1
B
C
D			1
E														74
F	1				1
G	2											74					74	1
H			1
I			1		70
K							1				1
L							1						74			74
M
N			70
P									73
Q							72
R						74					73							73
S	3		1					74	1	73
T	1
V					2
W		74		74											74
X
Y					1
Z
—
unknown (?)
not sequenced
sum of seq 2	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74
oomcaa 3	67	74	70	74	70	74	72	74	73	73	73	74	74	74	74	74	74	73
mcaa 4	A	W	N	W	I	R	Q	S	P	S	R	G	L	E	W	L	G	R
rel. oomcaa 5	91%	100%	95%	100%	95%	100%	97%	100%	99%	99%	99%	100%	100%	100%	100%	100%	100%	99%
pos occupied 6	5	1	5	1	4	1	3	1	2	2	2	1	1	1	1	1	1	2
	CDR II
amino acid 1	51	52	A	B	C	53	54	55	56	57	58	59	60	61	62	63
A	1					1							73	1
B
C												1
D											68			1
E									1		3			7
F		2	1			1			7
G							1				1				1
H			1						1
I														1
K				1			66			1
L									1					5		2
M
N							1		2	65	1
P													1	1
Q
R				72			1	1		1
S				1		72			2	2	1	1			73
T	73						5			4
V														58		72
W								73
X
Y		72	72						60	1		72
Z
—					74
unknown (?)
not sequenced
sum of seq 2	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74
oomcaa 3	73	72	72	72	74	72	66	73	60	65	68	72	73	58	73	72
mcaa 4	T	Y	Y	R	—	S	K	W	Y	N	D	Y	A	V	S	V
rel. oomcaa 5	99%	97%	97%	97%	100%	97%	89%	99%	81%	88%	92%	97%	99%	78%	99%	97%
pos occupied 6	2	2	3	3	1	3	5	2	7	6	5	3	2	7	2	2
	CDR II	Framework III
amino acid 1	64	65	66	67	68	69	70	71	72	73	74	75	76	77	78	79	80	81
A					2			6		1
B
C
D							2		73
E	1											2
F															71
G		8
H									1									2
I				65	2	71				1					1
K	67						1					70
L				4						1				1			74
M				1
N	1						69						74
P								66
Q	2		1											72				71
R	3		73											1				1
S		66			1		2	1			73					74
T					69	1				71	1	2
V				4		2		1							2
W
X
Y
Z
—
unknown (?)
not sequenced
sum of seq 2	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74	74
oomcaa 3	67	66	73	65	69	71	69	66	73	71	73	70	74	72	71	74	74	71
mcaa 4	K	S	R	I	T	I	N	P	D	T	S	K	N	Q	F	S	L	Q
rel. oomcaa 5	91%	89%	99%	88%	93%	96%	93%	89%	99%	96%	99%	95%	100%	97%	96%	100%	100%	96%
pos occupied 6	5	2	2	4	4	3	4	4	2	4	2	3	1	3	3	1	1	3
	Framework III	CDR III
amino acid 1	82	A	B	C	83	84	85	86	87	88	89	90	91	92	93	94	95	96
A							1			74					69		11	1
B
C														73
D		3						73									19	4
E							73										10	4
F			1										3		1		1	1
G								1							1		16	4
H		1																1
I											2							1
K		4														1	1	1
L	72																1	8
M	1			1							2							1
N		63											1				1	3
P						70												10
Q																	1	1
R		1												1		69	1	7
S		1	73		1	3										3	5	5
T		1			73				74			1					1	1
V	1			73							70				3	1	4	5
W																	1	6
X
Y												73	70					6
Z
—																		2
unknown (?)
not sequenced						1												1
sum of seq 2	74	74	74	74	74	73	74	74	74	74	74	74	74	74	74	74	73	72
oomcaa 3	72	63	73	73	73	70	73	73	74	74	70	73	70	73	69	69	19	10
mcaa 4	L	N	S	V	T	P	E	D	T	A	V	Y	Y	C	A	R	D	P
rel. oomcaa 5	97%	85%	99%	99%	99%	96%	99%	99%	100%	100%	95%	99%	95%	99%	93%	93%	26%	14%
pos occupied 6	3	7	2	2	2	2	2	2	1	1	3	2	3	2	4	4	14	20
	CDR III
amino acid 1	97	98	99	100	A	B	C	D	E	F	G	H	I	J	K	101
A	3	12	4	3	2	5		8						10	1
B
C	1		1			1		1	1
D	3	7	4	3	1	6	1	1	1							62
E	2	1	2	2	1	2							1
F	1		1	2	3		2			1					38	4
G	15	15	11	8	6	2	5	1	8	6	1			17
H		1			1	1	1	1				1	1	1
I	2		2		5	1
K	1	1	1	1				1
L	4	2	3	2	1					1	5				8
M				1			5								11
N	1	2	1	1	1	3		2		1		1	3
P	4		5	3		5	1		1
Q	1	1					1									1
R	8	1	8	8	3		1	1	5							1
S	5	7	6	7	3	4	2					1	1
T	4	3	4	4	6	3	1			1
V	1	9			4		9	5	1	1					2
W	8		3	2	4								4	4
X
Y	4	2	2	2	6	6	2	4	2	1	8	8	12	12
Z
—	3	7	14	23	25	33	41	47	53	54	57	56	50	28	12	4
unknown (?)										6	1	5
not sequenced	2	2	1	1	1	1	1	1	1	1	1	1	1	1	1	1
sum of seq 2	71	71	72	72	72	72	72	72	72	72	72	72	72	72	72	72
oomcaa 3	15	15	14	23	25	33	41	47	53	54	57	56	50	28	38	62
mcaa 4	G	G	—	—	—	—	—	—	—	—	—	—	—	—	F	D
rel. oomcaa 5	21%	21%	19%	32%	35%	46%	57%	65%	74%	75%	79%	78%	69%	39%	53%	86%
pos occupied 6	19	15	17	16	16	13	13	11	8	8	4	5	7	6	6	5
	Framework IV
	amino acid 1	102	103	104	105	106	107	108	109	110	111	112	113	Sum
	A							2						494
	B
	C													147
	D								1					403
	E													186
	F	2										2		150
	G			49		50								571
	H	2												18
	I	9					3		1					304
	K				1			1						293
	L	5						26						632
	M							8						31
	N													436
	P	4			6								1	387
	Q				40									539
	R				2									495
	S	4		1			1					43	46	1271
	T						45	4		45				640
	V	21						2	46		48			647
	W		65					5						398
	X
	Y	19												518
	Z
	—	2												585
	unknown (?)													13
	not sequenced	5	8	23	24	23	24	25	25	28	25	28	26	580
	sum of seq 2	68	65	50	49	50	49	48	48	45	48	45	47
	oomcaa 3	21	65	49	40	50	45	26	46	45	48	43	46
	mcaa 4	V	W	G	Q	G	T	L	V	T	V	S	S
	rel. oomcaa 5	31%	100%	98%	82%	100%	92%	54%	96%	100%	100%	96%	98%
	pos occupied 6	9	1	2	4	1	3	7	3	1	1	2	2

Appendix to Tables 1A-C

A. References of Rearranged Sequences

References of Rearranged Human Kappa Sequences Used for Alignment

1. Alescio-Zonta, L. Baglioni, C. (1970) Eur.J.Biochem., 15, 450-463.

2. Andrews, D. W. Capra, J. D. (1981) Biochemistry, 20, 5816-5822.

3. Andris, J. S., Ehrlich, P. H., Ostberg, L Capra. J. D. (1992) J.Immunol., 149, 4053-4059.

4. Atkinson, P. M., Lampman, G. W., Furie, B. C., Naparstek, Y., Schwartz, R. S., Stollar, B. D. Furie, B. (1985) J.Clin.Invest., 75, 1138-1143.

5. Aucouturier, P., Bauwens, M., Khamlichi, A. A., Denoroy, L. Spinelli, S., Touchard, G., Preud'homme, J.-L Cogne, M. (1993) J.Immunol., 150, 3561-3568.

6. Avila, M. A., Vazques, J., Danielsson, L., Fernandez De Cossio, M. E. Borrebaeck, C. A. K. (1993) Gene, 127, 273-274.

7. Barbas Iii, C. F., Crowe, Jr., J. E., Cababa, D., Jones, T. M., Zebedee, S. L., Murphy, B. R., Chanock, R. M. Burton, D. R. (1992) Proc.Natl.Acad.Sci.Usa, 89, 10164-10168.

8. Barbas, C. F., Iii, et al. (1993) J-Mol-Biol., 230, 812-23.

9. Bentley, D. L. Rabbitts, T. H. (1980) Nature, 288, 730-733.

10. Bentley, D. L. Rabbitts, T. H. (1983) Cell, 32, 181-189.

11. Bentley, D. L. (1984) Nature, 307, 77-80.

12. Bhat, N. M., Bieber, M. M., Chapman, C. J., Stevenson, F. K. Teng, N. N. H. (1993) J.Immunol., 151, 5011-5021.

13. Blaison, G., Kuntz, J.-L. Pasquali, J.-L. (1991) Eur.J.Immunol., 21, 1221-1227.

14. Braun, H., Leibold, W., Barnikol, H. U. Hilschmann, N. (1971) Z.Physiol.Chem., 352, 647-651; (1972) Z.Physiol.Chem., 353, 1284-1306.

15. Capra, J. D. Kehoe, J. M. (1975) Adv.Immunology, 20, 1-40.; Andrews, D. W. Capra, J. D. (1981) Proc.Nat.Acad.Sci.Usa, 78, 3799-3803.

16. Capra, J. D. Kehoe, J. M. (1975) Adv.Immunology, 20, 1-40.; Ledford, D. K., Goni, F., Pizzolato, M., Franklin, E. C., Solomon, A. Frangione, B. (1983) J.Immunol., 131, 1322-1325.

17. Chastagner, P., Theze, J. Zouali, M. (1991) Gene, 101, 305-306.

18. Chen, P. P., Robbins, D. L., Jirik, F. R., Kipps, T. J. Carson, D. A. (1987) J.Exp.Med, 166, 1900-1905.

19. Chen, P. P., Robbins, D. L., Jirik, F. R., Kipps, T. J. Carson, D. A (1987) J.Exp.Med, 166, 1900-1905; Liu, M.-F., Robbins, D. L., Crowley, J. J., Sinha, S., Kozin, F., Kipps, T. J., Carson, D. A. Chen. P. P. (1989) J.Immunol., 142, 688-694.

20. Chersi, A. Natali, P. G. (1978) Immunochemistry, 15, 585-589.

21. Co, M. S., Deschamps, M., Whitley, R. J. Queen, C. (1991) Proc.Natl.Acad.Sci.Usa, 88, 2869-2873.

22. Cuisinier, A.-M., Fumoux, F., Fougereau, M. Tonnelle, C. (1992) Mol.Immunol., 29, 1363-1373.

23. Davidson, A., Manheimer-Lory, A., Aranow, C., Peterson, R., Hannigan, N. Diamond, B. (1990) J.Clin.Invest., 85, 1401-1409.

24. Denomme, G. A., Mahmoudi, M., Edwards, J. Y., Massicotte, H., Cairns, E. Bell. D. A. (1993) Hum.Antibod.Hybridomas, 4, 98-103.

25. Dersimonian, H., Mcadam, K. P. W. J., Mackworth-Young, C. Stollar, B. D. (1989) J.Immunol., 142, 4027-4033.

26. Dreyer, W. J., Gray, W. R. Hood, L. (1967) Cold Spring Harbor Symp. Quantitative Biol., 32, 353-367.

27. Ebeling, S. B., Schutte, M. E. M. Logtenberg, T. (1993) Eur.J.Immunol., 23, 1405-1408.

28. Eulitz, M. Kley, H.-P. (1977) Immunochem., 14, 289-297.

29. Eulitz, M. Linke, R. P. (1982) Z.Physiol.Chem., 363, 1347-1358.

30. Eulitz, M., Breuer, M., Eblen, A., Weiss, D. T. Solomon, A. (1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P. Westermark, Kluwer Academic

31. Eulitz, M., Gotze, D. Hilschmann, N. (1972) Z.Physiol.Chem., 353, 487-491; Eulitz, M. Hilschmann, N. (1974) Z.Physiol.Chem., 355, 842-866.

32. Eulitz, M., Kley, H. P. Zeitler, HJ. (1979) Z.Physiol.Chem., 360, 725-734.

33. Ezaki, I., Kanda, H., Sakai, K., Fukui, N., Shingu, M., Nobunaga, M. Watanabe, T. (1991) Arthritis And Rheumatism, 34, 343-350.

34. Felgenhauer, M., Kohl, J. Ruker, F. (1990) Nucl.Acids Res., 18, 4927.

35. Ferri, G., Stoppini, M., Iadarola, P., Bellotti, V. Merlini, G. (1989) Biochim.Biophys.Acta, 995, 103-108.

36. Gillies, S. D., Dorai, H., Wesolowski, J., Majeau, G., Young, D., Boyd, J., Gardner, J. James, K. (1989) Bio/Tech., 7, 799-804.

37. Goni, F. Frangione, B. (1983) Proc.Nat.Acad.Sci.Usa, 80, 4837-4841.

38. Goni, F. R., Chen, P. P., Mcginnis, D., Arjonilla, M. L., Fernandez, J., Carson, D., Solomon, A., Mendez, E. Frangione, B. (1989) J.Immunol., 142, 3158-3163.

39. Gorman, S. D., Clark, M. R., Routledge, E. G., Cobbold, S. P. Waldmann, H. (1991) Proc.Natl.Acad.Sci.Usa, 88, 4181-4185.

40. Gottlieb, P. D., Cunningham, B. A., Rutishauser, U. Edelman, G. M. (1970) Biochemistry, 9, 3155-3161.

41. Griffiths, A. D., Malmqvist, M., Marks, J. D., Bye, J. M., Embleton, M. J., Mccafferty, J., Baier, M., Holliger, K. P., Gorick, B. D., Hughes-Jones, N. C., Hoogenboom, H. R. Winter, G. (1993) Embo J., 12, 725-734.

42. Hieter, P. A., Max, E. E., Seidman, J. G., Maizel, J. V., Jr. Leder, P. (1980) Cell, 22, 197-207; Klobeck, H. G, Meindl, A., Combriato, G., Solomon, A. E Zachau, H. G. (1985) Nucl.Acids Res., 13, 6499-6513; Weir, L. Leder, P. (1986)

43. Hilschmann, N. Craig, L. C. (1965) Proc.Natl.Acad.Sci.Usa, 53, 1403-1409; Hilschmann, N. (1967) Z.Physiol.Chem., 348, 1077-1080.

44. Hilschmann, N. Craig, L. C. (1965) Proc.Nat.Acad.Sci.Usa, 53, 1403-1409; Hilschmann, N. (1967) Z.Physiol.Chem., 348, 1718-1722; Hilschmann, N. (1969) Naturwissenschaften, 56, 195-205.

45. Hirabayashi, Y., Munakata, Y., Sasaki, T. Sario, H. (1992) Nucl.Acids Res., 20, 2601.

46. Jaenichen, H.-R., Pech, M., Lindenmaier, W., Wildgruber, N. Zachau, H. G. (1984) Nuc.Acids Res., 12, 5249-5263.

47. Jirik, F. R., Sorge, J., Fong, S., Heitzmann, J. G., Curd, J. G., Chen, P. P., Goldfien, R. Carson, D. A. (1986) Proc.Nat.Acad.Sci.Usa, 83, 2195-2199.

48. Kaplan, A. P. Metzger, H. (1969) Biochemistry, 8, 3944-3951.; Klapper, D. G. Capra, J. D. ( 1976) Ann.Immunol. (Inst.Pasteur), 127c, 261-271.

49. Kennedy, M. A. (1991) J.Exp.Med., 173, 1033-1036.

50. Kim, H. S. Deutsch, H. F. (1988) Immunol., 64, 573-579.

51. Kipps, T. J., Tomhave, E., Chen, P. P. Carson, D. A. (1988) J.Exp.Med., 167, 840-852.

52. Kipps, T. J., Tomhave, E., Chen, P. P. Fox, R. I. (1989) J.Immunol., 142, 4261-4268.

53. Klapper, D. G. Capra, J. D. (1976) Ann.Immunol. (Inst. Pasteur), 127c, 261-271.

54. Klein, U., Kuppers, R. Rajewsky, K. (1993) Eur.J.Immunol., 23, 3272-3277.

55. Klobeck, H. G, Meindl, A., Combriato, G., Solomon, A. Zachau, H. G. (1985) Nucl.Acids Res., 13, 6499-6513.

56. Klobeck, H. G., Bornkammm, G. W., Combriato, G., Mocikat, R., Pohlenz, H. D. Zachau, H. G. (1985) Nucl.Acids Res., 13, 6515-6529.

57. Klobeck, H. G., Combriato, G. Zachau, H. G. (1984) Nuc. Acids Res., 12, 6995-7006.

58. Klobeck, H. G., Solomon, A Zachau, H. G. (1984) Nature, 309, 73-76.

59. Knight, G. B., Agnello, V., Bonagura, V., Barnes, J. L., Panka, D. J. Zhang, Q.-X. (1993) J.Exp.Med., 178, 1903-1911.

60. Kohler, H., Shimizu, A., Paul, C. Putnam, F. W. (1970) Science, 169, 56-59. (Kaplan, A. P. Metzger, H. (1969) Biochemistry, 8, 3944-3951.)

61. Kratzin, H., Yang, C. Y., Krusche, J. U. Hilschmann, N. (1980) Z.Physiol.Chem., 361, 1591-1598.

62. Kunicki, T. J., Annis, D. S., Gorski, J. Nugent, D. J. (1991) J.Autoimmunity, 4, 433-446.

63. Larrick, J. W., Wallace, E. F., Coloma, M. J., Bruderer, U., Lang, A. B. Fry, K. E. (1992) Immunological Reviews, 130, 69-85.

64. Laure, C. J., Watanabe, S. Hilschmann, N. (1973) Z.Physiol.Chem., 354, 1503-1504.

65. Ledford, D. K, Goni, F., Pizzolato, M., Franklin, E. C., Solomon, A. Frangione, B. (1983) J.Immunol., 131, 1322-1325.

66. Ledford, D. K., Goni, F., Pizzolatv, M., Franklin, E. C., Solomon, A. Frangione, B. (1983) J.Immunol., 131, 1322-1325.

67. Ledford, D. K, Goni, F., Pizzolato, M., Franklin, E. C., Solomon, A. Frangione, B. (1983) J.Immunol., 131, 1322-1325. Pons-Estel, B., Goni, F., Solomon, A Frangione, B. (1984) J.Exp.Med., 160, 893.

68. Levy, S., Mendel, E., Kon, S., Avnur, Z. Levy, R. (1988) J.Exp.Med., 168, 475-489.

69. Liepnieks, J. J., Dwulet, F. E. Benson, M. D. (1990) Mol.Immunol., 27, 481-485.

70. Manheimer-Lory, A., Katz, J. B., Pillinger, M., Ghossein, C., Smith, A Diamond, B. (1991) J.Exp.Med., 174, 1639-1652.

71. Mantovani, L., Wilder, R. L. Casali, P. (1993) J.Immunol., 151, 473-488.

72. Mariette, X., Tsapis, A. Brouet, J.-C. (1993) Eur.J.Immunol., 23, 846-851.

73. Marks, J. D., Hoogenboom, H. R., Bonnert, T. P., Mccafferty, J., Griffiths, A. D. Winter, G. (1 991) J.Mol.Biol., 222, 581-597.

74. Marsh, P., Mills, F. Gould, H. (1985) Nuc.Acids Res., 13, 6531-6544.

75. Middaugh, C. R. Litman, G. W. (1987) J.Biol.Chem., 262, 3671-3673.

76. Milstein, C. Deverson, E. V. (1971) Biochem.J., 123, 945-958.

77. Milstein, C. (1969) Febs Letters, 2, 301-304.

78. Milstein, C. (1969) Febs Letters, 2, 301-304.

79. Milstein, C. P. Deverson, E. V. (1974) Eur.J.Biochem., 49, 377-391.

80. Moran, M. J., Andris, J. S., Matsumato, Y.-I., Capra, J. D. Hersh, E. M. (1993) Mol.Immunol., 30, 1543-1551.

81. Nakatani, T., Nomura, N., Horigome, K., Ohtsuka, H. Noguchi, H. (1989) Bio/Tech., 7, 805-810.

82. Newkirk, M., Chen, P. P., Carson, D., Posnett, D. Capra, J. D. (1986) Mol.Immunol., 23, 239-244.

83. Newkirk, M. M., Gram, H., Heinrich, G. F., Ostberg, L., Capra, J. D. Wasserman, R. L (1988) J.Clin.Invest., 81, 1511-1518.

84. Newkirk, M. M., Mageed, R. A., Jefferis, R., Chen, P. P. Capra, J. D. (1987) J.Exp.Med., 166, 550-564.

85. Olee, B. T., Lu, E. W., Huang, D.-F., Soto-Gil, R. W., Deftos, M., Kozin, F., Carson, D. A Chen, P. P. (1992) J.Exp.Med., 175, 831-842.

86. Palm, W. Hilschmann, N. (1973) Z.Physiol.Chem., 354, 1651-1654; (1975) Z.Physiol.Chem., 356, 167-191.

87. Pascual, V., Victor, K., Lelsz, D., Spellerberg, M. B., Hamblin, T. J., Thompson, K. M., Randen, I., Natvig, J., Capra, J. D. Stevenson, F. K. (1991) J.Immunol., 146, 4385-4391.

88. Pascual, V., Victor, K., Randen, I., Thompson, K., Steinitz, M., Forre, O., Fu, S.-M., Natvig, J. B. Capra, J. D. (1992) Scand.J.Immunol., 36, 349-362.

89. Pech, M. Zachau, H. G. (1984) Nuc.Acids Res., 12, 9229-9236.

90. Pech, M., Jaenichen, H.-R., Pohlenz, H.-D., Neumaier, P. S., Klobeck, H.-G. Zachau, H. G. (1984) J.Mol.Biol., 176, 189-204.

91. Pons-Estel, B., Goni, F., Solomon, A Frangione, B. (1984) J.Exp.Med., 160, 893-904.

92. Portolano, S., Mclachlan, S. M. Rapoport, B. (1993) J.Immunol., 151, 2839-2851.

93. Portolano, S., Seto, P., Chazenbalk, G. D., Nagayama, Y., Mclachlan, S. M. Rapoport, B. (1991) Biochem.Biophys.Res.Commun., 179, 372-377.

94. Pratt, L. F., Rassenti, L., Larrick, J., Robbins, B., Banks, P. M. Kipps, TJ. (1989) J.Immunol., 143. 699-705.

95. Preili, F., Tummolo, D., Solomon, A Frangione. B. (1986) J.Immunol., 136, 4169-4173.

96. Putnam, F. W., Whitley, E. J., Jr., Paul, C. Davidson, J. N. (1973) Biochemistry, 12, 3763-3780.

97. Randen, I., Pascual, V., Victor, K., Thompson, K. M., Forre, O., Capra, J. D. Natvig, J. B. (1993) Eur.J.Immunol., 23, 1220-1225.

98. Rassenti, L. Z., Pratt, L. F., Chen, P. P., Carson, D. A Kipps, T. J. (1991) J.Immunol., 147, 1060-1066.

99. Reidl, L. S., Friedman, D. F., Goldman, J., Hardy, R. R., Jefferies, L. C. Silberstein, L. E. (1991) J.Immunol., 147, 3623-3631.

100. Riechmann, L., Clark, M., Waldmann, H. Winter, G. (1988) Nature, 332, 323-327.

101. Riesen, W., Rudikoff, S., Oriol, R. Potter, M. (1975) Biochemistry, 14, 1052-1057; Riesen, W. F., Braun, D. G. Jaton, J. C. (1976) Proc.Nat.Acad.Sci.Usa, 73, 2096-2100; Riesen, W. F. Jaton, J. C. (1976) Biochemistry, 15, 3829.

102. Rodilla Sala, E., Kratzin, D. H., Pick, A. l. Hilschmann, N. (1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P. Westermark, Kluwer Academic

103. Schiechl, H. Hilschmann, N. (1971) Z.Physiol.Chem., 352, 111-115; (1972) Z.Physiol.Chem., 353, 345-370.

104. Schneider, M. Hilschmann, N. (1974) Z.Physiol.Chem., 355, 1164-1168.

105. Shearman, C. W., Pollock, D., White, G., Hehir, K., Moore, G. P., Kanzy, E. J. Kurrle, R. (1991) J.Immunol., 147, 4366-4373.

106. Shinoda, T. (1973) J.Biochem., 73, 433-446.

107. Shinoda, T. (1975) J.Biochem., 77, 1277-1296.

108. Shinoda, T., Takenawa, T., Hoshi, A. Isobe, T. (1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P. Westermark, Kluwer Academic Publishers, Dordrecht/Boston/London, Pp. 157-

109. Silberstein, L. E., Litwin, S. Carmack, C. E. (1989) J.Exp.Med., 169, 1631-1643.

110. Sims, M. J., Hassal, D. G., Brett, S., Rowan, W., Lockyer, M. J., Angel, A., Lewis, A. P., Hale, G., Waldmann, H. Crowe, J. S. (1993) J.Immunol., 151, 2296-2308.

111. Spatz, L. A., Wong, K. K., Williams, M., Desai, R., Golier, J., Berman, J. E., Alt, F. W. Latov. N. (1990) J.Immunol., 144, 2821-2828.

112. Stavnezer, J., Kekish, O., Batter, D., Grenier, J., Balazs, I., Henderson, E. Zegers, B. J. M. (1985) Nucl.Acids Res., 13, 3495-3514.

113. Straubinger, B., Thiebe, R., Pech, M. Zachau. H. G. (1988) Gene. 69, 209-214.

114. Suter, L., Barnikol, H. U., Watanabe, S. Hilschmann, N. (1969) Z.Physiol.Chem., 350, 275-278; (1972) Z.Physiol.Chem., 353, 189-208.

115. Tempest. P. R., Bremner, P., Lambert, M., Taylor, G., Furze, J. M., Carr, FJ. Harris, W. J. (1991) Bio/Tech., 9, 266-271.

116. Titani, K., Shinoda, T. Putnam, F. W. (1969) J.Biol.Chem., 244, 3550-3560.

117. Toft, K. G., Olstad, O. K., Sletten, K. Westermark, P. (1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P. Westernmark, Kluwer Academic.

118. Van E s, J. H., Aanstoot, H., Gmelig-Meyling, F. H. J., Derksen, R. H. W. M. Logtenberg, T. (1992) J.Immunol., 149, 2234-2240.

119. Victor, K. D., Pascual, V., Lefvert, A. K. Capra, J. D. (1992) Mol.Immunol., 29, 1501-1506.

120. Victor, K. D., Pascual, V., Williams, C. L., Lennon, V. A Capra, J. D. (1992) Eur.J.Immunol., 22, 2231-2236.

121. Victor, K. D., Randen, I., Thompson, K., Forre, O., Natvig, J. B., Fu, S. M. Capra, J. D. (1991) J.Clin.Invest., 87, 1603-1613.

122. Wagner, S. D. Luzzatto. L. (1993) Eur.J.Immunol., 23, 391-397.

123. Watanabe, S. Hiischmann, N. (1970) Z.Physiol.Chem., 351, 1291-1295.

124. Weisbart, R. H., Wong, A. L., Noritake, D., Kacena, A., Chan, G., Ruland, C., Chin, E., Chen, I. S. Y. Rosenblatt, J. D. (1991) J.Immunol., 147,2795-2801.

125. Weng, N.-P., Yu-Lee, L.-Y., Sanz, I., Patten, B. M. Marcus, D. M. (1992) J.Immunol., 149, 2518-2529.

126. Winkler, T. H., Fehr, H. Kalden, J. R. (1992) Eur.J.Immunol., 22, 1719-1728.

References of Rearranged Human Lambdo Sequences Used for Alignment

1. Alexandre, D., Chuchana, P., Brockly, F., Blancher, A., Lefranc, G. Lefranc, M.-P. (1989) Nuc.Acids Res., 17, 3975.

2. Anderson, M. L. M., Brown, L., Mckenzie, E., Kellow, J. E. Young, B. D. (1985) Nuc.Acids Res, 13, 2931-2941.

3. Andris, J. S., Brodeur, B. R. Capra, J. D. (1993) Mol.Immunol., 30, 1601-1616.

4. Andris, J. S., Ehrlich, P. H., Ostberg, L. Capra, J. D. (1992) J.Immunol., 149, 4053-4059.

5. Baczko, K., Braun, D. G., Hess, M. Hiischmann, V. (1970) Z.Physiol.Chem., 351, 763-767; Baczko, K., Braun, D. G. Hilschmann, N. (1974) Z.Physiol.Chem., 355, 131-154.

6. Berinstein, N., Levy, S. Levy, R. (1989) Science, 244, 337-339.

7. Bhat, N. M., Bieber, M. M., Chapman, C. J., Stevenson, F. K. Teng, N. N. H. (1993) J.Immunol., 151, 5011-5021.

8. Cairns, E., Kwong, P. C., Misener, V., Ip, P., Bell, D. A. Siminovitch, K. A. (1989) J.Immunol, 143, 685-691.

9. Carroll, W. L., Yu, M., Link, M. P. Korsmeyer, S. J. (1989) J.Immunol., 143, 692-698.

10. Chen, B. L Poijak, R. J. (1974) Biochemistry, 13, 1295-1302.

11. Chen, B. L., Chiu, Y. Y. H., Humphrey, R. L. Poijak, R. J. (1978) Biochim.Biophys.Acta, 537, 9-21.

12. Combriato, G. Klobeck, H. G. (1991) Eur.J.Immunol., 21, 1513-1522.

13. Cuisinier, A.-M., Fumoux, F., Fougereau, M. Tonnelle, C. (1992) Mol.Immunol., 29, 1363-1373.

14. Dwulet. F. E., Strako, K. Benson, M. D. (1985) Scand.J.Immunol., 22, 653-660.

15. Elahna, P., Livneh, A., Manheimer-Lory, A. J. Diamond, B. (1991) J.Immunol., 147,2771-2776.

16. Engelhard, M., Hess, M. Hilschmann, N. (1974) Z.Physiol.Chem., 355, 85-88; Engelhard, M. Hilschmann, N. (1975) Z.Physiol.Chem., 356, 1413-1444.

17. Eulitz, M. (1974) Eur.J.Biochem., 50, 49-69.

18. Eulitz, M., Breuer, M. Linke, R. P. (1987) Biol.Che.Hoppe-Seyler, 368, 863-870.

19. Eulitz, M., Murphy, C., Weiss, D. T. Solomon, A. (1991) J.Immunol., 146,3091-3096.

20. Fett, J. W. Deutsch, H. F. (1974) Biochemistry, 13, 4102-4114.

21. Fett, J. W. Deutsch, H. F. (1976) Immunochem., 13, 149-155.; Jabusch, J. R. Deutsch, H. F. ( 1982) Mol.Immunol., 19, 901-906.

22. Furey, W. Jr., Wang, B. C., Yoo, C. S. Sax, M. (1983) J. Mol. Biol., 167, 661-692.

23. Fykse, E.-M., Sletten, K., Husby, G. Cornwell, G. G., Iii (1988) Biochem.J., 256, 973-980.

24. Garver, F. A. Hiischmann, N. (1971) Febs Letters, 16, 128-132; (1972) Eur.J.Biochem., 26, 10-32.

25. Gawinowicz, M. A., Merlini, G., Birken, S., Osserman, E. F. Kabat, E. A. (1991) J.Immunol., 147, 915-920.

26. Ghiso, J., Solomon, A. Frangione, B. (1986) J.Immunol., 136, 716-719.

27. Griffiths, A. D., Malmqvist, M., Marks, J. D., Bye, J. M., Embleton, M. J., Mccafferty, J., Baier, M., Holliger, K. P., Gorick, B. D., Hughes-Jones, N. C., Hoogenboom, H. R. Winter, G. (1993) Embo J., 12, 725-734.

28. Gullasken, N., Idso, H., Nilsen, R., Sletten, K., Husby, G. Cornwell, G. G. (1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P. Westermark, Kluwer Academic.

29. Harindranath, N., Goldfarb, I. S., Ikematsu, H., Burastero, S. E., Wilder, R. L., Notkins, A. L. Casali, P. (1991) Int.Immunol., 3, 865-875.

30. Holm, E., Sletten, K. Husby, G. (1986) Biochem.J., 239, 545-551.

31. Hughes-Jones, N. C., Bye, J. M., Beale, D. Coadwell, J. (1990) BiochemJ., 268, 135-140.

32. Kametani, F., Yoshimura, K., Tonoike, H., Hoshi, A., Shinoda, T. Isobe, T. (1985) Biochem.Biophys.Res.Commun., 126, 848-852.

33. Kiefer, C. R., Mcguire, B. S., Jr., Osserman, E. F. Garver, F. A. (1983) J.Immunol., 131, 1871-1875.

34. Kiefer, C. R., Patton, H. M., Jr., Mcquire, B. S., Jr. Garver, F. A. (1980) J.Immunol., 124, 301-306.

35. Kishimoto, T., Okajima, H., Okumoto, T. Taniguchi, M. (1989) Nucl.Acids Res., 17, 4385.

36. Klafki, H.-W., Kratzin, H. D., Pick, A. I., Eckart, K. Hilschmann, N. (1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P. Westermark, Kluwer Academic.

37. Kohler, H., Rudofsky, S. Kluskens, L. (1975) J.Immunology, 114, 415-421.

38. Kojima, M., Odani, S. Ikenaka, T. (1980) Mol.Immunol., 17, 1407-1414.

39. Komori, S., Yamasaki, N., Shigeta, M., Isojima, S. Watanabe, T. (1988) Clin.Exp.Immunol., 71, 508-516.

40. Kratzin, H. D., Palm, W., Stangel, M., Schmidt, W. E., Friedrich, J. Hilschmann, N. (1989) Biol.Chem.Hoppe-Seyler, 370, 263-272.

41. Kratzin, H. D., Pick, A. I., Stangel, M. Hilschmann, N. (1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P. Westermark, Kluwer Academic Publishers, Dordrecht/Boston/London, Pp. 181-

42. Langer, B., Steinmetz-Kayne, M. Hilschmann, N. (1968) Z.Physiol.Chem., 349, 945-951.

43. Larrick, J. W., Danielsson, L., Brenner, C. A., Wallace, E. F., Abrahamson, M., Fry, K. E. Borrebaeck, C. A. K. (1989) Bio/Tech., 7, 934-938.

44. Levy, S., Mendel, E., Kon, S., Avnur, Z. Levy, R. (1988) J.Exp.Med., 168, 475-489.

45. Lewis, A. P., Lemon, S. M., Barber, K. A., Murphy, P., Parry, N. R., Peakman, T. C, Sims, M. J., Worden, J. Crowe, J. S. (1993) J.Immunol., 151, 2829-2838.

46. Liu, V. Y. S., Low, T. L. K, Infante, A Putnam, F. W. (1976) Science, 193, 1017-1020; Infante, A Putnam, F. W. (1979) J.Biol.Chem., 254, 9006-9016.

47. Lopez De Castro, J. A., Chiu, Y. Y. H. Poijak, R. J. (1978) Biochemistry, 17, 1718-1723.

48. Mantovani, L., Wilder, R. L. Casali, P. (1993) J.Immunol., 151, 473-488.

49. Marks, J. D., Hoogenboom, H. R., Bonnert, T. P., Mccafferty, J., Griffiths, A. D. Winter, G. (1991) J.Mol.Bioi, 222, 581-597.

50. Mihaesco, E., Roy, J.-P., Congy, N., Peran-Rivat, L. Mihaesco, C. (1985) Eur.J.Biochem., 150,349-357.

51. Milstein, C., Clegg, J. B. Jarvis, J. M. (1968) Biochem.J., 110, 631-652.

52. Moran, M. J., Andris, J. S., Matsumato, Y.-I., Capra, J. D. Hersh, E. M. (1993) Mol.Immunol., 30,1543-1551.

53. Nabeshima, Y. Ikenaka, T. (1979) Mol.Immunol., 16, 439-444.

54. Olee, B. T., Lu, E. W., Huang, D.-F., Soto-Gil, R. W., Deftos, M., Kozin, F., Carson, D. A. Chen, P. P. (1992) J.Exp.Med., 175, 831-842.

55. Pascual, V., Victor, K., Randen, I., Thompson, K., Steinitz, M., Forre, O, Fu, S.-M., Natvig, J. B. Capra, J. D. (1992) Scand.J.Immunol., 36, 349-362.

56. Paul, E., Iliev, A. A., Livneh, A. Diamond, B. (1992) J.Immunol., 149, 3588-3595.

57. Pick, A. I., Kratzin, H. D., Barnikol-Watanabe, S. Hilschmann, N. (1990) In Amyloid And Amyloidosis, Eds. J. B. Natvig, O. Forre, G. Husby, A. Husebekk, B. Skogen, K. Sletten P. Westermark, Kluwer Academic.

58. Ponstingl, H. Hilschmann, N. (1969) Z.Physiol.Chem., 350, 1148-1152; (1971) Z.Physiol.Chem., 352, 859-877.

59. Ponstingl, H., Hess, M. Hilschmann, N. (1968) Z.Physiol.Chem., 349, 867-871: (1977) Z.Physiol.Chem., 352, 247-266.

60. Randen, I., Pascual, V., Victor, K., Thompson, K. M., Forre, O., Capra, J. D. Natvig, J. B. (1993) Eur.J.Immunol., 23, 1220-1225.

61. Scholz, R. Hilschmann, N. (1975) Z.Physiol.Chem., 356, 1333-1335.

62. Settmacher, U., Jahn, S., Siegel, P., Von Baehr, R. Hansen, A. (1993) Mol.Immunol., 30, 953-954.

63. Shinoda, T., Titani, K. Putnam, F. W. (1970) J.Biol.Chem., 245, 4475-4487.

64. Sletten, K., Husby, G. Natvig, J. B. (1974) Scand.J.Immunol., 3, 833-836.; Sletten, K., Natvig, J. B., Husby, G. Juul, J. (1981) Biochem.J., 195, 561-572.

65. Solomon, A., Frangione, B. Franklin, E. C. (1982) J.Clin.Invest., 70, 453-460.; Frangione, B., Moloshok, T. Solomon, A. (1983) J.Immunol., 131, 2490-2493.

66. Takahashi, N., Takayasu, T., Isobe, T., Shinoda, T., Okuyama, T. Shimizu, A. (1979) J.Biochem., 86, 1523-1535.

67. Takahashi, N., Takayasu, T., Shinoda, T., Ito, S., Okuyama, T. Shimizu, A. (1980) Biomed.Res., 1, 321-333.

68. Takahashi, Y., Takahashi, N., Tetaert, D. Putnam, F. W. (1983) Proc.Nat.Acad.Sci.Usa, 80, 3686-3690.

69. Takayasu, T., Takahashi, N., Shinoda, T., Okuyama, T. Tomioka, H. (1980) J.Biochem., 89, 421-436.

70. Titani, K., Wikier, M., Shinoda, T. Putnam, F. W. (1970) J.Biol.Chem., 245, 2171-2176.

71. Toft, K. G., Sletten, K. Husby, G. (1985) Biol. Chem. Hoppe-Seyler, 366, 617-625.

72. Tonoike, H., Kametani, F., Hoshi, A., Shinoda, T. Isobe, T. (1985) Biochem.Biophys.Res.Commun., 126,1228-1234.

73. Tonoike, H., Kametani, F., Hoshi, A., Shinoda, T. Isobe, T. (1985) Febs Letters, 185, 139-141.

74. Tsujimoto, Y. Croce, C. M. (1984) Nucl.Acids Res., 12,8407-8414.

75. Tsunetsugu-Yokota. Y., Minekawa. T., Shigemoto, K., Shirasawa, T. Takemori, T. (1992) Mol.Immunol., 29, 723-728.

76. Tveteraas, T., Sletten, K. Westermark, P. (1985) Biochem.J., 232, 183-190.

77. Vasicek, T. J. Leder, P. (1990) J.Exp.Med., 172, 609-620.

78. Victor, K. D., Randen, I., Thompson, K., Forre, O., Natvig, J. B., Fu, S. M. Capra, J. D. (1991) J.Clin.Invest., 87, 1603-1613.

79. Weng, N.-P., Yu-Lee, L.-Y., Sanz, I., Patten, B. M. Marcus, D. M. (1992) J.Immunol., 149, 2518-2529.

80. Wikler, M. Putnam, F. W. (1970) J.Biol.Chem., 245, 4488-4507.

81. Winkler, T. H., Fehr, H. Kalden, J. R. (1992) Eur.J.Immunol., 22, 1719-1728.

82. Yago, K., Zenita, K., Ohwaki, I., Harada, Y., Nozawa, S., Tsukazaki, K., Iwamori, M., Endo, N., Yasuda, N., Okuma, M. Kannagi, R. (1993) Mol.Immunol., 30, 1481-1489.

83. Yamasaki, N., Komori, S. Watanabe, T. (1987) Mol.Immunol., 24, 981-985.

84. Zhu, D., Kim, H. S. Deutsch, H. F. (1983) Mol.Immunol., 20, 1107-1116.

85. Zhu, D., Zhang, H., Zhu, N. Luo, X. (1986) Scientia Sinica, 29, 746-755.

References of Rearranged Human Heavy Chain Sequences Used for Alignment

1. Adderson, E. E., Azmi, F. H., Wilson, P. M., Shackelford. P. G. Carroll, W. L. (1993) J.Immunol., 151, 800-809.

2. Adderson, E. E., Shackelford, P. G., Quinn, A. Carroll, W. L. (1991) J.Immunol., 147, 1667-1674.

3. Akahori, Y., Kurosawa, Y., Kamachi, Y., Torii, S. Matsuoka, H1. (1990) J.Clin.Invest., 85, 1722-1727.

4. Andris, J. S., Brodeur, B. R. Capra, J. D. (1993) Mol.Immunol., 30, 1601-1616.

5. Andris, J. S., Ehrlich, P. H., Ostberg, L. Capra, J. D. (1992) J.Immunol., 149, 4053-4059.

6. Andris, J. S., Johnson, S., Zolla-Pazner, S. Capra, J. D. (1991) Proc.Natl.Acad.Sci.Usa, 88, 7783-7787.

7. Anker, R., Conley, M. E. Pollok, B. A. (1989) J.Exp.Med., 169, 2109-2119.

8. Atkinson, P. M., Lampman, G. W., Furie, B. C., Naparstek, Y., Schwartz, R. S., Stollar, B. D. Furie, B. (1985) J.Clin.Invest., 75, 1138-1143.; Lampman, G. W., Furie, B., Schwartz, R. S., Stollar, B. D. Furie, B. C. (1989)

9. Avila, M. A., Vazques, J., Danielsson, L., Fernandez De Cossio, M. E. Borrebaeck, C. A. K. (1993) Gene, 127, 273-274.

1. Bakkus, M. H. C., Heirman, C., Van Riet, I., Van Camp, B. Thielemans, K. (1992) Blood, 80, 2326-2335.

11. Barbas Iii, C. F., Crowe, Jr., J. E., Cababa, D., Jones, T. M., Zebedee, S. L., Murphy, B. R., Chanock, R. M. Burton, D. R. (1992) Proc.Natl.Acad.Sci.Usa, 89, 10164-10168.

12. Barbas, C. F., Iii, Collet, T. A., Amberg, W., Roben, P., Binley, J. M., Hoekstra, D., Cababa, D., Jones, T. M., Williamson, R. A., Pilkington, G. R., Haigwood, N. L., Cabezas, E., Satterthwait, A. C., Sanz, . Burton, D. R. (1993) J.Biol.Miol., 230, 812-823.

13. Berman, J. E., Humphries, C. G., Barth, J., Alt, F. W. Tucker, P. W. (1991) J.Exp.Med., 173, 1529-1535.

14. Berman, J. E., Mellis, S. J., Pollock, R., Smith, C. L., Suh, H., Heinke, B., Kowal, C., Surti, U., Chess, L., Cantor, C. R. Alt, F. W. (1988) Embo J., 7, 727-738.

15. Bhat, N. M., Bieber, M. M., Chapman, C. J., Stevenson, F. K. Teng, N. N. H. (1993) J.Immunol., 151,5011-5021.

16. Bird, J., Galili, N., Link, M., Stites, D. Sklar, J. (1988) J.Exp.Med., 168, 229-245.

17. Cai, J., Humphries, C., Richardson, A. Tucker, P. W. (1992) J.Exp.Med., 176, 1073-1081.

18. Cairns, E., Kwong, P. C., Misener, V., Ip, P., Bell, D. A. Siminovitch, K. A. (1989) J.Immunol., 143, 685-691.

19. Capra, J. D. Hopper, J. E. (1976) Immunochemistry, 13, 995-999; Hopper, J. E., Noyes, C., Heinrikson, R. Kessel, J. W. (1976) J.Immunol., 116, 743-746.

20. Capra, J. D. Kehoe, J. M. (1974) Proc.NatAcad.Sci.Usa, 71, 845-848.

21. Carroll, W. L., Yu, M., Link, M. P. Korsmeyer, S. J. (1989) J.Immunol., 143, 692-698.

22. Chen, P. P., Liu, M.-F., Glass, C. A., Sinha, S., Kipps, T. J. Carson, D. A (1989) Arthritis Rheumatism, 32, 72-76; Kipps, T. J., Tomhave, E., Pratt, L. F., Duffy, S., Chen, P. P. Carson, D. A. (1989) Proc.Natl.Acad.Sci.Usa, 86, 5913-5917.

23. Chiu, Y. Y. H., Lopez De Castro, J. A Poijak, R. J. (1979) Biochemistry, 18, 553-560.

24. Cleary, M. L., Meeker, T. C., Levy, S., Lee, E., Trela, M., Sklar, J. Levy, R. (1986) Cell, 44,97-106.

25. Cuisinier, A.-M., Fumoux, F., Fougereau, M. Tonnelle, C. (1992) Mol.Immunol., 29, 1363-1373.

26. Cuisinier, A.-M., Gauthier, L., Boubli, L., Fougereau, M. Tonnelle, C. (1993) Eur.J.Immunol., 23, 110-118.

27. Cunningham, B. A., Gottlieb. P. D., Pflumm, M. N. Edelman, G. M. (1971) Progress In Immunology (B.Amos, Ed.), Academic Press, N.Y., Pp. 3-24.

28. Cunningham, B. A., Rutishauser, U., Gall, W. E., Gottlieb, P. D., Waxdal, M. J. Edelman, G. M. (1970) Biochemistry, 9, 3161-3170.

29. Deane, M. Norton, J. D. (1990) Eur.J.Immunol., 20, 2209-2217.

30. Deane, M. Norton, J. D. (1991) Leukemia, 5, 646-650.

31. Dersimonian, H., Schwartz, R. S., Barrett, K. J. Stollar, B. D. (1987) J.Immunol., 139, 2496-2501.

32. Dersimonian, H., Schwartz, R. S., Barrett, K. J. Stollar, B. D. (1987) J.Immunol., 139, 2496-2501; Chen, P. P., Liu, M.-F., Sinha, S. Carson, D. A. (1988) Arth.Rheum., 31, 1429-1431.

33. Desai, R., Spatz, L., Matsuda, T., Ilyas, A. A., Berman, J. E., Alt, F. W., Kabat, E. A. Latov, N. (1990) J.Neuroimmunol., 26, 35-41.

34. Ezaki, I., Kanda, H., Sakai, K., Fukui, N., Shingu, M., Nobunaga, M. Watanabe, T. (1991) Arthritis And Rheumatism, 34, 343-350.

35. Felgenhauer, M., Kohl, J. Ruker, F. (1990) Nucl.Acids Res., 18, 4927.

36. Florent, G., Lehman, D. Putnam, F. W. (1974) Biochemistry, 13, 2482-2498.

37. Friedlander, R. M., Nussenzweig, M. C. Leder, P. (1990) Nucl.Acids Res., 18, 4278.

38. Gawinowicz, M. A., Merlini, G., Birken, S., Osserman, E. F. Kabat, E. A. (1991) J.Immunol., 147, 915-920.

39. Gillies, S. D., Dorai, H., Wesolowski, J., Majeau, G., Young, D., Boyd, I., Gardner, J. James, K. (1989) Bio/Tech., 7, 799-804.

40. Goni, F. Frangione, B. (1983) Proc.Nat.Acad.Sci.Usa, 80, 4837-4841.

41. Gorman, S. D., Clark, M. R., Routledge, E. G., Cobbold, S. P. Waldmann, H. (1991) Proc.Natl.Acad.Sci.Usa, 88, 4181-4185.

42. Griffiths, A. D., Malmqvist, M., Marks, J. D., Bye, J. M., Embleton, M. J., Mccafferty, J., Baier, M., Holliger, K. P., Gorick, B. D., Hughes-Jones, N. C, Hoogenboom, H. R. Winter, G. (1993) Embo J., 12, 725-734.

43. Grillot-Courvalin, C., Brouet, J.-C., Piller, F., Rassenti, L. Z., Labaume, S., Silverman, G. J., Silberstein, L. Kipps, T. J. (1992) Eur.J.Immunol., 22, 1781-1788.

44. Guillaume, T., Rubinstein, D. B., Young, F., Tucker, L., Logtenberg, T., Schwartz, R. S. Barrett, K. L. (1990) J.Immunol., 145, 1934-1945;Young, F., Tucker, L., Rubinstein, D., Guillaume, T., Andre-Schwartz, J., Barrett, K. J., Schwartz, R. S. Logtenberg, T. (1990)

45. Harindranath, N., Goldfarb, I. S., Ikematsu, H., Burastero, S. E., Wilder, R. L., Notkins, A. L. Casali, P. (1991) Int.Immunol., 3, 865-875.

46. Hillson, J. L., Oppliger, I. R., Sasso, E. H., Milner, E. C. B. Wener, M. H. (1992) J.Immunol., 149, 3741-3752.

47. Hirabayashi, Y., Munakata, Y., Sasaki, T. Sano, H. (1992) Nucl.Acids Res., 20, 2601.

48. Hoch, S. Schwaber, J. (1987) J.Immunol., 139, 1689-1693.

49. Huang, C., Stewart, A. K., Schwartz, R. S. Stollar, B. D. (1992) J.Clin.Invest., 89, 1331-1343.

50. Hughes-Jones, N. C., Bye, J. M., Beale, D. Coadwell, J. (1990) Biochem.J., 268, 135-140.

51. Ikematsu, H., Harindranath, N., Ueki, Y., Notkins, A. L. Casali, P. (1993) J.Immunol., 150, 1325-1337.

52. Ikematsu, H., Kasaian, M. T., Schettino, E. W. Casali, P. (1993) J.Immunol., 151, 3604-3616.

53. Kelly, P. J., Pascual, V., Capra, J. D. Lipsky, P. E. (1992) J.Immunol., 148, 1294-1301.

54. Kipps, T. J. Duffy, S. F. (1991) J.Clin.Invest., 87, 2087-2096.

55. Kipps, T. J., Tomhave, E., Pratt, L. F., Duffy, S., Chen, P. P. Carson, D. A. (1989) Proc.Natl.Acad.Sci.Usa, 86, 5913-5917.

56. Kishimoto, T., Okajima, H., Okumoto, T. Taniguchi, M. (1989) Nucl.Acids Res., 17, 4385.

57. Knight, G. B., Agnello, V., Bonagura, V., Barnes, J. L., Panka, D. J. Zhang, Q.-X (1993) J.Exp.Med., 178, 1903-1911.

58. Kohler, H., Shimizu, A., Paul, C., Moore, V. Putnam, F. W. (1970) Nature, 227, 1318-1320. Florent, G., Lehman, D. Putnam, F. W. (1974) Biochemistry, 13, 2482-2498

59. Komori, S., Yamasaki, N., Shigeta, M., Isojima, S. Watanabe, T. (1988) Clin.Exp.Immunol., 71, 508-516.

60. Kon, S., Levy, S. Levy, R. (1987) Proc.Natl.Acad.Sci.Usa, 84, 5053-5057.

61. Kratzin, H., Altevogt, P., Ruban, E., Kortt, A., Staroscik, K. Hilschmann, N. (1975) Z.Physiol.Chem., 356, 1337-1342; Kratzin, H., Altevogt, P., Kortt, A., Ruban, E. Hilschmann, N. (1978) Z.Physiol.Chem., 359, 1717-1745.

62. Kudo, A., Ishihara, T., Nishimura, Y. Watanabe, T. (1985) Gene, 33. 181-189.

63. Kunicki, T. J., Annis, D. S., Gorski, J. Nugent, D. J. (1991) J.Autoimmunity, 4, 433-446.

64. Larrick, J. W., Wallace, E. F., Coloma, M. J., Bruderer, U., Lang, A. B. Fry, K. E. (1992) Immunological Reviews, 130, 69-85.

65. Lehman, D. W. Putnam, F. W. (1980) Proc.Nat.Acad.Sci.Usa, 77, 3239-3243.

66. Lewis, A. P., Lemon. S. M., Barber, K. A., Murphy, P., Parry, N. R., Peakman, T. C., Sims, M. J., Worden, J. Crowe, J. S. (1993) J.Immunol., 151, 2829-2838.

67. Liu, V. Y. S., Low, T. L. K., Infante, A Putnam, F. W. (1976) Science, 193, 1017-1020.

68. Logtenberg, T., Young, F. M., Van Es, J., Gmelig-Meyiing, F. H. J., Berman, J. E. Alt, F. W. (1989) J.Autoimmunity, 2, 203-213.

69. Logtenberg, T., Young, F. M., Van Es, J. H., Gmelig-Meyling, F. H. J. Alt, F. W. (1989) J.Exp.Med., 170, 1347-1355.

70. Manheimer-Lory, A., Katz, J. B., Pillinger, M., Ghossein, C., Smith, A Diamond, B. (1991) J.Exp.Med., 174, 1639-1652.

71. Mantovani, L., Wilder, R. L. Casali, P. (1993) J.Immunol., 151, 473-488.

72. Mariette, X., Tsapis, A. Brouet, J.-C. (1993) Eur.J.Immunol., 23, 846-851.

73. Marks, J. D., Hoogenboom, H. R., Bonnert, T. P., Mccafferty, J., Griffiths, A. D. Winter, G. (1991) J.Biol.Miol., 222, 581-597.

74. Meeker, T. C., Grimaldi, J., O'rourke, R., Loeb, J. Juliusson, G. Einhorn, S. (1988) J.Immol., 141, 3994-3998.

75. Milili. M., Fougereau, M., Guglieimi, P. Schiff, C. (1991) Mol.Immunol., 28, 753-761.

76. Moran, M. J., Andris, J. S., Matsumato, Y.-I., Capra, J. D. Hersh, E. M. (1993) Mol.Immunol., 30, 1543-1551.

77. Mortari, F., Wang, J.-Y. Schroeder, Jr., H. W. (1993) J.Immunol., 150, 1348-1357.

78. Newkirk, M. M., Gram, H., Heinich, G. F., Ostberg, L., Capra, J. D. Wasserman, R. L. (1988) J.Clin.Invest., 81, 1511-1518.

79. Newkirk, M. M., Mageed, R. A., Jefferis, R., Chen, P. P. Capra, J. D. (1987) J.Exp.Med., 166, 550-564.

80. Nickerson, K. G., Berman, J., Glickman, E., Chess, L. Alt, F. W. (1989) J.Exp.Med., 169, 1391-1403.

81. Olee, B. T., Lu, E. W., Huang, D.-F., Soto-Gil, R. W., Deftos, M., Kozin, F., Carson, D. A. Chen, P. P. (1992) J.Exp.Med., 175, 831-842.

82. Pascual, V., Randen, I., Thompson, K., Sioud, M. Forre, O., Natvig, J. Capra, J. D. (1990) J.Clin.Invest., 86, 1320-1328.

83. Pascual, V., Randen, I., Thompson, K., Sioud, M. Forre, O., Natvig, J. Capra, J. D. (1990) J.Clin.Invest., 86, 1320-1328; Randen, I., Brown, D., Thompson, K. M., Hughes-Jones, N., Pascual, V., Victor, K., Capra, J. D., Forre, O. Natvig, J. B. (1992)

84. Pascual, V., Victor, K., Lelsz, D., Spellerberg, M. B., Hamblin, T. J., Thompson, K. M., Randen, I., Natvig, J., Capra, J. D. Stevenson, F. K. (1991) J.Immunol., 146, 43854391.

85. Pascual, V., Victor, K, Randen, I., Thompson, K., Steinitz, M., Forre, O, Fu, S.-M., Natvig, J. B. Capra, J. D. (1992) Scand.J.Immunol., 36, 349-362.

86. Pascual, V., Victor, K., Spellerberg, M., Hamblin, T. J., Stevenson, F. K. Capra, J. D. (1992) J.Immunol., 149, 2337-2344.

87. Ponstingl, H., Schwarz, J., Reichel, W. Hilschmann, N. (1970) Z.Physiol.Chem., 351, 1591-1594.; Ponstingl, H. Hilschmann, N. ( 1976) Z.Physiol.Chem., 357,1571-1604.

88. Portolano, S., Mclachlan, S. M. Rapoport, B. (1993) J.Immunol., 151, 2839-2851.

89. Portolano, S., Seto, P., Chazenbalk, G. D., Nagayama, Y., Mclachlan, S. M. Rapoport, B. (1991) Biochem.Biophys.Res.Commun., 179, 372-377.

90. Pratt, L. F., Szubin, R., Carson, D. A. Kipps, T. J. (1991) J.Immunol., 147, 2041-2046.

91. Press, E. M. Hogg, N. M. (1970) Biochem.J., 117, 641-660.

92. Putnam, F. W., Shimizu, A., Paul., C., Shinoda, T. Kohler, H. (1971) Ann.N.Y.Acad.Sci., 190, 83-103.

93. Putnam, F. W., Takahashi, N., Tetaert, D., Debuire, B. Lin, L. C. (1981) Proc.Nat.Acad.Sci.Usa, 78, 6168-6172.; Takahashi, N., Tetaert, D., Debuire, B., Lin, L. Putnam, F. W. (1982) Proc.Nat.Acad.Sci.Usa, 79, 2850-2854.

94. Raaphorst, F. M., Timmers, E., Kenter, M. J. H., Van Tol, M. J. D., Vossen, J. M. Schuurman, R. K. B. (1992) Eur.J.Immunol., 22, 247-251.

95. Rabbitts, T. H., Bentley, D. L., Dunnick; W., Forster, A., Matthyssens, G. Milstein, C. (1980) Cold Spring Harb.Symp.Quanti.Biol., 45, 867-878; Matthyssens, G. Rabbitts, T. H. (1980) Proc.Nat.Acad.Sci.Usa, 77, 6561-6565.

96. Randen, I., Pascual, V., Victor, K., Thompson, K. M., Forre, O, Capra, J. D. Natvig, J. B. (1993) Eur.J.Immunol., 23, 1220-1225.

97. Rassenti, L. Z. Kipps, T. J. (1993) J.Exp.Med., 177, 1039-1046.

98. Reidl, L. S., Friedman, D. F., Goldman, J., Hardy, R. R., Jefferies, L. C. Silberstein, L. E. (1991) J.Immunol., 147, 3623-3631.

99. Roudier, J., Silverman, G. J., Chen, P. P., Carson, D. A. Kipps, T. J. (1990) J.Immunol., 144, 1526-1530.

100. Sanz, I., Casali, P., Thomas, J. W., Notkins, A. L. Capra, J. D. (1989) J.Immunol., 142, 4054-4061.

101. Sanz. I., Dang. H., Takei, M., Talal, N. Capra, J. D. (1989) J.Immunol., 142, 883-887.

102. Schmidt, W. E., Jung, H-. D., Palm, W. Hilschmann, N. (1983) Z.Physiol.Chem., 364, 713-747.

103. Schroeder, H. W., Jr. Wang, J. Y. (1990) Proc.Natl.Acad.Sci.Usa, 87, 6146-6150.

104. Schroeder, H. W., Jr., Hillson, J. L Perlmutter, R. M. (1987) Science, 238. 791-793.

105. Schroeder, H. W., Jr., Hillson, J. L. Perlmutter, R. M. (1987) Science, 238, 791-793; Chen, P. P., Liu, M.-F., Glass, C. A., Sinha, S., Kipps, T. J. Carson, D. A (1989) Arthritis Rheumatism, 32, 72-76.

106. Schroeder, H. W., Jr., Hillson, J. L. Perlmutter, R. M. (1987) Science, 238, 791-793; Chen, P. P., Liu, M.-F., Sinha, S. Carson, D. A. (1988) Arth.Rheum., 31,1429-1431.

107. Schutte, M. E., Ebeling, S. B., Akkermans, K. E., Gmelig-Meyling, F. H. Logtenberg, T. (1991) Eur.J.Immunol., 21, 1115-1121.

108. Schutte, M. E., Ebeling, S. B., Akkermans, K. E., Gmelig-Meyling, F. H. J. Logtenberg, T. (1991) Eur.J.Immunol., 21, 1115-1121.

109. Settmacher, U., Jahn, S., Siegel, P., Von Baehr, R. Hansen, A (1993) Mol.Immunol., 30, 953-954.

110. Shen, A., Humphries, C., Tucker, P. Blattner, F. (1987) Proc.NatlAcad.Sci.Usa, 84, 8563-8567.

111. Shimizu, A., Nussenzweig, M. C., Mizuta, T.-R., Leder, P. Honjo. T. (1989) Proc.Natl.Acad.Sci.Usa, 86, 8020-8023.

112. Shin, E. K., Matsuda, F., Fujikura, J., Akamizu, T., Sugawa, H., Mori, T. Honjo, T. (1993) Eur.J.Immunol., 23, 2365-2367.

113. Silberstein, L. E., Litwin, S. Carmack, C. E. (1989) J.Exp.Med., 169, 16311-1643.

114. Singal, D. P., Frame, B., Joseph, S., Blajchman, M. A. Leber, B. F. (1993) Immunogenet., 38, 242.

115. Spatz. L. A., Wong, K. K., Williams, M., Desai, R., Golier, J., Berman, J. E., Alt, F. W. Latov, N. (1990) J.Immunol., 144, 2821-2828.

116. Steiner, L. A., Garcia-Pardo. A. Margolies, M. N. (1979) Biochemistry, 18, 4068-4080.

117. Stewart, A. K., Huang, C., Stollar, B. D. Schwartz, R. S. (1993) J.Exp.Med., 177, 409-418.

118. Thomas, J. W. (1993) J.Immunol., 150, 1375-1382.

119. Torano, A. Putnam, F. W. (1978) Proc.Nat.Acad.Sci.Usa, 75, 966-969.

120. Van Der. Heijden, R. W. J., Bunschoten, H., Pascual, V., Uytdehaag, F. G. C. M., Osterhaus, A. D. M. E. Capra, J. D. (1990) J.Immunol., 144, 2835-2839.

121. Van Der Stoep, N., Van Der Linden, J. Logtenberg, T. (1993) J.Exp.Med., 177, 99-107.

122. Van Es, J. H., Gmelig-Meyling, F. H. J. Logtenberg, T. (1992) Eur.J.Immunol., 22, 2761-2764.

123. Varade, W. S., Marin, E., Kittelberger, A. M. Insel, R. A (1993) J.Immunol., 150, 4985-4995.

124. Victor, K. D., Pascual, V., Lefvert, A. K. Capra, J. D. (1992) Mol.Immunol., 29, 1501-1506.

125. Victor, K. D., Pascual, V., Williams, C. L., Lennon, V. A Capra, J. D. (1992) Eur.J.Immunol., 22, 2231-2236.

126. Watanabe, S., Barnikol, H. U., Horn, J., Bertram, J. Hilschmann, N. (1973) Z.Physiol.Chem., 354, 1505-1509.

127. Weng, N.-P., Yu-Lee, L.-Y., Sanz, I., Patten, B. M. Marcus, D. M. (1992) J.Immunol., 149, 2518-2529.

128. White, M. B., Word, C. J., Humphries, C. G., Blattner, F. R. Tucker, P. W. (1990) Mol.Cell.Biol., 10. 3690-3699.

129. Winkler, T. H., Fehr, H. Kalden, J. R. (1992) Eur.J.Immunol., 22, 1719-1728.

130. Yago, K., Zenita, K., Ohwaki, I., Harada, Y., Nozawa, S., Tsukazaki, K., Iwamori, M., Endo, N., Yasuda. N., Okuma, M. Kannagi, R. (1993) Mol.Immunol., 30, 1481-1489.

131. Zeienetz, A. D., Chen, T. T. Levy, R. (1992) J.Exp.Med., 176, 1137-1148.

B. References of Germline Sequences

References of Human Germline Kappa Sequences

1. Cox, J. P. L., Tomlinson, I. M. Winter, G. (1994) Eur.J.Immunol., 24, 827-836.

2. Huber, C., Et Al. (1993) Eur.J.Immunol., 23, 2868.

3. Klobeck, H. G., Bornkammm, G. W., Combriato, G., Mocikat, R., Pohlenz, H. D. Zachau, H. G. (1985) Nucl.Acids Res., 13, 6515-6529.

4. Lautner-Rieske, A., Huber, C., Meindi, A., Pargent, W., Schäble. K. F., Thiebe, R., Zocher. I. Zachau, H. G. (1992) Eur.J.Immunol. 22, 1023.

5. Lorenz, W., Schäble, K. F., Thiebe, R., Stavnezer, J. Zachau, H. G. (1988) Mol.Immunol., 25. 479.

6. Pargent, W., Meindl, A., Thiebe, R., Mitzel, S. Zachau, H. G. (1991) Eur.J.Immunol., 21, 1821-1827.

7. Pech, M. Zachau, H. G. (1984) Nuc.Acids Res., 12, 9229-9236.

8. Pech, M., Jaenichen, H.-R., Pohlenz, H.-D., Neumaier, P. S., Klobeck, H.-G. Zachau, H. G. (1984) J.Biol.Miol., 176, 189-204.

9. Scott, M. G., Crimmins, D. L., Mccourt, D. W., Chung, G., Schable, K. F., Thiebe, R., Quenzel, E.-M., Zachau, H. G. Nahm, M. H. (1991) J.Immunol., 147, 4007-4013.

10. Stavnezer, J., Kekish, O, Batter, D., Grenier, J., Balazs, I., Henderson, E. Zegers, B. J. M. (1985) Nucl.Acids Res., 13, 3495-3514.

11. Straubinger, B., Huber, E., lorenz, W., Osterholzer, E., Pargent, W., Pech, M., Pohlenz, H.-D., Zimmer, F.-J. Zachau, H. G. (1988) J.Biol.Mol., 199, 23-34.

12. Straubinger, B., Thiebe, R., Huber, C., Osterhoizer, E. Zachau, H. G. (1988) Biol.Chem.Hoppe-Seyer, 369, 601-607.

References of Human Germline Lambda Sequences

1. Williams, S. C. Winter, G. (1993) Eur.J.Immunol., 23, 1456-1461.

2. Siminovitch, K. A., Misener, V., Kwong, P. C., Song, Q.-L Chen, P. P. (1989) J.Clin.Invest., 84, 1675-1678.

3. Brockly, F., Alexandre, D., Chuchana, P., Huck, S., Lefranc, G. Lefranc, M.-P. (1989) NucAcids.Res., 17, 3976.

4. Daley, M. D., Peng, H.-Q., Misener, V., Liu, X.-Y., Chen, P. P. Siminovitch, K. A. (1992) Mol.Immunol., 29, 1515-1518.

5. Deftos, M., Soto-Gil, R., Quan, M., Olee, T. Chen, P. P. (1994) Scand.J.Immunol., 39, 95.

6. Stiernholm, N. B. J., Kuzniar, B. Berinstein, N. L. (1994) J.Immunol., 152, 4969-4975.

7. Combriato, G. Klobeck, H. G. (1991) Eur.J.Immunol., 21, 1513-1522.

8. Anderson, M. L. M., Szajnert, M. F., Kaplan, J. C., Mccoll, L. Young, B. D. (1984) Nuc.Acids Res., 12, 6647-6661.

References of Human Germline Heavy Chain Sequences

1. Adderson, E. E., Azmi, F. H., Wilson, P. M., Shackelford, P. G. Carroll, W. L. (1993) J.Immunol., 151, 800-809.

2. Andris, J. S., Brodeur, B. R. Capra. J. D. (1993) Mol.Immunol., 30, 1601-1616.

3. Berman, J. E., Mellis, S. J., Pollock, R., Smith, C. L., Suh, H., Heinke, B., Kowal, C., Surti, U., Chess, L., Cantor, C. R. Alt, F. W. (1988) Embo J., 7, 727-738.

4. Buluwela, L. Rabbitts, T. H. (1988) Eur.J.Immunol., 18, 1843-1845.; Buluwela, L., Albertson, D. G., Sherrington, P., Rabbitts, P. H., Spurr, N. Rabbitts, T. H. ( 1988) Embo J., 7, 2003-2010.

5. Chen, P. P., Liu, M.-F., Sinha, S. Carson, D. A. (1988) Arth.Rheum., 31, 1429-1431.

6. Chen, P. P., Liu, M.-F., Glass, C. A., Sinha, S., Kipps, T. J. Carson, D. A. (1989) Arthritis Rheumatism, 32, 72-76.

7. Cook, G. P. et al. (1994) Nature Genetics 7, 162-168.

8. Haino, M. et al., (1994). J.Biol.Chem. 269, 2619-2626

9. Humphries, C. G., Shen, A., Kuziel, W. A., Capra, J. D., Blattner, F. R. Tucker, P. W. (1988) Nature, 331, 446-449.

10. Kodaira, M., Kinashi, T., Umemura, I., Matsuda, F., Noma, T., Ono, Y. Honjo, T. (1986) J.Biol.Mol., 190, 529-541.

11. Lee, K. H., Matsuda, F., Kinashi, T., Kodaira, M. Honjo, T. (1987) J.Biol.Mol., 195, 761-768.

12. Matsuda, F., Lee, K. H., Nakai, S., Sato, T., Kodaira, M., Zong, S. Q., Ohno, H., Fukuhara, S. Honjo, T. (1988) Embo J., 7, 1047-1051.

13. Matsuda, F., Shin, E. K., Hirabayashi, Y., Nagaoka, H., Yoshida, M. C, Zong, S. Q., Honjo, T. (1990) Embo J., 9, 2501-2506.

14. Matsuda, F., Shin, E. K., Nagaoka, H., Matsumura, R., Haino, M., Fukita, Y., Taka-Ishi, S., Imai, T., Riley, J. H., Anand, R. Et. Al. (1993) Nature Genet. 3, 88-94

15. Nagaoka, H., Ozawa, K., Matsuda, F., Hayashida, H., Matsumura, R., Haino, M., Shin, E. K., Fukita, Y., Imai, T., Anand, R., Yokoyama, K., Eki, T., Soeda, E. Honjo, T. (1993). (Temporal).

16. Rechavi, G., Bienz, B., Ram, D., Ben-Neriah, Y., Cohen, J. B., Zakut, R. Givol, D. (1982) Proc.Nat.Acad.Sci.Usa, 79, 4405-4409.

17. Sanz, I., Kelly, P., Williams, C., Scholl, S., Tucker, P. Capra, J. D. (1989) Embo J., 8, 3741-3748.

18. Shin, E. K., Matsuda, F., Fujikura, J., Akamizu, T., Sugawa, H., Mori, T. Honjo, T. (1993) Eur.J.Immunol., 23, 2365-2367.

19. Tomlinson, Im., Walter, G., Marks, Jd., Liewelyn, Mb. Winter. G. (1992) J.Biol.Mol. 227, 776-798.

20. Van Der Maarel, S., Van Dijk. K. W., Alexander, C. M., Sasso, E. H., Bull, A Milner, E. C. B. (1993) J.Immunol., 150, 2858-2868.

21. Van Dijk, K. W., Mortari, F., Kirkham, P. M., Schroeder, Jr., H. W. Milner, E. C. B. (1993) Eur.J.Immunol., 23, 832-839.

22. Van E s, J. H., Aanstoot, H., Gmelig-Meyling, F. H. J., Derksen, R. H. W. M. Logtenberg, T. (1992) J.Immunol., 149, 2234-2240.

23. Weng, N.-P., Snyder, J. G., Yu-Lee, L.-Y. Marcus, D. M. (1992) Eur.J.Immunol., 22, 1075-1082.

24. Winkler, T. H., Fehr, H. Kalden, J. R. (1992) Eur.J.Immunol., 22, 1719-1728.

25. Olee, T., Yang, P. M., Siminovitch, K. A., Olsen, N. J., Hillson, J. L., W u, J., Kozin, F., Carson, D. A. Chen, P. P. (1991) J.Clin.Invest 88, 193-203.

26. Chen, P. P. Yang, P. M. (1990) Scand.J.Immunol. 31, 593-599.

27. Tomlinson, M., Walter, G., Cook Winter, G. (Unpublished).

373 20 amino acids amino acid <Unknown> linear protein 1Ala Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly1 5 10 15Gly Gly Gly Ser 20 82 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide” 2TCAGCGGGTG GCGGTTCTGG CGGCGGTGGG AGCGGTGGCG GTGGTTCTGG CGGTGGTGGT 60TCCGATATCG GTCCACGTAC GG 82 83 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide” 3AATTCCGTAC GTGGACCGAT ATCGGAACCA CCACCGCCAG AACCACCGCC ACCGCTCCCA 60CCGCCGCCAG AACCGCCACC CGC 83 69 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide misc_feature 28..45 /product= ”6 random codons by trinucleotide mutagenesis (19aa, no Cys)“ 4GATACGGCCG TGTATTATTG CGCGCGTNNK NNKNNKNNKN NKNNKGATTA TTGGGGCCAA 60GGCACCCTG 69 84 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide misc_feature 28..57 /product= “10 random codons by trinucleotide mutagenesis (19aa, no Cys)” misc_feature 58..60 /product= “random codon by trinucleotide mutagenesis (TTT/ATG)” misc_feature 64..66 /product= “random codon by trinucleotide mutagenesis (GTT/TAT)” 5GATACGGCCG TGTATTATTG CGCGCGTNNK NNKNNKNNKN NKNNKNNKNN KNNKNNKWTK 60GATKWTTGGG GCCAAGGCAC CCTG 84 21 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide” 6GATACGGCCG TGTATTATTG C 21 17 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide” 7CAGGGTGCCT TGGCCCC 17 17 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide” 8GCAGAAGGCG AACGTCC 17 80 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide misc_feature 39..41 /product= ”random codon (mixture of GCT, CGT, CAT, TCT, TAT)“ misc_feature 42..53 /product= ”random codons by trinucleotide mutagenesis (19 aa, no Cys)“ misc_feature 57..59 /product= ”random codon by trinucleotide mutagenesis (19 aa, no Cys)“ 9TGGAAGCTGA AGACGTGGGC GTGTATTATT GCCAGCAGBV TNNKNNKNNK NNKCCGNNKT 60TTGGCCAGGG TACGAAAGTT 80 18 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 10AACTTTCGTA CCCTGGCC 18 108 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide misc_feature 21..23 /product= “random codon by trinucleotide mutagenesis (19aa, no Cys)” misc_feature 27..35 /product= “random codons by trinucleotide mutagenesis (19 aa, no Cys)” misc_feature 36..41 /product= “random codons by mixed monomers (A/G A/C/G T)” misc_feature 42..44 /product= “random codon by trinucleotide mutagenesis (19aa, no Cys)” misc_feature 48..50 /product= “random codon by trinucleotide mutagenesis (19aa, no Cys)” 11AGGGTCTCGA GTGGGTGAGC NNKATTNNKN NKNNKRVTRV TNNKACCNNK TATGCGGATA 60GCGTGAAAGG CCGTTTTACC ATTTCACGTG ATAATTCGAA AAACACCA 108 105 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide misc_feature 21..23 /product= ”random codon by trinucleotide mutagenesis (19aa, no Cys)“ misc_feature 27..32 /product= ”random codons by trinucleotide mutagenesis (19aa, no Cys)“ misc_feature 33..38 /product= ”random codons by mixed monomers (A/G A/C/G T)“ misc_feature 39..41 /product= ”random codon by trinucleotide mutagenesis (19aa, no Cys)“ misc_feature 45..47 /product= ”random codon by trinucleotide mutagenesis (19aa, no Cys)“ 12AGGGTCTCGA GTGGGTGAGC NNKATTNNKN NKRVTRVTNN KACCNNKTAT GCGGATAGCG 60TGAAAGGCCG TTTTACCATT TCACGTGATA ATTCGAAAAA CACCA 105 20 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 13TGGTGTTTTT CGAATTATCA 20 108 amino acids amino acid <Unknown> linear protein 14Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Asn Tyr 20 25 30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ser Thr Pro Leu 85 90 95Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg 100 105 113 amino acids amino acid <Unknown> linear protein 15Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 110Arg 109 amino acids amino acid <Unknown> linear protein 16Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser 20 25 30Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu65 70 75 80Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Asn Ser Pro 85 90 95Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg 100 105 114 amino acids amino acid <Unknown> linear protein 17Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr65 70 75 80Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95Tyr Tyr Ser Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110Lys Arg 112 amino acids amino acid <Unknown> linear protein 18Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly Gln1 5 10 15Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Asn Asn 20 25 30Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45Ile Tyr Asp Asn Asn Lys Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Thr Gly Leu Gln65 70 75 80Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Thr Trp Asp Asp Ser Leu 85 90 95Ser Gly Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln 100 105 110 112 amino acids amino acid <Unknown> linear protein 19Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln1 5 10 15Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr 20 25 30Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45Met Ile Tyr Asp Val Ser Lys Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu65 70 75 80Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Ala Gly Ser 85 90 95Ser Thr Val Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln 100 105 110 108 amino acids amino acid <Unknown> linear protein 20Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Gln Thr1 5 10 15Ala Arg Ile Thr Cys Ser Gly Asp Ser Leu Gly Ser Lys Tyr Ala Ser 20 25 30Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr Asp 35 40 45Asp Asn Lys Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn 50 55 60Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Val Gln Ala Glu Asp65 70 75 80Glu Ala Asp Tyr Tyr Cys Gln Ser Trp Asp Ser Ser Gly Asn Val Val 85 90 95Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln 100 105 119 amino acids amino acid <Unknown> linear protein 21Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Ala Pro Gly Tyr Cys Ser Gly Phe Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115 117 amino acids amino acid <Unknown> linear protein 22Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Trp Ile Asn Pro Asn Ser Gly Asn Thr Asn Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Gly Asp Gly Gly Phe Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ser 115 120 amino acids amino acid <Unknown> linear protein 23Glx Val Thr Leu Lys Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Met Gly Val Ser Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu 35 40 45Trp Leu Ala His Ile Asp Trp Asp Asp Asp Lys Tyr Tyr Ser Thr Ser 50 55 60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val65 70 75 80Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr 85 90 95Cys Ala Arg Ile His Asn Ile Gly Glu Ala Phe Asp Val Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120 117 amino acids amino acid <Unknown> linear protein 24Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Val Ile Ser Tyr Asp Gly Gly Asn Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Asp Arg Gly Gly Ser Gly Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110Val Thr Val Ser Ser 115 118 amino acids amino acid <Unknown> linear protein 25Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Glu Ile Tyr His Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Gly Arg Gly Gly Gly Gly Val Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110Leu Val Thr Val Ser Ser 115 119 amino acids amino acid <Unknown> linear protein 26Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu1 5 10 15Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr 20 25 30Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met 35 40 45Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe 50 55 60Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr65 70 75 80Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85 90 95Ala Arg Leu Gly Gly Gly Gly Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115 119 amino acids amino acid <Unknown> linear protein 27Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln1 5 10 15Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30Ser Ala Ala Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60Val Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn65 70 75 80Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Arg Asp Pro Gly Gly Phe Asp Val Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115 109 amino acids amino acid <Unknown> linear protein 28Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Pro 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 100 105 114 amino acids amino acid <Unknown> linear protein 29Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gln Gln His 85 90 95Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 110Arg Thr 110 amino acids amino acid <Unknown> linear protein 30Asp Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser 20 25 30Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Val Pro Ala Arg Phe Ser 50 55 60Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu65 70 75 80Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro 85 90 95Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 100 105 110 115 amino acids amino acid <Unknown> linear protein 31Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly1 5 10 15Glu Arg Ala Thr Ile Asn Cys Arg Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr65 70 75 80Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110Lys Arg Thr 115 109 amino acids amino acid <Unknown> linear protein 32Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly Gln1 5 10 15Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 20 25 30Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45Ile Tyr Asp Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Thr Gly Leu Gln65 70 75 80Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro 85 90 95Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 100 105 110 amino acids amino acid <Unknown> linear protein 33Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln1 5 10 15Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr 20 25 30Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45Met Ile Tyr Asp Val Ser Asn Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu65 70 75 80Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Gln His Tyr Thr Thr 85 90 95Pro Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 100 105 110 107 amino acids amino acid <Unknown> linear protein 34Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Gln1 5 10 15Thr Ala Arg Ile Ser Cys Ser Gly Asp Ala Leu Gly Asp Lys Tyr Ala 20 25 30Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr 35 40 45Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln Ala Glu65 70 75 80Asp Glu Ala Asp Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Pro Val 85 90 95Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 100 105 120 amino acids amino acid <Unknown> linear protein 35Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120 120 amino acids amino acid <Unknown> linear protein 36Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120 121 amino acids amino acid <Unknown> linear protein 37Gln Val Gln Leu Lys Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln1 5 10 15Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu 35 40 45Trp Leu Ala Leu Ile Asp Trp Asp Asp Asp Lys Tyr Tyr Ser Thr Ser 50 55 60Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val65 70 75 80Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr 85 90 95Cys Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 120 amino acids amino acid <Unknown> linear protein 38Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120 119 amino acids amino acid <Unknown> linear protein 39Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115 120 amino acids amino acid <Unknown> linear protein 40Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu1 5 10 15Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr 20 25 30Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met 35 40 45Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe 50 55 60Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr65 70 75 80Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85 90 95Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120 123 amino acids amino acid <Unknown> linear protein 41Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln1 5 10 15Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30Ser Ala Ala Trp Asn Trp Ile Arg Gln Ser Pro Gly Arg Gly Leu Glu 35 40 45Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60Val Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn65 70 75 80Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 327 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..327 /product= ”V kappa 1“ 42GAT ATC CAG ATG ACC CAG AGC CCG TCT AGC CTG AGC GCG AGC GTG GGT 48Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15GAT CGT GTG ACC ATT ACC TGC AGA GCG AGC CAG GGC ATT AGC AGC TAT 96Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30CTG GCG TGG TAC CAG CAG AAA CCA GGT AAA GCA CCG AAA CTA TTA ATT 144Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45TAT GCA GCC AGC AGC TTG CAA AGC GGG GTC CCG TCC CGT TTT AGC GGC 192Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60TCT GGA TCC GGC ACT GAT TTT ACC CTG ACC ATT AGC AGC CTG CAA CCT 240Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80GAA GAC TTT GCG ACC TAT TAT TGC CAG CAG CAT TAT ACC ACC CCG CCG 288Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Pro 85 90 95ACC TTT GGC CAG GGT ACG AAA GTT GAA ATT AAA CGT ACG 327Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 100 105 109 amino acids amino acid linear protein 43Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Pro 85 90 95Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 100 105 342 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..342 /product= ”V kappa 2“ 44GAT ATC GTG ATG ACC CAG AGC CCA CTG AGC CTG CCA GTG ACT CCG GGC 48Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly110 115 120 125GAG CCT GCG AGC ATT AGC TGC AGA AGC AGC CAA AGC CTG CTG CAT AGC 96Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 130 135 140AAC GGC TAT AAC TAT CTG GAT TGG TAC CTT CAA AAA CCA GGT CAA AGC 144Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 145 150 155CCG CAG CTA TTA ATT TAT CTG GGC AGC AAC CGT GCC AGT GGG GTC CCG 192Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 160 165 170GAT CGT TTT AGC GGC TCT GGA TCC GGC ACC GAT TTT ACC CTG AAA ATT 240Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 175 180 185AGC CGT GTG GAA GCT GAA GAC GTG GGC GTG TAT TAT TGC CAG CAG CAT 288Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gln Gln His190 195 200 205TAT ACC ACC CCG CCG ACC TTT GGC CAG GGT ACG AAA GTT GAA ATT AAA 336Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 210 215 220CGT ACG 342Arg Thr 114 amino acids amino acid linear protein 45Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gln Gln His 85 90 95Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 110Arg Thr 330 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..330 /product= ”V kappa 3“ 46GAT ATC GTG CTG ACC CAG AGC CCG GCG ACC CTG AGC CTG TCT CCG GGC 48Asp Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly115 120 125 130GAA CGT GCG ACC CTG AGC TGC AGA GCG AGC CAG AGC GTG AGC AGC AGC 96Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser 135 140 145TAT CTG GCG TGG TAC CAG CAG AAA CCA GGT CAA GCA CCG CGT CTA TTA 144Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 150 155 160ATT TAT GGC GCG AGC AGC CGT GCA ACT GGG GTC CCG GCG CGT TTT AGC 192Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Val Pro Ala Arg Phe Ser 165 170 175GGC TCT GGA TCC GGC ACG GAT TTT ACC CTG ACC ATT AGC AGC CTG GAA 240Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu 180 185 190CCT GAA GAC TTT GCG GTG TAT TAT TGC CAG CAG CAT TAT ACC ACC CCG 288Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro195 200 205 210CCG ACC TTT GGC CAG GGT ACG AAA GTT GAA ATT AAA CGT ACG 330Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 215 220 110 amino acids amino acid linear protein 47Asp Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly 1 5 10 15Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser 20 25 30Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Val Pro Ala Arg Phe Ser 50 55 60Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu 65 70 75 80Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro 85 90 95Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 100 105 110 345 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..345 /product= ”V kappa 4“ 48GAT ATC GTG ATG ACC CAG AGC CCG GAT AGC CTG GCG GTG AGC CTG GGC 48Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 115 120 125GAA CGT GCG ACC ATT AAC TGC AGA AGC AGC CAG AGC GTG CTG TAT AGC 96Glu Arg Ala Thr Ile Asn Cys Arg Ser Ser Gln Ser Val Leu Tyr Ser 130 135 140AGC AAC AAC AAA AAC TAT CTG GCG TGG TAC CAG CAG AAA CCA GGT CAG 144Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 145 150 155CCG CCG AAA CTA TTA ATT TAT TGG GCA TCC ACC CGT GAA AGC GGG GTC 192Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 160 165 170CCG GAT CGT TTT AGC GGC TCT GGA TCC GGC ACT GAT TTT ACC CTG ACC 240Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr175 180 185 190ATT TCG TCC CTG CAA GCT GAA GAC GTG GCG GTG TAT TAT TGC CAG CAG 288Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 195 200 205CAT TAT ACC ACC CCG CCG ACC TTT GGC CAG GGT ACG AAA GTT GAA ATT 336His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 210 215 220AAA CGT ACG 345Lys Arg Thr 225 115 amino acids amino acid linear protein 49Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15Glu Arg Ala Thr Ile Asn Cys Arg Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110Lys Arg Thr 115 327 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..327 /product= ”V lambda 1“ 50CAG AGC GTG CTG ACC CAG CCG CCT TCA GTG AGT GGC GCA CCA GGT CAG 48Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly Gln 120 125 130CGT GTG ACC ATC TCG TGT AGC GGC AGC AGC AGC AAC ATT GGC AGC AAC 96Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 135 140 145TAT GTG AGC TGG TAC CAG CAG TTG CCC GGG ACG GCG CCG AAA CTG CTG 144Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 150 155 160ATT TAT GAT AAC AAC CAG CGT CCC TCA GGC GTG CCG GAT CGT TTT AGC 192Ile Tyr Asp Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 165 170 175GGA TCC AAA AGC GGC ACC AGC GCG AGC CTT GCG ATT ACG GGC CTG CAA 240Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Thr Gly Leu Gln180 185 190 195AGC GAA GAC GAA GCG GAT TAT TAT TGC CAG CAG CAT TAT ACC ACC CCG 288Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro 200 205 210CCT GTG TTT GGC GGC GGC ACG AAG TTA ACC GTT CTT GGC 327Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 215 220 109 amino acids amino acid linear protein 51Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly Gln 1 5 10 15Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 20 25 30Tyr Val Ser Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45Ile Tyr Asp Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Thr Gly Leu Gln 65 70 75 80Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro 85 90 95Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 100 105 330 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..330 /product= ”V lambda 2“ 52CAG AGC GCA CTG ACC CAG CCA GCT TCA GTG AGC GGC TCA CCA GGT CAG 48Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln110 115 120 125AGC ATT ACC ATC TCG TGT ACG GGT ACT AGC AGC GAT GTG GGC GGC TAT 96Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr 130 135 140AAC TAT GTG AGC TGG TAC CAG CAG CAT CCC GGG AAG GCG CCG AAA CTG 144Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 145 150 155ATG ATT TAT GAT GTG AGC AAC CGT CCC TCA GGC GTG AGC AAC CGT TTT 192Met Ile Tyr Asp Val Ser Asn Arg Pro Ser Gly Val Ser Asn Arg Phe 160 165 170AGC GGA TCC AAA AGC GGC AAC ACC GCG AGC CTG ACC ATT AGC GGC CTG 240Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu 175 180 185CAA GCG GAA GAC GAA GCG GAT TAT TAT TGC CAG CAG CAT TAT ACC ACC 288Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Gln His Tyr Thr Thr190 195 200 205CCG CCT GTG TTT GGC GGC GGC ACG AAG TTA ACC GTT CTT GGC 330Pro Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 210 215 110 amino acids amino acid linear protein 53Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln 1 5 10 15Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr 20 25 30Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu 35 40 45Met Ile Tyr Asp Val Ser Asn Arg Pro Ser Gly Val Ser Asn Arg Phe 50 55 60Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu 65 70 75 80Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Gln His Tyr Thr Thr 85 90 95Pro Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 100 105 110 321 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..321 /product= ”V lambda 3“ 54AGC TAT GAA CTG ACC CAG CCG CCT TCA GTG AGC GTT GCA CCA GGT CAG 48Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Gln 115 120 125ACC GCG CGT ATC TCG TGT AGC GGC GAT GCG CTG GGC GAT AAA TAC GCG 96Thr Ala Arg Ile Ser Cys Ser Gly Asp Ala Leu Gly Asp Lys Tyr Ala 130 135 140AGC TGG TAC CAG CAG AAA CCC GGG CAG GCG CCA GTT CTG GTG ATT TAT 144Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr 145 150 155GAT GAT TCT GAC CGT CCC TCA GGC ATC CCG GAA CGC TTT AGC GGA TCC 192Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 160 165 170AAC AGC GGC AAC ACC GCG ACC CTG ACC ATT AGC GGC ACT CAG GCG GAA 240Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln Ala Glu175 180 185 190GAC GAA GCG GAT TAT TAT TGC CAG CAG CAT TAT ACC ACC CCG CCT GTG 288Asp Glu Ala Asp Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Pro Val 195 200 205TTT GGC GGC GGC ACG AAG TTA ACC GTT CTT GGC 321Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 210 215 107 amino acids amino acid linear protein 55Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Gln 1 5 10 15Thr Ala Arg Ile Ser Cys Ser Gly Asp Ala Leu Gly Asp Lys Tyr Ala 20 25 30Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Tyr 35 40 45Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Gly Thr Gln Ala Glu 65 70 75 80Asp Glu Ala Asp Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Pro Val 85 90 95Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 100 105 361 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..360 /product= ”VH1A“ 56CAG GTG CAA TTG GTT CAG TCT GGC GCG GAA GTG AAA AAA CCG GGC AGC 48Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 110 115 120AGC GTG AAA GTG AGC TGC AAA GCC TCC GGA GGC ACT TTT AGC AGC TAT 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 125 130 135GCG ATT AGC TGG GTG CGC CAA GCC CCT GGG CAG GGT CTC GAG TGG ATG 144Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met140 145 150 155GGC GGC ATT ATT CCG ATT TTT GGC ACG GCG AAC TAC GCG CAG AAG TTT 192Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe 160 165 170CAG GGC CGG GTG ACC ATT ACC GCG GAT GAA AGC ACC AGC ACC GCG TAT 240Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 175 180 185ATG GAA CTG AGC AGC CTG CGT AGC GAA GAT ACG GCC GTG TAT TAT TGC 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 190 195 200GCG CGT TGG GGC GGC GAT GGC TTT TAT GCG ATG GAT TAT TGG GGC CAA 336Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 205 210 215GGC ACC CTG GTG ACG GTT AGC TCA G 361Gly Thr Leu Val Thr Val Ser Ser220 225 120 amino acids amino acid linear protein 57Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr 20 25 30Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr 65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120 361 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..360 /product= ”VH1B“ 58CAG GTG CAA TTG GTT CAG AGC GGC GCG GAA GTG AAA AAA CCG GGC GCG 48Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 125 130 135AGC GTG AAA GTG AGC TGC AAA GCC TCC GGA TAT ACC TTT ACC AGC TAT 96Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 140 145 150TAT ATG CAC TGG GTC CGC CAA GCC CCT GGG CAG GGT CTC GAG TGG ATG 144Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 155 160 165GGC TGG ATT AAC CCG AAT AGC GGC GGC ACG AAC TAC GCG CAG AAG TTT 192Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe 170 175 180CAG GGC CGG GTG ACC ATG ACC CGT GAT ACC AGC ATT AGC ACC GCG TAT 240Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr185 190 195 200ATG GAA CTG AGC AGC CTG CGT AGC GAA GAT ACG GCC GTG TAT TAT TGC 288Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 205 210 215GCG CGT TGG GGC GGC GAT GGC TTT TAT GCG ATG GAT TAT TGG GGC CAA 336Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 220 225 230GGC ACC CTG GTG ACG GTT AGC TCA G 361Gly Thr Leu Val Thr Val Ser Ser 235 240 120 amino acids amino acid linear protein 59Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe 50 55 60Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr 65 70 75 80Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120 364 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..363 /product= ”VH2“ 60CAG GTG CAA TTG AAA GAA AGC GGC CCG GCC CTG GTG AAA CCG ACC CAA 48Gln Val Gln Leu Lys Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln 125 130 135ACC CTG ACC CTG ACC TGT ACC TTT TCC GGA TTT AGC CTG TCC ACG TCT 96Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser 140 145 150GGC GTT GGC GTG GGC TGG ATT CGC CAG CCG CCT GGG AAA GCC CTC GAG 144Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu 155 160 165TGG CTG GCT CTG ATT GAT TGG GAT GAT GAT AAG TAT TAT AGC ACC AGC 192Trp Leu Ala Leu Ile Asp Trp Asp Asp Asp Lys Tyr Tyr Ser Thr Ser 170 175 180CTG AAA ACG CGT CTG ACC ATT AGC AAA GAT ACT TCG AAA AAT CAG GTG 240Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val185 190 195 200GTG CTG ACT ATG ACC AAC ATG GAC CCG GTG GAT ACG GCC ACC TAT TAT 288Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr 205 210 215TGC GCG CGT TGG GGC GGC GAT GGC TTT TAT GCG ATG GAT TAT TGG GGC 336Cys Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly 220 225 230CAA GGC ACC CTG GTG ACG GTT AGC TCA G 364Gln Gly Thr Leu Val Thr Val Ser Ser 235 240 121 amino acids amino acid linear protein 61Gln Val Gln Leu Lys Glu Ser Gly Pro Ala Leu Val Lys Pro Thr Gln 1 5 10 15Thr Leu Thr Leu Thr Cys Thr Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Val Gly Val Gly Trp Ile Arg Gln Pro Pro Gly Lys Ala Leu Glu 35 40 45Trp Leu Ala Leu Ile Asp Trp Asp Asp Asp Lys Tyr Tyr Ser Thr Ser 50 55 60Leu Lys Thr Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Gln Val 65 70 75 80Val Leu Thr Met Thr Asn Met Asp Pro Val Asp Thr Ala Thr Tyr Tyr 85 90 95Cys Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly 100 105 110Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 361 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..360 /product= ”VH3“ 62GAA GTG CAA TTG GTG GAA AGC GGC GGC GGC CTG GTG CAA CCG GGC GGC 48Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 125 130 135AGC CTG CGT CTG AGC TGC GCG GCC TCC GGA TTT ACC TTT AGC AGC TAT 96Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 140 145 150GCG ATG AGC TGG GTG CGC CAA GCC CCT GGG AAG GGT CTC GAG TGG GTG 144Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 155 160 165AGC GCG ATT AGC GGT AGC GGC GGC AGC ACC TAT TAT GCG GAT AGC GTG 192Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val170 175 180 185AAA GGC CGT TTT ACC ATT TCA CGT GAT AAT TCG AAA AAC ACC CTG TAT 240Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 190 195 200CTG CAA ATG AAC AGC CTG CGT GCG GAA GAT ACG GCC GTG TAT TAT TGC 288Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 205 210 215GCG CGT TGG GGC GGC GAT GGC TTT TAT GCG ATG GAT TAT TGG GGC CAA 336Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 220 225 230GGC ACC CTG GTG ACG GTT AGC TCA G 361Gly Thr Leu Val Thr Val Ser Ser 235 240 120 amino acids amino acid linear protein 63Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120 358 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..357 /product= ”VH4“ 64CAG GTG CAA TTG CAA GAA AGT GGT CCG GGC CTG GTG AAA CCG AGC GAA 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 125 130 135ACC CTG AGC CTG ACC TGC ACC GTT TCC GGA GGC AGC ATT AGC AGC TAT 96Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr 140 145 150TAT TGG AGC TGG ATT CGC CAG CCG CCT GGG AAG GGT CTC GAG TGG ATT 144Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 155 160 165GGC TAT ATT TAT TAT AGC GGC AGC ACC AAC TAT AAT CCG AGC CTG AAA 192Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 170 175 180AGC CGG GTG ACC ATT AGC GTT GAT ACT TCG AAA AAC CAG TTT AGC CTG 240Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu185 190 195 200AAA CTG AGC AGC GTG ACG GCG GCG GAT ACG GCC GTG TAT TAT TGC GCG 288Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 205 210 215CGT TGG GGC GGC GAT GGC TTT TAT GCG ATG GAT TAT TGG GGC CAA GGC 336Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln Gly 220 225 230ACC CTG GTG ACG GTT AGC TCA G 358Thr Leu Val Thr Val Ser Ser 235 119 amino acids amino acid linear protein 65Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Tyr 20 25 30Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu Trp Ile 35 40 45Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser Leu Lys 50 55 60Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe Ser Leu 65 70 75 80Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser 115 361 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..360 /product= ”VH5“ 66GAA GTG CAA TTG GTT CAG AGC GGC GCG GAA GTG AAA AAA CCG GGC GAA 48Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu120 125 130 135AGC CTG AAA ATT AGC TGC AAA GGT TCC GGA TAT TCC TTT ACG AGC TAT 96Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr 140 145 150TGG ATT GGC TGG GTG CGC CAG ATG CCT GGG AAG GGT CTC GAG TGG ATG 144Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met 155 160 165GGC ATT ATT TAT CCG GGC GAT AGC GAT ACC CGT TAT TCT CCG AGC TTT 192Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe 170 175 180CAG GGC CAG GTG ACC ATT AGC GCG GAT AAA AGC ATT AGC ACC GCG TAT 240Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr 185 190 195CTT CAA TGG AGC AGC CTG AAA GCG AGC GAT ACG GCC ATG TAT TAT TGC 288Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys200 205 210 215GCG CGT TGG GGC GGC GAT GGC TTT TAT GCG ATG GAT TAT TGG GGC CAA 336Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 220 225 230GGC ACC CTG GTG ACG GTT AGC TCA G 361Gly Thr Leu Val Thr Val Ser Ser 235 120 amino acids amino acid linear protein 67Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu 1 5 10 15Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr 20 25 30Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met 35 40 45Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe 50 55 60Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr 65 70 75 80Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85 90 95Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln 100 105 110Gly Thr Leu Val Thr Val Ser Ser 115 120 370 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..369 /product= ”VH6“ 68CAG GTG CAA TTG CAA CAG TCT GGT CCG GGC CTG GTG AAA CCG AGC CAA 48Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 125 130 135ACC CTG AGC CTG ACC TGT GCG ATT TCC GGA GAT AGC GTG AGC AGC AAC 96Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 140 145 150AGC GCG GCG TGG AAC TGG ATT CGC CAG TCT CCT GGG CGT GGC CTC GAG 144Ser Ala Ala Trp Asn Trp Ile Arg Gln Ser Pro Gly Arg Gly Leu Glu 155 160 165TGG CTG GGC CGT ACC TAT TAT CGT AGC AAA TGG TAT AAC GAT TAT GCG 192Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 170 175 180GTG AGC GTG AAA AGC CGG ATT ACC ATC AAC CCG GAT ACT TCG AAA AAC 240Val Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn185 190 195 200CAG TTT AGC CTG CAA CTG AAC AGC GTG ACC CCG GAA GAT ACG GCC GTG 288Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 205 210 215TAT TAT TGC GCG CGT TGG GGC GGC GAT GGC TTT TAT GCG ATG GAT TAT 336Tyr Tyr Cys Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr 220 225 230TGG GGC CAA GGC ACC CTG GTG ACG GTT AGC TCA G 370Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 235 240 123 amino acids amino acid linear protein 69Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30Ser Ala Ala Trp Asn Trp Ile Arg Gln Ser Pro Gly Arg Gly Leu Glu 35 40 45Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60Val Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95Tyr Tyr Cys Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 49 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 70GAATGCATAC GCTGATATCC AGATGACCCA GAGCCCGTCT AGCCTGAGC 49 56 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 71CGCTCTGCAG GTAATGGTCA CACGATCACC CACGCTCGCG CTCAGGCTAG ACGGGC 56 58 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 72GACCATTACC TGCAGAGCGA GCCAGGGCAT TAGCAGCTAT CTGGCGTGGT ACCAGCAG 58 71 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 73CTTTGCAAGC TGCTGGCTGC ATAAATTAAT AGTTTCGGTG CTTTACCTGG TTTCTGCTGG 60TACCACGCCA G 71 67 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 74CAGCCAGCAG CTTGCAAAGC GGGGTCCCGT CCCGTTTTAG CGGCTCTGGA TCCGGCACTG 60ATTTTAC 67 67 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 75GATAATAGGT CGCAAAGTCT TCAGGTTGCA GGCTGCTAAT GGTCAGGGTA AAATCAGTGC 60CGGATCC 67 54 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 76CGATATCGTG ATGACCCAGA GCCCACTGAG CCTGCCAGTG ACTCCGGGCG AGCC 54 66 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 77GCCGTTGCTA TGCAGCAGGC TTTGGCTGCT TCTGCAGCTA ATGCTCGCAG GCTCGCCCGG 60AGTCAC 66 62 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 78CTGCTGCATA GCAACGGCTA TAACTATCTG GATTGGTACC TTCAAAAACC AGGTCAAAGC 60CC 62 71 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 79CGATCCGGGA CCCCACTGGC ACGGTTGCTG CCCAGATAAA TTAATAGCTG CGGGCTTTGA 60CCTGGTTTTT G 71 69 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 80AGTGGGGTCC CGGATCGTTT TAGCGGCTCT GGATCCGGCA CCGATTTTAC CCTGAAAATT 60AGCCGTGTG 69 54 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 81CCATGCAATA ATACACGCCC ACGTCTTCAG CTTCCACACG GCTAATTTTC AGGG 54 38 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 82GAATGCATAC GCTGATATCG TGCTGACCCA GAGCCCGG 38 67 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 83CGCTCTGCAG CTCAGGGTCG CACGTTCGCC CGGAGACAGG CTCAGGGTCG CCGGGCTCTG 60GGTCAGC 67 56 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 84CCCTGAGCTG CAGAGCGAGC CAGAGCGTGA GCAGCAGCTA TCTGGCGTGG TACCAG 56 72 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 85GCACGGCTGC TCGCGCCATA AATTAATAGA CGCGGTGCTT GACCTGGTTT CTGCTGGTAC 60CACGCCAGAT AG 72 67 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 86GCGCGAGCAG CCGTGCAACT GGGGTCCCGG CGCGTTTTAG CGGCTCTGGA TCCGGCACGG 60ATTTTAC 67 66 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 87GATAATACAC CGCAAAGTCT TCAGGTTCCA GGCTGCTAAT GGTCAGGGTA AAATCCGTGC 60CGGATC 66 49 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 88GAATGCATAC GCTGATATCG TGATGACCCA GAGCCCGGAT AGCCTGGCG 49 56 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 89GCTTCTGCAG TTAATGGTCG CACGTTCGCC CAGGCTCACC GCCAGGCTAT CCGGGC 56 74 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 90CGACCATTAA CTGCAGAAGC AGCCAGAGCG TGCTGTATAG CAGCAACAAC AAAAACTATC 60TGGCGTGGTA CCAG 74 63 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 91GATGCCCAAT AAATTAATAG TTTCGGCGGC TGACCTGGTT TCTGCTGGTA CCACGCCAGA 60TAG 63 74 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 92AAACTATTAA TTTATTGGGC ATCCACCCGT GAAAGCGGGG TCCCGGATCG TTTTAGCGGC 60TCTGGATCCG GCAC 74 73 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 93GATAATACAC CGCCACGTCT TCAGCTTGCA GGGACGAAAT GGTCAGGGTA AAATCAGTGC 60CGGATCCAGA GCC 73 48 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 94GAATGCATAC GCTCAGAGCG TGCTGACCCA GCCGCCTTCA GTGAGTGG 48 71 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 95CAATGTTGCT GCTGCTGCCG CTACACGAGA TGGTCACACG CTGACCTGGT GCGCCACTCA 60CTGAAGGCGG C 71 59 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 96GGCAGCAGCA GCAACATTGG CAGCAACTAT GTGAGCTGGT ACCAGCAGTT GCCCGGGAC 59 68 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 97CCGGCACGCC TGAGGGACGC TGGTTGTTAT CATAAATCAG CAGTTTCGGC GCCGTCCCGG 60GCAACTGC 68 60 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 98CCCTCAGGCG TGCCGGATCG TTTTAGCGGA TCCAAAAGCG GCACCAGCGC GAGCCTTGCG 60 48 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 99CCGCTTCGTC TTCGCTTTGC AGGCCCGTAA TCGCAAGGCT CGCGCTGG 48 49 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 100GAATGCATAC GCTCAGAGCG CACTGACCCA GCCAGCTTCA GTGAGCGGC 49 64 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 101CGCTGCTAGT ACCCGTACAC GAGATGGTAA TGCTCTGACC TGGTGAGCCG CTCACTGAAG 60CTGG 64 64 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 102GTACGGGTAC TAGCAGCGAT GTGGGCGGCT ATAACTATGT GAGCTGGTAC CAGCAGCATC 60CCGG 64 68 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 103CGCCTGAGGG ACGGTTGCTC ACATCATAAA TCATCAGTTT CGGCGCCTTC CCGGGATGCT 60GCTGGTAC 68 62 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 104CAACCGTCCC TCAGGCGTGA GCAACCGTTT TAGCGGATCC AAAAGCGGCA ACACCGCGAG 60CC 62 53 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 105CCGCTTCGTC TTCCGCTTGC AGGCCGCTAA TGGTCAGGCT CGCGGTGTTG CCG 53 47 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 106GAATGCATAC GCTAGCTATG AACTGACCCA GCCGCCTTCA GTGAGCG 47 68 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 107CGCCCAGCGC ATCGCCGCTA CACGAGATAC GCGCGGTCTG ACCTGGTGCA ACGCTCACTG 60AAGGCGGC 68 58 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 108GGCGATGCGC TGGGCGATAA ATACGCGAGC TGGTACCAGC AGAAACCCGG GCAGGCGC 58 70 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 109GCGTTCCGGG ATGCCTGAGG GACGGTCAGA ATCATCATAA ATCACCAGAA CTGGCGCCTG 60CCCGGGTTTC 70 64 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 110CAGGCATCCC GGAACGCTTT AGCGGATCCA ACAGCGGCAA CACCGCGACC CTGACCATTA 60GCGG 64 41 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 111CCGCTTCGTC TTCCGCCTGA GTGCCGCTAA TGGTCAGGGT C 41 37 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 112GCTCTTCACC CCTGTTACCA AAGCCCAGGT GCAATTG 37 79 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 113GGCTTTGCAG CTCACTTTCA CGCTGCTGCC CGGTTTTTTC ACTTCCGCGC CAGACTGAAC 60CAATTGCACC TGGGCTTTG 79 80 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 114GAAAGTGAGC TGCAAAGCCT CCGGAGGCAC TTTTAGCAGC TATGCGATTA GCTGGGTGCG 60CCAAGCCCCT GGGCAGGGTC 80 81 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 115GCCCTGAAAC TTCTGCGCGT AGTTCGCCGT GCCAAAAATC GGAATAATGC CGCCCATCCA 60CTCGAGACCC TGCCCAGGGG C 81 80 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 116GCGCAGAAGT TTCAGGGCCG GGTGACCATT ACCGCGGATG AAAGCACCAG CACCGCGTAT 60ATGGAACTGA GCAGCCTGCG 80 50 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 117GCGCGCAATA ATACACGGCC GTATCTTCGC TACGCAGGCT GCTCAGTTCC 50 79 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 118GGCTTTGCAG CTCACTTTCA CGCTCGCGCC CGGTTTTTTC ACTTCCGCGC CGCTCTGAAC 60CAATTGCACC TGGGCTTTG 79 80 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 119GAAAGTGAGC TGCAAAGCCT CCGGATATAC CTTTACCAGC TATTATATGC ACTGGGTCCG 60CCAAGCCCCT GGGCAGGGTC 80 81 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 120GCCCTGAAAC TTCTGCGCGT AGTTCGTGCC GCCGCTATTC GGGTTAATCC AGCCCATCCA 60CTCGAGACCC TGCCCAGGGG C 81 80 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 121GCGCAGAAGT TTCAGGGCCG GGTGACCATG ACCCGTGATA CCAGCATTAG CACCGCGTAT 60ATGGAACTGA GCAGCCTGCG 80 76 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 122GGTACAGGTC AGGGTCAGGG TTTGGGTCGG TTTCACCAGG GCCGGGCCGC TTTCTTTCAA 60TTGCACCTGG GCTTTG 76 85 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 123CTGACCCTGA CCTGTACCTT TTCCGGATTT AGCCTGTCCA CGTCTGGCGT TGGCGTGGGC 60TGGATTCGCC AGCCGCCTGG GAAAG 85 83 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 124GCGTTTTCAG GCTGGTGCTA TAATACTTAT CATCATCCCA ATCAATCAGA GCCAGCCACT 60CGAGGGCTTT CCCAGGCGGC TGG 83 78 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 125GCACCAGCCT GAAAACGCGT CTGACCATTA GCAAAGATAC TTCGAAAAAT CAGGTGGTGC 60TGACTATGAC CAACATGG 78 53 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 126GCGCGCAATA ATAGGTGGCC GTATCCACCG GGTCCATGTT GGTCATAGTC AGC 53 51 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 127CGAAGTGCAA TTGGTGGAAA GCGGCGGCGG CCTGGTGCAA CCGGGCGGCA G 51 64 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 128CATAGCTGCT AAAGGTAAAT CCGGAGGCCG CGCAGCTCAG ACGCAGGCTG CCGCCCGGTT 60GCAC 64 70 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 129GATTTACCTT TAGCAGCTAT GCGATGAGCT GGGTGCGCCA AGCCCCTGGG AAGGGTCTCG 60AGTGGGTGAG 70 71 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 130GGCCTTTCAC GCTATCCGCA TAATAGGTGC TGCCGCCGCT ACCGCTAATC GCGCTCACCC 60ACTCGAGACC C 71 73 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 131CGGATAGCGT GAAAGGCCGT TTTACCATTT CACGTGATAA TTCGAAAAAC ACCCTGTATC 60TGCAAATGAA CAG 73 62 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 132CACGCGCGCA ATAATACACG GCCGTATCTT CCGCACGCAG GCTGTTCATT TGCAGATACA 60GG 62 70 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 133GGTCAGGCTC AGGGTTTCGC TCGGTTTCAC CAGGCCCGGA CCACTTTCTT GCAATTGCAC 60CTGGGCTTTG 70 76 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 134GAAACCCTGA GCCTGACCTG CACCGTTTCC GGAGGCAGCA TTAGCAGCTA TTATTGGAGC 60TGGATTCGCC AGCCGC 76 77 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 135GATTATAGTT GGTGCTGCCG CTATAATAAA TATAGCCAAT CCACTCGAGA CCCTTCCCAG 60GCGGCTGGCG AATCCAG 77 79 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 136CGGCAGCACC AACTATAATC CGAGCCTGAA AAGCCGGGTG ACCATTAGCG TTGATACTTC 60GAAAAACCAG TTTAGCCTG 79 69 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 137GCGCGCAATA ATACACGGCC GTATCCGCCG CCGTCACGCT GCTCAGTTTC AGGCTAAACT 60GGTTTTTCG 69 37 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 138GCTCTTCACC CCTGTTACCA AAGCCGAAGT GCAATTG 37 79 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 139CCTTTGCAGC TAATTTTCAG GCTTTCGCCC GGTTTTTTCA CTTCCGCGCC GCTCTGAACC 60AATTGCACTT CGGCTTTGG 79 75 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 140CCTGAAAATT AGCTGCAAAG GTTCCGGATA TTCCTTTACG AGCTATTGGA TTGGCTGGGT 60GCGCCAGATG CCTGG 75 78 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 141CGGAGAATAA CGGGTATCGC TATCGCCCGG ATAAATAATG CCCATCCACT CGAGACCCTT 60CCCAGGCATC TGGCGCAC 78 77 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 142CGATACCCGT TATTCTCCGA GCTTTCAGGG CCAGGTGACC ATTAGCGCGG ATAAAAGCAT 60TAGCACCGCG TATCTTC 77 68 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 143GCGCGCAATA ATACATGGCC GTATCGCTCG CTTTCAGGCT GCTCCATTGA AGATACGCGG 60TGCTAATG 68 81 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 144GAAATCGCAC AGGTCAGGCT CAGGGTTTGG CTCGGTTTCA CCAGGCCCGG ACCAGACTGT 60TGCAATTGCA CCTGGGCTTT G 81 79 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 145GCCTGACCTG TGCGATTTCC GGAGATAGCG TGAGCAGCAA CAGCGCGGCG TGGAACTGGA 60TTCGCCAGTC TCCTGGGCG 79 78 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 146CACCGCATAA TCGTTATACC ATTTGCTACG ATAATAGGTA CGGCCCAGCC ACTCGAGGCC 60ACGCCCAGGA GACTGGCG 78 78 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 147GGTATAACGA TTATGCGGTG AGCGTGAAAA GCCGGATTAC CATCAACCCG GATACTTCGA 60AAAACCAGTT TAGCCTGC 78 68 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 148GCGCGCAATA ATACACGGCC GTATCTTCCG GGGTCACGCT GTTCAGTTGC AGGCTAAACT 60GGTTTTTC 68 69 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 149GGCTGAAGAC GTGGGCGTGT ATTATTGCCA GCAGCATTAT ACCACCCCGC CGACCTTTGG 60CCAGGGTAC 69 71 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 150GCGGAAAAAT AAACACGCTC GGAGCAGCCA CCGTACGTTT AATTTCAACT TTCGTACCCT 60GGCCAAAGGT C 71 70 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 151GAGCGTGTTT ATTTTTCCGC CGAGCGATGA ACAACTGAAA AGCGGCACGG CGAGCGTGGT 60GTGCCTGCTG 70 71 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 152CAGCGCGTTG TCTACTTTCC ACTGAACTTT CGCTTCACGC GGATAAAAGT TGTTCAGCAG 60GCACACCACG C 71 69 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 153GAAAGTAGAC AACGCGCTGC AAAGCGGCAA CAGCCAGGAA AGCGTGACCG AACAGGATAG 60CAAAGATAG 69 74 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 154GTTTTTCATA ATCCGCTTTG CTCAGGGTCA GGGTGCTGCT CAGAGAATAG GTGCTATCTT 60TGCTATCCTG TTCG 74 71 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 155GCAAAGCGGA TTATGAAAAA CATAAAGTGT ATGCGTGCGA AGTGACCCAT CAAGGTCTGA 60GCAGCCCGGT G 71 57 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 156GGCATGCTTA TCAGGCCTCG CCACGATTAA AAGATTTAGT CACCGGGCTG CTCAGAC 57 48 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 157GGCGTCTAGA GGCCAAGGCA CCCTGGTGAC GGTTAGCTCA GCGTCGAC 48 63 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 158GTGCTTTTGC TGCTCGGAGC CAGCGGAAAC ACGCTTGGAC CTTTGGTCGA CGCTGAGCTA 60ACC 63 66 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 159CTCCGAGCAG CAAAAGCACC AGCGGCGGCA CGGCTGCCCT GGGCTGCCTG GTTAAAGATT 60ATTTCC 66 65 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 160CTGGTCAGCG CCCCGCTGTT CCAGCTCACG GTGACTGGTT CCGGGAAATA ATCTTTAACC 60AGGCA 65 60 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 161AGCGGGGCGC TGACCAGCGG CGTGCATACC TTTCCGGCGG TGCTGCAAAG CAGCGGCCTG 60 65 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 162GTGCCTAAGC TGCTGCTCGG CACGGTCACA ACGCTGCTCA GGCTATACAG GCCGCTGCTT 60TGCAG 65 61 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 163GAGCAGCAGC TTAGGCACTC AGACCTATAT TTGCAACGTG AACCATAAAC CGAGCAACAC 60C 61 59 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 164GCGCGAATTC GCTTTTCGGT TCCACTTTTT TATCCACTTT GGTGTTGCTC GGTTTATGG 59 333 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 7..321 /product= ”C kappa“ 165CGTACG GTG GCT GCT CCG AGC GTG TTT ATT TTT CCG CCG AGC GAT GAA 48 Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 125 130 135CAA CTG AAA AGC GGC ACG GCG AGC GTG GTG TGC CTG CTG AAC AAC TTT 96Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 140 145 150TAT CCG CGT GAA GCG AAA GTT CAG TGG AAA GTA GAC AAC GCG CTG CAA 144Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 155 160 165AGC GGC AAC AGC CAG GAA AGC GTG ACC GAA CAG GAT AGC AAA GAT AGC 192Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser170 175 180 185ACC TAT TCT CTG AGC AGC ACC CTG ACC CTG AGC AAA GCG GAT TAT GAA 240Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 190 195 200AAA CAT AAA GTG TAT GCG TGC GAA GTG ACC CAT CAA GGT CTG AGC AGC 288Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 205 210 215CCG GTG ACT AAA TCT TTT AAT CGT GGC GAG GCC TGATAAGCAT GC 333Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Ala 220 225 105 amino acids amino acid linear protein 166Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 1 5 10 15Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 20 25 30Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 35 40 45Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 50 55 60Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His 65 70 75 80Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val 85 90 95Thr Lys Ser Phe Asn Arg Gly Glu Ala 100 105 327 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 6..317 /product= ”CH1“ 167GCTCA GCG TCG ACC AAA GGT CCA AGC GTG TTT CCG CTG GCT CCG AGC 47 Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser 110 115AGC AAA AGC ACC AGC GGC GGC ACG GCT GCC CTG GGC TGC CTG GTT AAA 95Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys120 125 130 135GAT TAT TTC CCG GAA CCA GTC ACC GTG AGC TGG AAC AGC GGG GCG CTG 143Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu 140 145 150ACC AGC GGC GTG CAT ACC TTT CCG GCG GTG CTG CAA AGC AGC GGC CTG 191Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu 155 160 165TAT AGC CTG AGC AGC GTT GTG ACC GTG CCG AGC AGC AGC TTA GGC ACT 239Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr 170 175 180CAG ACC TAT ATT TGC AAC GTG AAC CAT AAA CCG AGC AAC ACC AAA GTG 287Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val 185 190 195GAT AAA AAA GTG GAA CCG AAA AGC GAA TTC TGATAAGCTT 327Asp Lys Lys Val Glu Pro Lys Ser Glu Phe200 205 104 amino acids amino acid linear protein 168Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys 1 5 10 15Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr 65 70 75 80Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95Lys Val Glu Pro Lys Ser Glu Phe 100 408 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 85..396 /product= ”C lambda“ 169GAAGACGAAG CGGATTATTA TTGCCAGCAG CATTATACCA CCCCGCCTGT GTTTGGCGGC 60GGCACGAAGT TAACCGTTCT TGGC CAG CCG AAA GCC GCA CCG AGT GTG ACG 111 Gln Pro Lys Ala Ala Pro Ser Val Thr 105 110CTG TTT CCG CCG AGC AGC GAA GAA TTG CAG GCG AAC AAA GCG ACC CTG 159Leu Phe Pro Pro Ser Ser Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu 115 120 125GTG TGC CTG ATT AGC GAC TTT TAT CCG GGA GCC GTG ACA GTG GCC TGG 207Val Cys Leu Ile Ser Asp Phe Tyr Pro Gly Ala Val Thr Val Ala Trp130 135 140 145AAG GCA GAT AGC AGC CCC GTC AAG GCG GGA GTG GAG ACC ACC ACA CCC 255Lys Ala Asp Ser Ser Pro Val Lys Ala Gly Val Glu Thr Thr Thr Pro 150 155 160TCC AAA CAA AGC AAC AAC AAG TAC GCG GCC AGC AGC TAT CTG AGC CTG 303Ser Lys Gln Ser Asn Asn Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu 165 170 175ACG CCT GAG CAG TGG AAG TCC CAC AGA AGC TAC AGC TGC CAG GTC ACG 351Thr Pro Glu Gln Trp Lys Ser His Arg Ser Tyr Ser Cys Gln Val Thr 180 185 190CAT GAG GGG AGC ACC GTG GAA AAA ACC GTT GCG CCG ACT GAG GCC 396His Glu Gly Ser Thr Val Glu Lys Thr Val Ala Pro Thr Glu Ala 195 200 205TGATAAGCAT GC 408 104 amino acids amino acid linear protein 170Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu 1 5 10 15Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe 20 25 30Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val 35 40 45Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys 50 55 60Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser 65 70 75 80His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu 85 90 95Lys Thr Val Ala Pro Thr Glu Ala 100 78 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 171GAAGACAAGC GGATTATTAT TGCCAGCAGC ATTATACCAC CCCGCCTGTG TTTGGCGGCG 60GCACGAAGTT AACCGTTC 78 80 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 172CAATTCTTCG CTGCTCGGCG GAAACAGCGT CACACTCGGT GCGGCTTTCG GCTGGCCAAG 60AACGGTTAAC TTCGTGCCGC 80 80 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 173CGCCGAGCAG CGAAGAATTG CAGGCGAACA AAGCGACCCT GGTGTGCCTG ATTAGCGACT 60TTTATCCGGG AGCCGTGACA 80 80 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 174TGTTTGGAGG GTGTGGTGGT CTCCACTCCC GCCTTGACGG GGCTGCTATC TGCCTTCCAG 60GCCACTGTCA CGGCTCCCGG 80 94 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 175CCACACCCTC CAAACAAAGC AACAACAAGT ACGCGGCCAG CAGCTATCTG AGCCTGACGC 60CTGAGCAGTG GAAGTCCCAC AGAAGCTACA GCTG 94 80 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 176GCATGCTTAT CAGGCCTCAG TCGGCGCAAC GGTTTTTTCC ACGGTGCTCC CCTCATGCGT 60GACCTGGCAG CTGTAGCTTC 80 843 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene“ CDS 1..843 /product= ”VH3-Vk2“ 177ATG AAA CAA AGC ACT ATT GCA CTG GCA CTC TTA CCG TTG CTC TTC ACC 48Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr105 110 115 120CCT GTT ACC AAA GCC GAC TAC AAA GAT GAA GTG CAA TTG GTG GAA AGC 96Pro Val Thr Lys Ala Asp Tyr Lys Asp Glu Val Gln Leu Val Glu Ser 125 130 135GGC GGC GGC CTG GTG CAA CCG GGC GGC AGC CTG CGT CTG AGC TGC GCG 144Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala 140 145 150GCC TCC GGA TTT ACC TTT AGC AGC TAT GCG ATG AGC TGG GTG CGC CAA 192Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln 155 160 165GCC CCT GGG AAG GGT CTC GAG TGG GTG AGC GCG ATT AGC GGT AGC GGC 240Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser Gly 170 175 180GGC AGC ACC TAT TAT GCG GAT AGC GTG AAA GGC CGT TTT ACC ATT TCA 288Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser185 190 195 200CGT GAT AAT TCG AAA AAC ACC CTG TAT CTG CAA ATG AAC AGC CTG CGT 336Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg 205 210 215GCG GAA GAT ACG GCC GTG TAT TAT TGC GCG CGT TGG GGC GGC GAT GGC 384Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Trp Gly Gly Asp Gly 220 225 230TTT TAT GCG ATG GAT TAT TGG GGC CAA GGC ACC CTG GTG ACG GTT AGC 432Phe Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 235 240 245TCA GCG GGT GGC GGT TCT GGC GGC GGT GGG AGC GGT GGC GGT GGT TCT 480Ser Ala Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 250 255 260GGC GGT GGT GGT TCC GAT ATC GTG ATG ACC CAG AGC CCA CTG AGC CTG 528Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu265 270 275 280CCA GTG ACT CCG GGC GAG CCT GCG AGC ATT AGC TGC AGA AGC AGC CAA 576Pro Val Thr Pro Gly Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln 285 290 295AGC CTG CTG CAT AGC AAC GGC TAT AAC TAT CTG GAT TGG TAC CTT CAA 624Ser Leu Leu His Ser Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln 300 305 310AAA CCA GGT CAA AGC CCG CAG CTA TTA ATT TAT CTG GGC AGC AAC CGT 672Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg 315 320 325GCC AGT GGG GTC CCG GAT CGT TTT AGC GGC TCT GGA TCC GGC ACC GAT 720Ala Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 330 335 340TTT ACC CTG AAA ATT AGC CGT GTG GAA GCT GAA GAC GTG GGC GTG TAT 768Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr345 350 355 360TAT TGC CAG CAG CAT TAT ACC ACC CCG CCG ACC TTT GGC CAG GGT ACG 816Tyr Cys Gln Gln His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr 365 370 375AAA GTT GAA ATT AAA CGT ACG GAA TTC 843Lys Val Glu Ile Lys Arg Thr Glu Phe 380 385 281 amino acids amino acid linear protein 178Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15Pro Val Thr Lys Ala Asp Tyr Lys Asp Glu Val Gln Leu Val Glu Ser 20 25 30Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala 35 40 45Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln 50 55 60Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser Gly 65 70 75 80Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser 85 90 95Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg 100 105 110Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Trp Gly Gly Asp Gly 115 120 125Phe Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 130 135 140Ser Ala Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser145 150 155 160Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu 165 170 175Pro Val Thr Pro Gly Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln 180 185 190Ser Leu Leu His Ser Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln 195 200 205Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg 210 215 220Ala Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp225 230 235 240Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr 245 250 255Tyr Cys Gln Gln His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr 260 265 270Lys Val Glu Ile Lys Arg Thr Glu Phe 275 280 15 amino acids amino acid <Unknown> linear protein internal 179Cys Ala Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp1 5 10 15 12 amino acids amino acid <Unknown> linear protein internal 180Cys Ala Arg Phe Gly Lys Met Asn Tyr Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 181Cys Ala Arg His Arg Thr Glu Trp His Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 182Cys Ala Arg Val Arg Glu Leu Tyr His Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 183Cys Ala Arg Lys Phe Leu Lys Ala Arg Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 184Cys Ala Arg Trp Asn Thr Thr Gly Tyr Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 185Cys Ala Arg Ile Asn Glu Ala Gln Pro Asp Tyr Trp1 5 10 11 amino acids amino acid <Unknown> linear protein internal 186Cys Ala Arg Thr Ala Ile Thr Arg Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 187Cys Ala Arg Trp Tyr Asn Arg Asn Ser Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 188Cys Ala Arg Ser Val Gly Asp Ser Lys Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 189Cys Ala Arg Ser Lys Thr Phe Ala Ala Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 190Cys Ala Arg Val Ala Pro Gln Tyr Asp Asp Tyr Trp1 5 10 12 amino acids amino acid <Unknown> linear protein internal 191Cys Ala Arg Met Gln Ser Glu Trp Met Asp Tyr Trp1 5 10 17 amino acids amino acid <Unknown> linear protein internal 192Cys Ala Arg Tyr Phe Val His Phe Leu Tyr Thr Met Val Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 193Cys Ala Arg Met Ala Leu Arg Ala Ser Gly Lys Tyr Ile Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 194Cys Ala Arg Lys Asn Gln Met Val Phe His Ala Arg Lys Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 195Cys Ala Arg Thr Gln Ser Phe Trp Glu Gln Gln Lys Val Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 196Cys Ala Arg Tyr Pro Tyr Arg Ser Asn Phe Phe Met Pro Met Asp Val1 5 10 15Trp 16 amino acids amino acid <Unknown> linear protein internal Modified-site 3..4 /product= ”see Figure 10C“ /label= R*G /note= ”* denotes codon with one-base deletion, causes shift of reading fr...“ 197Cys Ala Arg Gly Ser Gly Ser Glu His Trp Ser Ile Phe Asp Val Trp1 5 10 15 17 amino acids amino acid <Unknown> linear protein internal 198Cys Ala Arg Arg Asn Pro Trp Asn Val Asn Tyr Leu His Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 199Cys Ala Arg Met Lys Pro Met Leu Asn Arg Asp Gly Thr Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 200Cys Ala Arg Lys Gly Ser Glu Phe Leu Glu Thr Asp Val Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 201Cys Ala Arg Ser Trp Thr Asn Asp Lys Pro Asn Phe Ile Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 202Cys Ala Arg Tyr Ala Gly Thr Thr Phe Lys Gln Gly Pro Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 203Cys Ala Arg Lys Arg Met Met Gln Asn Pro Arg Phe Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 204Cys Ala Arg Arg Ser Lys Gln Lys Arg Lys Met Arg Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 205Cys Ala Arg Arg Asn Gly Lys Arg His Leu Arg His Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 206Cys Ala Arg Arg Lys Met Arg Lys Arg Ile Lys Arg Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 207Cys Ala Arg Tyr Arg Lys Ile Met Lys Trp Lys Asn Ser Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 208Cys Ala Arg Leu Ile Glu Val His Pro Ser Phe Asp Gln Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 209Cys Ala Arg Arg Lys Pro Met Phe Leu Lys Lys Ala Val Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 210Cys Ala Arg Arg Lys Phe His Arg Tyr Ser Thr Val Lys Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 211Cys Ala Arg Arg Lys Thr Met Arg Ser Arg Val Lys Tyr Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 212Cys Ala Arg Lys Lys Arg Ser Trp Arg Arg Met Asp Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 213Cys Ala Arg Arg Asn Pro Arg Arg Gly Arg Met Asn Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 214Cys Ala Arg Lys Gly Lys Lys Lys Phe Ala Arg Pro Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 215Cys Ala Arg Arg Met Val His Lys Gly Lys Arg Lys Ile Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 216Cys Ala Arg Arg Lys His Ile Thr Tyr Pro Arg Lys Gln Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 217Cys Ala Arg Arg Trp Thr Lys Arg Arg Ser Phe Ala Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 218Cys Ala Arg Lys Lys Leu Lys Gln Tyr Thr Phe Ser Arg Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 219Cys Ala Arg Thr Arg Pro Trp Gln Ala Thr Arg Lys Gly Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 220Cys Ala Arg Asn Gln Trp Glu Phe Lys Asn Arg Arg Lys Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 221Cys Ala Arg Lys Arg Trp Met Trp Pro Ile Gly Lys Arg Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 222Cys Ala Arg Tyr Ser Leu Trp Arg Leu Asp Glu Tyr Phe Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 223Cys Ala Arg Val Pro Trp Gly Asp Phe Trp Ser Trp His Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 224Cys Ala Arg Asn Gly Leu Glu Pro Arg His Arg Lys Met Met Asp Tyr1 5 10 15Trp 12 amino acids amino acid <Unknown> linear protein internal 225Cys Ala Arg Ile Met Lys Ala Pro Pro Asp Tyr Trp1 5 10 17 amino acids amino acid <Unknown> linear protein internal 226Cys Ala Arg Arg Lys Thr Trp His Trp Phe Tyr Lys Arg Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 227Cys Ala Arg Trp Lys Asp Met Trp Ser Gln Val Tyr Val Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 228Cys Ala Arg Asn Lys Gln Gln Met Arg Phe Arg Arg Phe Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 229Cys Ala Arg Asn Met Leu Ala Leu Ser Arg Gly Lys Glu Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 230Cys Ala Arg Asn Met Arg Leu Met Arg Met Arg Lys Asn Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 231Cys Ala Arg Tyr Ile Lys Gln Ala Lys Arg Lys Leu Ala Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 232Cys Ala Arg Tyr Asn Arg His Ala Trp Gln Lys Met Gln Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 233Cys Ala Arg Tyr Val Lys Tyr Ala Arg Asn Lys Met Gln Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 234Cys Ala Arg Tyr Lys Arg Gly Ala Trp Met Lys Thr Met Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 235Cys Ala Arg Arg Lys Pro Leu Arg Arg Ile Met Lys Trp Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 236Cys Ala Arg Tyr Arg Lys Arg Ala Ser Arg Gln Met Gln Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 237Cys Ala Arg Gln Arg Tyr Arg Ser Lys Ile Lys Gly His Phe Asp Val1 5 10 15Trp 16 amino acids amino acid <Unknown> linear protein internal 238Cys Ala Arg Trp Arg Asp Phe Asn Ser Tyr Asp Pro Met Asp Tyr Trp1 5 10 15 17 amino acids amino acid <Unknown> linear protein internal 239Cys Ala Arg Met Ala Asp Leu Asp Asn Tyr Trp Val Gln Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 240Cys Ala Arg Leu Gln Ala Tyr Leu Lys Pro His His Trp Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 241Cys Ala Arg Arg Leu Ile Glu Gln Ala Arg Asp His Val Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 242Cys Ala Arg Ser Trp His Asn Ser Gln Phe Thr Gln Ser Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 243Cys Ala Arg Val Asp His Phe Gln Thr Glu Asn Glu Trp Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 244Cys Ala Arg Asp Trp Pro Thr Leu Ile Phe Trp Tyr Trp Phe Asp Tyr1 5 10 15Trp 12 amino acids amino acid <Unknown> linear protein internal 245Cys Ala Arg Gly Phe Gly Phe Thr Glu Asp Tyr Trp1 5 10 17 amino acids amino acid <Unknown> linear protein internal 246Cys Ala Arg Gln Phe Asp Glu Asp Ser Phe Val Arg Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 247Cys Ala Arg Ile Leu Lys Glu Ser Ser Lys Ser Arg Gln Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 248Cys Ala Arg Glu Gln Asp Glu Tyr Gly Ala Ile Arg Ile Met Asp Tyr1 5 10 15Trp 18 amino acids amino acid <Unknown> linear protein internal 249Cys Ala Arg Asn His Phe Glu Ala Ser Trp Pro Arg Arg Gln Met Asp1 5 10 15Val Trp 17 amino acids amino acid <Unknown> linear protein internal 250Cys Ala Arg Glu Asn Glu Trp Val Asp Met Ile Leu Asp Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 251Cys Ala Arg Gln Tyr Ser Glu Thr Arg Trp Val Arg Lys Phe Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 252Cys Ala Arg Gln Phe Lys Glu Ser Lys Thr Arg Arg Lys Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 253Cys Ala Arg Lys Lys Thr Gln Tyr Val His Asp Trp Arg Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 254Cys Ala Arg Arg Trp Arg Glu Thr Lys Ser Lys Arg Phe Phe Asp Val1 5 10 15Trp 12 amino acids amino acid <Unknown> linear protein internal 255Cys Ala Arg Asp Tyr Ile Met Glu Phe Asp Tyr Trp1 5 10 17 amino acids amino acid <Unknown> linear protein internal 256Cys Ala Arg Gln Phe Glu Glu Thr Lys Gln Arg Arg Leu Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 257Cys Ala Arg Asp Gln Gly Phe Tyr Ala Ile Asp Tyr Val Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 258Cys Ala Arg Val Phe Thr Tyr Met Tyr Asn Tyr Phe Arg Phe Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 259Cys Ala Arg Val Phe Phe Glu Gln Met Glu Val Val Arg Met Asp Val1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 260Cys Ala Arg Glu Lys Glu Tyr Arg Leu Ser Trp Ser Gln Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 261Cys Ala Arg Tyr Pro Ser Arg Trp Ala Pro Asn Trp Tyr Met Asp Tyr1 5 10 15Trp 17 amino acids amino acid <Unknown> linear protein internal 262Cys Ala Arg Asp Gly Gly Phe Lys Pro Leu Thr His Phe Phe Asp Val1 5 10 15Trp 143 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 263ACATGTAAGC TTCCCCCCCC CCTTAATTAA CCCCCCCCCC TGTACACCCC CCCCCCGCTA 60GCCCCCCCCC CCAGATCTCC CCCCCCCCGA CGTCCCCCCT CTAGACCCCC CCCCCGCATG 120CCCCCCCCCC CGAATTCGAC GTC 143 1947 base pairs nucleic acid double circular other nucleic acid /desc = ”synthetic vector“ CDS 132..989 /product= ”Amp resistance“ 264CAGGTGGCAC TTTTCGGGGA AATGTGCGCG GAACCCCTAT TTGTTTATTT TTCTAAATAC 60ATTCAAATAT GTATCCGCTC ATGAGACAAT AACCCTGATA AATGCTTCAA TAATATTGAA 120AAAGGAAGAG T ATG AGT ATT CAA CAT TTC CGT GTC GCC CTT ATT CCC TTT 170 Met Ser Ile Gln His Phe Arg Val Ala Leu Ile Pro Phe 285 290TTT GCG GCA TTT TGC CTT CCT GTT TTT GCT CAC CCA GAA ACG CTG GTG 218Phe Ala Ala Phe Cys Leu Pro Val Phe Ala His Pro Glu Thr Leu Val295 300 305 310AAA GTA AAA GAT GCT GAA GAT CAG TTG GGT GCA CGA GTG GGT TAC ATC 266Lys Val Lys Asp Ala Glu Asp Gln Leu Gly Ala Arg Val Gly Tyr Ile 315 320 325GAA CTG GAT CTC AAC AGC GGT AAG ATC CTT GAG AGT TTT CGC CCC GAA 314Glu Leu Asp Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe Arg Pro Glu 330 335 340GAA CGT TTT CCA ATG ATG AGC ACT TTT AAA GTT CTG CTA TGT GGC GCG 362Glu Arg Phe Pro Met Met Ser Thr Phe Lys Val Leu Leu Cys Gly Ala 345 350 355GTA TTA TCC CGT ATT GAC GCC GGG CAA GAG CAA CTC GGT CGC CGC ATA 410Val Leu Ser Arg Ile Asp Ala Gly Gln Glu Gln Leu Gly Arg Arg Ile 360 365 370CAC TAT TCT CAG AAT GAC TTG GTT GAG TAC TCA CCA GTC ACA GAA AAG 458His Tyr Ser Gln Asn Asp Leu Val Glu Tyr Ser Pro Val Thr Glu Lys375 380 385 390CAT CTT ACG GAT GGC ATG ACA GTA AGA GAA TTA TGC AGT GCT GCC ATA 506His Leu Thr Asp Gly Met Thr Val Arg Glu Leu Cys Ser Ala Ala Ile 395 400 405ACC ATG AGT GAT AAC ACT GCG GCC AAC TTA CTT CTG ACA ACG ATC GGA 554Thr Met Ser Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr Ile Gly 410 415 420GGA CCG AAG GAG CTA ACC GCT TTT TTG CAC AAC ATG GGG GAT CAT GTA 602Gly Pro Lys Glu Leu Thr Ala Phe Leu His Asn Met Gly Asp His Val 425 430 435ACT CGC CTT GAT CGT TGG GAA CCG GAG CTG AAT GAA GCC ATA CCA AAC 650Thr Arg Leu Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala Ile Pro Asn 440 445 450GAC GAG CGT GAC ACC ACG ATG CCT GTA GCA ATG GCA ACA ACG TTG CGC 698Asp Glu Arg Asp Thr Thr Met Pro Val Ala Met Ala Thr Thr Leu Arg455 460 465 470AAA CTA TTA ACT GGC GAA CTA CTT ACT CTA GCT TCC CGG CAA CAA TTA 746Lys Leu Leu Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg Gln Gln Leu 475 480 485ATA GAC TGG ATG GAG GCG GAT AAA GTT GCA GGA CCA CTT CTG CGC TCG 794Ile Asp Trp Met Glu Ala Asp Lys Val Ala Gly Pro Leu Leu Arg Ser 490 495 500GCC CTT CCG GCT GGC TGG TTT ATT GCT GAT AAA TCT GGA GCC GGT GAG 842Ala Leu Pro Ala Gly Trp Phe Ile Ala Asp Lys Ser Gly Ala Gly Glu 505 510 515CGT GGG TCT CGC GGT ATC ATT GCA GCA CTG GGG CCA GAT GGT AAG CCC 890Arg Gly Ser Arg Gly Ile Ile Ala Ala Leu Gly Pro Asp Gly Lys Pro 520 525 530TCC CGT ATC GTA GTT ATC TAC ACG ACG GGG AGT CAG GCA ACT ATG GAT 938Ser Arg Ile Val Val Ile Tyr Thr Thr Gly Ser Gln Ala Thr Met Asp535 540 545 550GAA CGA AAT AGA CAG ATC GCT GAG ATA GGT GCC TCA CTG ATT AAG CAT 986Glu Arg Asn Arg Gln Ile Ala Glu Ile Gly Ala Ser Leu Ile Lys His 555 560 565TGG TAACTGTCAG ACCAAGTTTA CTCATATATA CTTTAGATTG ATTTAAAACT 1039TrpTCATTTTTAA TTTAAAAGGA TCTAGGTGAA GATCCTTTTT GATAATCTCA TGACCAAAAT 1099CCCTTAACGT GAGTTTTCGT TCCACTGAGC GTCAGACCCC GTAGAAAAGA TCAAAGGATC 1159TTCTTGAGAT CCTTTTTTTC TGCGCGTAAT CTGCTGCTTG CAAACAAAAA AACCACCGCT 1219ACCAGCGGTG GTTTGTTTGC CGGATCAAGA GCTACCAACT CTTTTTCCGA AGGTAACTGG 1279CTTCAGCAGA GCGCAGATAC CAAATACTGT CCTTCTAGTG TAGCCGTAGT TAGGCCACCA 1339CTTCAAGAAC TCTGTAGCAC CGCCTACATA CCTCGCTCTG CTAATCCTGT TACCAGTGGC 1399TGCTGCCAGT GGCGATAAGT CGTGTCTTAC CGGGTTGGAC TCAAGACGAT AGTTACCGGA 1459TAAGGCGCAG CGGTCGGGCT GAACGGGGGG TTCGTGCACA CAGCCCAGCT TGGAGCGAAC 1519GACCTACACC GAACTGAGAT ACCTACAGCG TGAGCTATGA GAAAGCGCCA CGCTTCCCGA 1579AGGGAGAAAG GCGGACAGGT ATCCGGTAAG CGGCAGGGTC GGAACAGGAG AGCGCACGAG 1639GGAGCTTCCA GGGGGAAACG CCTGGTATCT TTATAGTCCT GTCGGGTTTC GCCACCTCTG 1699ACTTGAGCGT CGATTTTTGT GATGCTCGTC AGGGGGGCGG AGCCTATGGA AAAACGCCAG 1759CAACGCGGCC TTTTTACGGT TCCTGGCCTT TTGCTGGCCT TTTGCTCACA TGTAAGCTTC 1819CCCCCCCCCT TAATTAACCC CCCCCCCTGT ACACCCCCCC CCCGCTAGCC CCCCCCCCCA 1879GATCTCCCCC CCCCCGACGT CCCCCCTCTA GACCCCCCCC CCGCATGCCC CCCCCCCCGA 1939ATTCACGT 1947 286 amino acids amino acid linear protein 265Met Ser Ile Gln His Phe Arg Val Ala Leu Ile Pro Phe Phe Ala Ala 1 5 10 15Phe Cys Leu Pro Val Phe Ala His Pro Glu Thr Leu Val Lys Val Lys 20 25 30Asp Ala Glu Asp Gln Leu Gly Ala Arg Val Gly Tyr Ile Glu Leu Asp 35 40 45Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe Arg Pro Glu Glu Arg Phe 50 55 60Pro Met Met Ser Thr Phe Lys Val Leu Leu Cys Gly Ala Val Leu Ser 65 70 75 80Arg Ile Asp Ala Gly Gln Glu Gln Leu Gly Arg Arg Ile His Tyr Ser 85 90 95Gln Asn Asp Leu Val Glu Tyr Ser Pro Val Thr Glu Lys His Leu Thr 100 105 110Asp Gly Met Thr Val Arg Glu Leu Cys Ser Ala Ala Ile Thr Met Ser 115 120 125Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr Ile Gly Gly Pro Lys 130 135 140Glu Leu Thr Ala Phe Leu His Asn Met Gly Asp His Val Thr Arg Leu145 150 155 160Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala Ile Pro Asn Asp Glu Arg 165 170 175Asp Thr Thr Met Pro Val Ala Met Ala Thr Thr Leu Arg Lys Leu Leu 180 185 190Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg Gln Gln Leu Ile Asp Trp 195 200 205Met Glu Ala Asp Lys Val Ala Gly Pro Leu Leu Arg Ser Ala Leu Pro 210 215 220Ala Gly Trp Phe Ile Ala Asp Lys Ser Gly Ala Gly Glu Arg Gly Ser225 230 235 240Arg Gly Ile Ile Ala Ala Leu Gly Pro Asp Gly Lys Pro Ser Arg Ile 245 250 255Val Val Ile Tyr Thr Thr Gly Ser Gln Ala Thr Met Asp Glu Arg Asn 260 265 270Arg Gln Ile Ala Glu Ile Gly Ala Ser Leu Ile Lys His Trp 275 280 285 142 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 266GACGTCTTAA TGTGAGTTAG CTCACTCATT AGGCACCCCA GGCTTTACAC TTTATGCTTC 60CGGCTCGTAT GTTGTGTGGA ATTGTGAGCG GATAACAATT TCACACAGGA AACAGCTATG 120ACCATGATTA CGAATTTCTA GA 142 520 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene cassette“ CDS 1..510 /product= ”gIIIp ss with myc-tag, amber codon“ 267GAA TTC GAG CAG AAG CTG ATC TCT GAG GAG GAT CTG TAG GGT GGT GGC 48Glu Phe Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu * Gly Gly Gly 290 295 300TCT GGT TCC GGT GAT TTT GAT TAT GAA AAG ATG GCA AAC GCT AAT AAG 96Ser Gly Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys 305 310 315GGG GCT ATG ACC GAA AAT GCC GAT GAA AAC GCG CTA CAG TCT GAC GCT 144Gly Ala Met Thr Glu Asn Ala Asp Glu Asn Ala Leu Gln Ser Asp Ala 320 325 330AAA GGC AAA CTT GAT TCT GTC GCT ACT GAT TAC GGT GCT GCT ATC GAT 192Lys Gly Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly Ala Ala Ile Asp335 340 345 350GGT TTC ATT GGT GAC GTT TCC GGC CTT GCT AAT GGT AAT GGT GCT ACT 240Gly Phe Ile Gly Asp Val Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr 355 360 365GGT GAT TTT GCT GGC TCT AAT TCC CAA ATG GCT CAA GTC GGT GAC GGT 288Gly Asp Phe Ala Gly Ser Asn Ser Gln Met Ala Gln Val Gly Asp Gly 370 375 380GAT AAT TCA CCT TTA ATG AAT AAT TTC CGT CAA TAT TTA CCT TCC CTC 336Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gln Tyr Leu Pro Ser Leu 385 390 395CCT CAA TCG GTT GAA TGT CGC CCT TTT GTC TTT GGC GCT GGT AAA CCA 384Pro Gln Ser Val Glu Cys Arg Pro Phe Val Phe Gly Ala Gly Lys Pro 400 405 410TAT GAA TTT TCT ATT GAT TGT GAC AAA ATA AAC TTA TTC CGT GGT GTC 432Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn Leu Phe Arg Gly Val415 420 425 430TTT GCG TTT CTT TTA TAT GTT GCC ACC TTT ATG TAT GTA TTT TCT ACG 480Phe Ala Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr Val Phe Ser Thr 435 440 445TTT GCT AAC ATA CTG CGT AAT AAG GAG TCT TGATAAGCTT 520Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser 450 455 12 amino acids amino acid linear protein 268Glu Phe Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 1 5 10 123 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 269GGGGGGGGGG AAGCTTGACC TGTGAAGTGA AAAATGGCGC AGATTGTGCG ACATTTTTTT 60TGTCTGCCGT TTAATTAAAG GGGGGGGGGG GCCGGCCTGG GGGGGGGTGT ACAGGGGGGG 120GGG 123 470 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 270GCTAGCACGC GCCCTGTAGC GGCGCATTAA GCGCGGCGGG TGTGGTGGTT ACGCGCAGCG 60TGACCGCTAC ACTTGCCAGC GCCCTAGCGC CCGCTCCTTT CGCTTTCTTC CCTTCCTTTC 120TCGCCACGTT CGCCGGCTTT CCCCGTCAAG CTCTAAATCG GGGCATCCCT TTAGGGTTCC 180GATTTAGTGC TTTACGGCAC CTCGACCCCA AAAAACTTGA TTAGGGTGAT GGTTCTCGTA 240GTGGGCCATC GCCCTGATAG ACGGTTTTTC GCCCTTTGAC GTTGGAGTCC ACGTTCTTTA 300ATAGTGGACT CTTGTTCCAA ACTGGAACAA CACTCAACCC TATCTCGGTC TATTCTTTTG 360ATTTATAAGG GATTTTGCCG ATTTCGGCCT ATTGGTTAAA AAATGAGCTG ATTTAACAAA 420AATTTAACGC GAATTTTAAC AAAATATTAA CGTTTACAAT TTCATGTACA 470 733 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 271AGATCTGACC AAAATCCCTT AACGTGAGTT TTCGTTCCAC TGAGCGTCAG ACCCCGTAGA 60AAAGATCAAA GGATCTTCTT GAGATCCTTT TTTTCTGCGC GTAATCTGCT GCTTGCAAAC 120AAAAAAACCA CCGCTACCAG CGGTGGTTTG TTTGCCGGAT CAAGAGCTAC CAACTCTTTT 180TCCGAAGGTA ACTGGCTACA GCAGAGCGCA GATACCAAAT ACTGTTCTTC TAGTGTAGCC 240GTAGTTAGGC CACCACTTCA AGAACTCTGT AGCACCGCCT ACATACCTCG CTCTGCTAAT 300CCTGTTACCA GTGGCTGCTG CCAGTGGCGA TAAGTCGTGT CTTACCGGGT TGGACTCAAG 360ACGATAGTTA CCGGATAAGG CGCAGCGGTC GGGCTGAACG GGGGGTTCGT GCACACAGCC 420CAGCTTGGAG CGAACGACCT ACACCGAACT GAGATACCTA CAGCGTGAGC TATGAGAAAG 480CGCCACGCTT CCCGAAGGGA GAAAGGCGGA CAGGTATCCG GTAAGCGGCA GGGTCGGAAC 540AGGAGAGCGC ACGAGGGAGC TTCCAGGGGG AAACGCCTGG TATCTTTATA GTCCTGTCGG 600GTTTCGCCAC CTCTGACTTG AGCGTCGATT TTTGTGATGC TCGTCAGGGG GGCGGAGCCT 660ATGGAAAAAC GCCAGCAACG CGGCCTTTTT ACGGTTCCTG GCCTTTTGCT GGCCTTTTGC 720TCACATGGCT AGC 733 813 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene cassette“ CDS 102..758 /product= ”cat resistance“ 272GGGACGTCGG GTGAGGTTCC AACTTTCACC ATAATGAAAT AAGATCACTA CCGGGCGTAT 60TTTTTGAGTT ATCGAGATTT TCAGGAGCTA AGGAAGCTAA A ATG GAG AAA AAA 113 Met Glu Lys LysATC ACT GGA TAT ACC ACC GTT GAT ATA TCC CAA TGG CAT CGT AAA GAA 161Ile Thr Gly Tyr Thr Thr Val Asp Ile Ser Gln Trp His Arg Lys Glu175 180 185 190CAT TTT GAG GCA TTT CAG TCA GTT GCT CAA TGT ACC TAT AAC CAG ACC 209His Phe Glu Ala Phe Gln Ser Val Ala Gln Cys Thr Tyr Asn Gln Thr 195 200 205GTT CAG CTG GAT ATT ACG GCC TTT TTA AAG ACC GTA AAG AAA AAT AAG 257Val Gln Leu Asp Ile Thr Ala Phe Leu Lys Thr Val Lys Lys Asn Lys 210 215 220CAC AAG TTT TAT CCG GCC TTT ATT CAC ATT CTT GCC CGC CTG ATG AAT 305His Lys Phe Tyr Pro Ala Phe Ile His Ile Leu Ala Arg Leu Met Asn 225 230 235GCT CAC CCG GAG TTC CGT ATG GCA ATG AAA GAC GGT GAG CTG GTG ATA 353Ala His Pro Glu Phe Arg Met Ala Met Lys Asp Gly Glu Leu Val Ile 240 245 250TGG GAT AGT GTT CAC CCT TGT TAC ACC GTT TTC CAT GAG CAA ACT GAA 401Trp Asp Ser Val His Pro Cys Tyr Thr Val Phe His Glu Gln Thr Glu255 260 265 270ACG TTT TCA TCG CTC TGG AGT GAA TAC CAC GAC GAT TTC CGG CAG TTT 449Thr Phe Ser Ser Leu Trp Ser Glu Tyr His Asp Asp Phe Arg Gln Phe 275 280 285CTA CAC ATA TAT TCG CAA GAT GTG GCG TGT TAC GGT GAA AAC CTG GCC 497Leu His Ile Tyr Ser Gln Asp Val Ala Cys Tyr Gly Glu Asn Leu Ala 290 295 300TAT TTC CCT AAA GGG TTT ATT GAG AAT ATG TTT TTC GTC TCA GCC AAT 545Tyr Phe Pro Lys Gly Phe Ile Glu Asn Met Phe Phe Val Ser Ala Asn 305 310 315CCC TGG GTG AGT TTC ACC AGT TTT GAT TTA AAC GTA GCC AAT ATG GAC 593Pro Trp Val Ser Phe Thr Ser Phe Asp Leu Asn Val Ala Asn Met Asp 320 325 330AAC TTC TTC GCC CCC GTT TTC ACT ATG GGC AAA TAT TAT ACG CAA GGC 641Asn Phe Phe Ala Pro Val Phe Thr Met Gly Lys Tyr Tyr Thr Gln Gly335 340 345 350GAC AAG GTG CTG ATG CCG CTG GCG ATT CAG GTT CAT CAT GCC GTT TGT 689Asp Lys Val Leu Met Pro Leu Ala Ile Gln Val His His Ala Val Cys 355 360 365GAT GGC TTC CAT GTC GGC AGA ATG CTT AAT GAA TTA CAA CAG TAC TGC 737Asp Gly Phe His Val Gly Arg Met Leu Asn Glu Leu Gln Gln Tyr Cys 370 375 380GAT GAG TGG CAG GGC GGG GCG TAATTTTTTT AAGGCAGTTA TTGGGTGCCC 788Asp Glu Trp Gln Gly Gly Ala 385TTAAACGCCT GGTGCTAGAT CTTCC 813 219 amino acids amino acid linear protein 273Met Glu Lys Lys Ile Thr Gly Tyr Thr Thr Val Asp Ile Ser Gln Trp 1 5 10 15His Arg Lys Glu His Phe Glu Ala Phe Gln Ser Val Ala Gln Cys Thr 20 25 30Tyr Asn Gln Thr Val Gln Leu Asp Ile Thr Ala Phe Leu Lys Thr Val 35 40 45Lys Lys Asn Lys His Lys Phe Tyr Pro Ala Phe Ile His Ile Leu Ala 50 55 60Arg Leu Met Asn Ala His Pro Glu Phe Arg Met Ala Met Lys Asp Gly 65 70 75 80Glu Leu Val Ile Trp Asp Ser Val His Pro Cys Tyr Thr Val Phe His 85 90 95Glu Gln Thr Glu Thr Phe Ser Ser Leu Trp Ser Glu Tyr His Asp Asp 100 105 110Phe Arg Gln Phe Leu His Ile Tyr Ser Gln Asp Val Ala Cys Tyr Gly 115 120 125Glu Asn Leu Ala Tyr Phe Pro Lys Gly Phe Ile Glu Asn Met Phe Phe 130 135 140Val Ser Ala Asn Pro Trp Val Ser Phe Thr Ser Phe Asp Leu Asn Val145 150 155 160Ala Asn Met Asp Asn Phe Phe Ala Pro Val Phe Thr Met Gly Lys Tyr 165 170 175Tyr Thr Gln Gly Asp Lys Val Leu Met Pro Leu Ala Ile Gln Val His 180 185 190His Ala Val Cys Asp Gly Phe His Val Gly Arg Met Leu Asn Glu Leu 195 200 205Gln Gln Tyr Cys Asp Glu Trp Gln Gly Gly Ala 210 215 2755 base pairs nucleic acid double circular other nucleic acid /desc = ”synthetic vector“ CDS 3..509 /product= ”gIIIp ss, myc tag, amber codon“ CDS complement (1853..2509) /product= ”cat resistance“ 274AA TTC GAG CAG AAG CTG ATC TCT GAG GAG GAT CTG TAG GGT GGT GGC 47 Phe Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu * Gly Gly Gly 220 225 230TCT GGT TCC GGT GAT TTT GAT TAT GAA AAG ATG GCA AAC GCT AAT AAG 95Ser Gly Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys235 240 245 250GGG GCT ATG ACC GAA AAT GCC GAT GAA AAC GCG CTA CAG TCT GAC GCT 143Gly Ala Met Thr Glu Asn Ala Asp Glu Asn Ala Leu Gln Ser Asp Ala 255 260 265AAA GGC AAA CTT GAT TCT GTC GCT ACT GAT TAC GGT GCT GCT ATC GAT 191Lys Gly Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly Ala Ala Ile Asp 270 275 280GGT TTC ATT GGT GAC GTT TCC GGC CTT GCT AAT GGT AAT GGT GCT ACT 239Gly Phe Ile Gly Asp Val Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr 285 290 295GGT GAT TTT GCT GGC TCT AAT TCC CAA ATG GCT CAA GTC GGT GAC GGT 287Gly Asp Phe Ala Gly Ser Asn Ser Gln Met Ala Gln Val Gly Asp Gly 300 305 310GAT AAT TCA CCT TTA ATG AAT AAT TTC CGT CAA TAT TTA CCT TCC CTC 335Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gln Tyr Leu Pro Ser Leu315 320 325 330CCT CAA TCG GTT GAA TGT CGC CCT TTT GTC TTT GGC GCT GGT AAA CCA 383Pro Gln Ser Val Glu Cys Arg Pro Phe Val Phe Gly Ala Gly Lys Pro 335 340 345TAT GAA TTT TCT ATT GAT TGT GAC AAA ATA AAC TTA TTC CGT GGT GTC 431Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn Leu Phe Arg Gly Val 350 355 360TTT GCG TTT CTT TTA TAT GTT GCC ACC TTT ATG TAT GTA TTT TCT ACG 479Phe Ala Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr Val Phe Ser Thr 365 370 375TTT GCT AAC ATA CTG CGT AAT AAG GAG TCT TGATAAGCTT GACCTGTGAA 529Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser 380 385GTGAAAAATG GCGCAGATTG TGCGACATTT TTTTTGTCTG CCGTTTAATT AAAGGGGGGG 589GGGGGCCGGC CTGGGGGGGG GTGTACATGA AATTGTAAAC GTTAATATTT TGTTAAAATT 649CGCGTTAAAT TTTTGTTAAA TCAGCTCATT TTTTAACCAA TAGGCCGAAA TCGGCAAAAT 709CCCTTATAAA TCAAAAGAAT AGACCGAGAT AGGGTTGAGT GTTGTTCCAG TTTGGAACAA 769GAGTCCACTA TTAAAGAACG TGGACTCCAA CGTCAAAGGG CGAAAAACCG TCTATCAGGG 829CGATGGCCCA CTACGAGAAC CATCACCCTA ATCAAGTTTT TTGGGGTCGA GGTGCCGTAA 889AGCACTAAAT CGGAACCCTA AAGGGAGCCC CCGATTTAGA GCTTGACGGG GAAAGCCGGC 949GAACGTGGCG AGAAAGGAAG GGAAGAAAGC GAAAGGAGCG GGCGCTAGGG CGCTGGCAAG 1009TGTAGCGGTC ACGCTGCGCG TAACCACCAC ACCCGCCGCG CTTAATGCGC CGCTACAGGG 1069CGCGTGCTAG CCATGTGAGC AAAAGGCCAG CAAAAGGCCA GGAACCGTAA AAAGGCCGCG 1129TTGCTGGCGT TTTTCCATAG GCTCCGCCCC CCTGACGAGC ATCACAAAAA TCGACGCTCA 1189AGTCAGAGGT GGCGAAACCC GACAGGACTA TAAAGATACC AGGCGTTTCC CCCTGGAAGC 1249TCCCTCGTGC GCTCTCCTGT TCCGACCCTG CCGCTTACCG GATACCTGTC CGCCTTTCTC 1309CCTTCGGGAA GCGTGGCGCT TTCTCATAGC TCACGCTGTA GGTATCTCAG TTCGGTGTAG 1369GTCGTTCGCT CCAAGCTGGG CTGTGTGCAC GAACCCCCCG TTCAGCCCGA CCGCTGCGCC 1429TTATCCGGTA ACTATCGTCT TGAGTCCAAC CCGGTAAGAC ACGACTTATC GCCACTGGCA 1489GCAGCCACTG GTAACAGGAT TAGCAGAGCG AGGTATGTAG GCGGTGCTAC AGAGTTCTTG 1549AAGTGGTGGC CTAACTACGG CTACACTAGA AGAACAGTAT TTGGTATCTG CGCTCTGCTG 1609TAGCCAGTTA CCTTCGGAAA AAGAGTTGGT AGCTCTTGAT CCGGCAAACA AACCACCGCT 1669GGTAGCGGTG GTTTTTTTGT TTGCAAGCAG CAGATTACGC GCAGAAAAAA AGGATCTCAA 1729GAAGATCCTT TGATCTTTTC TACGGGGTCT GACGCTCAGT GGAACGAAAA CTCACGTTAA 1789GGGATTTTGG TCAGATCTAG CACCAGGCGT TTAAGGGCAC CAATAACTGC CTTAAAAAAA 1849TTACGCCCCG CCCTGCCACT CATCGCAGTA CTGTTGTAAT TCATTAAGCA TTCTGCCGAC 1909ATGGAAGCCA TCACAAACGG CATGATGAAC CTGAATCGCC AGCGGCATCA GCACCTTGTC 1969GCCTTGCGTA TAATATTTGC CCATAGTGAA AACGGGGGCG AAGAAGTTGT CCATATTGGC 2029TACGTTTAAA TCAAAACTGG TGAAACTCAC CCAGGGATTG GCTGAGACGA AAAACATATT 2089CTCAATAAAC CCTTTAGGGA AATAGGCCAG GTTTTCACCG TAACACGCCA CATCTTGCGA 2149ATATATGTGT AGAAACTGCC GGAAATCGTC GTGGTATTCA CTCCAGAGCG ATGAAAACGT 2209TTCAGTTTGC TCATGGAAAA CGGTGTAACA AGGGTGAACA CTATCCCATA TCACCAGCTC 2269ACCGTCTTTC ATTGCCATAC GGAACTCCGG GTGAGCATTC ATCAGGCGGG CAAGAATGTG 2329AATAAAGGCC GGATAAAACT TGTGCTTATT TTTCTTTACG GTCTTTAAAA AGGCCGTAAT 2389ATCCAGCTGA ACGGTCTGGT TATAGGTACA TTGAGCAACT GACTGAAATG CCTCAAAATG 2449TTCTTTACGA TGCCATTGGG ATATATCAAC GGTGGTATAT CCAGTGATTT TTTTCTCCAT 2509TTTAGCTTCC TTAGCTCCTG AAAATCTCGA TAACTCAAAA AATACGCCCG GTAGTGATCT 2569TATTTCATTA TGGTGAAAGT TGGAACCTCA CCCGACGTCT AATGTGAGTT AGCTCACTCA 2629TTAGGCACCC CAGGCTTTAC ACTTTATGCT TCCGGCTCGT ATGTTGTGTG GAATTGTGAG 2689CGGATAACAA TTTCACACAG GAAACAGCTA TGACCATGAT TACGAATTTC TAGAGCATGC 2749GGGGGG 2755 11 amino acids amino acid linear protein 275Phe Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 1 5 10 219 amino acids amino acid linear protein 276Met Glu Lys Lys Ile Thr Gly Tyr Thr Thr Val Asp Ile Ser Gln Trp 1 5 10 15His Arg Lys Glu His Phe Glu Ala Phe Gln Ser Val Ala Gln Cys Thr 20 25 30Tyr Asn Gln Thr Val Gln Leu Asp Ile Thr Ala Phe Leu Lys Thr Val 35 40 45Lys Lys Asn Lys His Lys Phe Tyr Pro Ala Phe Ile His Ile Leu Ala 50 55 60Arg Leu Met Asn Ala His Pro Glu Phe Arg Met Ala Met Lys Asp Gly 65 70 75 80Glu Leu Val Ile Trp Asp Ser Val His Pro Cys Tyr Thr Val Phe His 85 90 95Glu Gln Thr Glu Thr Phe Ser Ser Leu Trp Ser Glu Tyr His Asp Asp 100 105 110Phe Arg Gln Phe Leu His Ile Tyr Ser Gln Asp Val Ala Cys Tyr Gly 115 120 125Glu Asn Leu Ala Tyr Phe Pro Lys Gly Phe Ile Glu Asn Met Phe Phe 130 135 140Val Ser Ala Asn Pro Trp Val Ser Phe Thr Ser Phe Asp Leu Asn Val145 150 155 160Ala Asn Met Asp Asn Phe Phe Ala Pro Val Phe Thr Met Gly Lys Tyr 165 170 175Tyr Thr Gln Gly Asp Lys Val Leu Met Pro Leu Ala Ile Gln Val His 180 185 190His Ala Val Cys Asp Gly Phe His Val Gly Arg Met Leu Asn Glu Leu 195 200 205Gln Gln Tyr Cys Asp Glu Trp Gln Gly Gly Ala 210 215 173 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 277GACGTCTTAA TGTGAGTTAG CTCACTCATT AGGCACCCCA GGCTTTACAC TTTATGCTTC 60CGGCTCGTAT GTTGTGTGGA ATTGTGAGCG GATAACAATT TCACACAGGA AACAGCTATG 120ACCATGTCTA GAATAACTTC GTATAATGTA CGCTATACGA AGTTATCGCA TGC 173 47 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 278AGATCTCATA ACTTCGTATA ATGTATGCTA TACGAAGTTA TGACGTC 47 1255 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene cassette“ CDS 1..1245 /product= ”gIIIp, GGGGS linker“ 279GAA TTC GGT GGT GGT GGA TCT GCG TGC GCT GAA ACG GTT GAA AGT TGT 48Glu Phe Gly Gly Gly Gly Ser Ala Cys Ala Glu Thr Val Glu Ser Cys220 225 230 235TTA GCA AAA TCC CAT ACA GAA AAT TCA TTT ACT AAC GTC TGG AAA GAC 96Leu Ala Lys Ser His Thr Glu Asn Ser Phe Thr Asn Val Trp Lys Asp 240 245 250GAC AAA ACT TTA GAT CGT TAC GCT AAC TAT GAG GGC TGT CTG TGG AAT 144Asp Lys Thr Leu Asp Arg Tyr Ala Asn Tyr Glu Gly Cys Leu Trp Asn 255 260 265GCT ACA GGC GTT GTA GTT TGT ACT GGT GAC GAA ACT CAG TGT TAC GGT 192Ala Thr Gly Val Val Val Cys Thr Gly Asp Glu Thr Gln Cys Tyr Gly 270 275 280ACA TGG GTT CCT ATT GGG CTT GCT ATC CCT GAA AAT GAG GGT GGT GGC 240Thr Trp Val Pro Ile Gly Leu Ala Ile Pro Glu Asn Glu Gly Gly Gly 285 290 295TCT GAG GGT GGC GGT TCT GAG GGT GGC GGT TCT GAG GGT GGC GGT ACT 288Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Thr300 305 310 315AAA CCT CCT GAG TAC GGT GAT ACA CCT ATT CCG GGC TAT ACT TAT ATC 336Lys Pro Pro Glu Tyr Gly Asp Thr Pro Ile Pro Gly Tyr Thr Tyr Ile 320 325 330AAC CCT CTC GAC GGC ACT TAT CCG CCT GGT ACT GAG CAA AAC CCC GCT 384Asn Pro Leu Asp Gly Thr Tyr Pro Pro Gly Thr Glu Gln Asn Pro Ala 335 340 345AAT CCT AAT CCT TCT CTT GAG GAG TCT CAG CCT CTT AAT ACT TTC ATG 432Asn Pro Asn Pro Ser Leu Glu Glu Ser Gln Pro Leu Asn Thr Phe Met 350 355 360TTT CAG AAT AAT AGG TTC CGA AAT AGG CAG GGG GCA TTA ACT GTT TAT 480Phe Gln Asn Asn Arg Phe Arg Asn Arg Gln Gly Ala Leu Thr Val Tyr 365 370 375ACG GGC ACT GTT ACT CAA GGC ACT GAC CCC GTT AAA ACT TAT TAC CAG 528Thr Gly Thr Val Thr Gln Gly Thr Asp Pro Val Lys Thr Tyr Tyr Gln380 385 390 395TAC ACT CCT GTA TCA TCA AAA GCC ATG TAT GAC GCT TAC TGG AAC GGT 576Tyr Thr Pro Val Ser Ser Lys Ala Met Tyr Asp Ala Tyr Trp Asn Gly 400 405 410AAA TTC AGA GAC TGC GCT TTC CAT TCT GGC TTT AAT GAG GAT TTA TTT 624Lys Phe Arg Asp Cys Ala Phe His Ser Gly Phe Asn Glu Asp Leu Phe 415 420 425GTT TGT GAA TAT CAA GGC CAA TCG TCT GAC CTG CCT CAA CCT CCT GTC 672Val Cys Glu Tyr Gln Gly Gln Ser Ser Asp Leu Pro Gln Pro Pro Val 430 435 440AAT GCT GGC GGC GGC TCT GGT GGT GGT TCT GGT GGC GGC TCT GAG GGT 720Asn Ala Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Glu Gly 445 450 455GGT GGC TCT GAG GGT GGC GGT TCT GAG GGT GGC GGC TCT GAG GGA GGC 768Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly460 465 470 475GGT TCC GGT GGT GGC TCT GGT TCC GGT GAT TTT GAT TAT GAA AAG ATG 816Gly Ser Gly Gly Gly Ser Gly Ser Gly Asp Phe Asp Tyr Glu Lys Met 480 485 490GCA AAC GCT AAT AAG GGG GCT ATG ACC GAA AAT GCC GAT GAA AAC GCG 864Ala Asn Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp Glu Asn Ala 495 500 505CTA CAG TCT GAC GCT AAA GGC AAA CTT GAT TCT GTC GCT ACT GAT TAC 912Leu Gln Ser Asp Ala Lys Gly Lys Leu Asp Ser Val Ala Thr Asp Tyr 510 515 520GGT GCT GCT ATC GAT GGT TTC ATT GGT GAC GTT TCC GGC CTT GCT AAT 960Gly Ala Ala Ile Asp Gly Phe Ile Gly Asp Val Ser Gly Leu Ala Asn 525 530 535GGT AAT GGT GCT ACT GGT GAT TTT GCT GGC TCT AAT TCC CAA ATG GCT 1008Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn Ser Gln Met Ala540 545 550 555CAA GTC GGT GAA GGT GAT AAT TCA CCT TTA ATG AAT AAT TTC CGT CAA 1056Gln Val Gly Glu Gly Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gln 560 565 570TAT TTA CCT TCC ATC CCT CAA TCG GTT GAA TGT CGC CCT TTT GTC TTT 1104Tyr Leu Pro Ser Ile Pro Gln Ser Val Glu Cys Arg Pro Phe Val Phe 575 580 585GGC GCT GGT AAA CCC TAT GAA TTT TCT ATT GAT TGT GAC AAA ATA AAC 1152Gly Ala Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn 590 595 600TTA TTC CGT GGT GTC TTT GCG TTT CTT TTA TAT GTT GCC ACC TTT ATG 1200Leu Phe Arg Gly Val Phe Ala Phe Leu Leu Tyr Val Ala Thr Phe Met 605 610 615TAT GTA TTT TCT ACG TTT GCT AAC ATA CTG CGT AAT AAG GAG TCT 1245Tyr Val Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser620 625 630TGATAAGCTT 1255 415 amino acids amino acid linear protein 280Glu Phe Gly Gly Gly Gly Ser Ala Cys Ala Glu Thr Val Glu Ser Cys 1 5 10 15Leu Ala Lys Ser His Thr Glu Asn Ser Phe Thr Asn Val Trp Lys Asp 20 25 30Asp Lys Thr Leu Asp Arg Tyr Ala Asn Tyr Glu Gly Cys Leu Trp Asn 35 40 45Ala Thr Gly Val Val Val Cys Thr Gly Asp Glu Thr Gln Cys Tyr Gly 50 55 60Thr Trp Val Pro Ile Gly Leu Ala Ile Pro Glu Asn Glu Gly Gly Gly 65 70 75 80Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Thr 85 90 95Lys Pro Pro Glu Tyr Gly Asp Thr Pro Ile Pro Gly Tyr Thr Tyr Ile 100 105 110Asn Pro Leu Asp Gly Thr Tyr Pro Pro Gly Thr Glu Gln Asn Pro Ala 115 120 125Asn Pro Asn Pro Ser Leu Glu Glu Ser Gln Pro Leu Asn Thr Phe Met 130 135 140Phe Gln Asn Asn Arg Phe Arg Asn Arg Gln Gly Ala Leu Thr Val Tyr145 150 155 160Thr Gly Thr Val Thr Gln Gly Thr Asp Pro Val Lys Thr Tyr Tyr Gln 165 170 175Tyr Thr Pro Val Ser Ser Lys Ala Met Tyr Asp Ala Tyr Trp Asn Gly 180 185 190Lys Phe Arg Asp Cys Ala Phe His Ser Gly Phe Asn Glu Asp Leu Phe 195 200 205Val Cys Glu Tyr Gln Gly Gln Ser Ser Asp Leu Pro Gln Pro Pro Val 210 215 220Asn Ala Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Glu Gly225 230 235 240Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly Gly 245 250 255Gly Ser Gly Gly Gly Ser Gly Ser Gly Asp Phe Asp Tyr Glu Lys Met 260 265 270Ala Asn Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp Glu Asn Ala 275 280 285Leu Gln Ser Asp Ala Lys Gly Lys Leu Asp Ser Val Ala Thr Asp Tyr 290 295 300Gly Ala Ala Ile Asp Gly Phe Ile Gly Asp Val Ser Gly Leu Ala Asn305 310 315 320Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn Ser Gln Met Ala 325 330 335Gln Val Gly Glu Gly Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gln 340 345 350Tyr Leu Pro Ser Ile Pro Gln Ser Val Glu Cys Arg Pro Phe Val Phe 355 360 365Gly Ala Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn 370 375 380Leu Phe Arg Gly Val Phe Ala Phe Leu Leu Tyr Val Ala Thr Phe Met385 390 395 400Tyr Val Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser 405 410 415 502 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene cassette“ CDS 4..492 /product= ”gIIIp ss“ 281CGG GAA TTC GGA GGC GGT TCC GGT GGT GGC TCT GGT TCC GGT GAT TTT 48 Glu Phe Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Asp Phe 420 425 430GAT TAT GAA AAG ATG GCA AAC GCT AAT AAG GGG GCT ATG ACC GAA AAT 96Asp Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala Met Thr Glu Asn 435 440 445GCC GAT GAA AAC GCG CTA CAG TCT GAC GCT AAA GGC AAA CTT GAT TCT 144Ala Asp Glu Asn Ala Leu Gln Ser Asp Ala Lys Gly Lys Leu Asp Ser 450 455 460GTC GCT ACT GAT TAC GGT GCT GCT ATC GAT GGT TTC ATT GGT GAC GTT 192Val Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly Asp Val 465 470 475TCC GGC CTT GCT AAT GGT AAT GGT GCT ACT GGT GAT TTT GCT GGC TCT 240Ser Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser 480 485 490AAT TCC CAA ATG GCT CAA GTC GGT GAC GGT GAT AAT TCA CCT TTA ATG 288Asn Ser Gln Met Ala Gln Val Gly Asp Gly Asp Asn Ser Pro Leu Met495 500 505 510AAT AAT TTC CGT CAA TAT TTA CCT TCC CTC CCT CAA TCG GTT GAA TGT 336Asn Asn Phe Arg Gln Tyr Leu Pro Ser Leu Pro Gln Ser Val Glu Cys 515 520 525CGC CCT TTT GTC TTT GGC GCT GGT AAA CCA TAT GAA TTT TCT ATT GAT 384Arg Pro Phe Val Phe Gly Ala Gly Lys Pro Tyr Glu Phe Ser Ile Asp 530 535 540TGT GAC AAA ATA AAC TTA TTC CGT GGT GTC TTT GCG TTT CTT TTA TAT 432Cys Asp Lys Ile Asn Leu Phe Arg Gly Val Phe Ala Phe Leu Leu Tyr 545 550 555GTT GCC ACC TTT ATG TAT GTA TTT TCT ACG TTT GCT AAC ATA CTG CGT 480Val Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala Asn Ile Leu Arg 560 565 570AAT AAG GAG TCT TGATAAGCTT 502Asn Lys Glu Ser575 163 amino acids amino acid linear protein 282Glu Phe Gly Gly Gly Ser Gly Gly Gly Ser Gly Ser Gly Asp Phe Asp 1 5 10 15Tyr Glu Lys Met Ala Asn Ala Asn Lys Gly Ala Met Thr Glu Asn Ala 20 25 30Asp Glu Asn Ala Leu Gln Ser Asp Ala Lys Gly Lys Leu Asp Ser Val 35 40 45Ala Thr Asp Tyr Gly Ala Ala Ile Asp Gly Phe Ile Gly Asp Val Ser 50 55 60Gly Leu Ala Asn Gly Asn Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn 65 70 75 80Ser Gln Met Ala Gln Val Gly Asp Gly Asp Asn Ser Pro Leu Met Asn 85 90 95Asn Phe Arg Gln Tyr Leu Pro Ser Leu Pro Gln Ser Val Glu Cys Arg 100 105 110Pro Phe Val Phe Gly Ala Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys 115 120 125Asp Lys Ile Asn Leu Phe Arg Gly Val Phe Ala Phe Leu Leu Tyr Val 130 135 140Ala Thr Phe Met Tyr Val Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn145 150 155 160Lys Glu Ser 47 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 283GCATGCCATA ACTTCGTATA ATGTACGCTA TACGAAGTTA TAAGCTT 47 1163 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene cassette“ CDS 82..978 /product= ”bla resistance“ 284GGGGGTGTAC ATTCAAATAT GTATCCGCTC ATGAGACAAT AACCCTGATA AATGCTTCAA 60TAATATTGAA AAAGGAAGAG T ATG AGT ATT CAA CAT TTC CGT GTC GCC CTT 111 Met Ser Ile Gln His Phe Arg Val Ala Leu 165 170ATT CCC TTT TTT GCG GCA TTT TGC CTT CCT GTT TTT GCT CAC CCA GAA 159Ile Pro Phe Phe Ala Ala Phe Cys Leu Pro Val Phe Ala His Pro Glu 175 180 185ACG CTG GTG AAA GTA AAA GAT GCT GAG GAT CAG TTG GGT GCG CGA GTG 207Thr Leu Val Lys Val Lys Asp Ala Glu Asp Gln Leu Gly Ala Arg Val190 195 200 205GGT TAC ATC GAA CTG GAT CTC AAC AGC GGT AAG ATC CTT GAG AGT TTT 255Gly Tyr Ile Glu Leu Asp Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe 210 215 220CGC CCC GAA GAA CGT TTT CCA ATG ATG AGC ACT TTT AAA GTT CTG CTA 303Arg Pro Glu Glu Arg Phe Pro Met Met Ser Thr Phe Lys Val Leu Leu 225 230 235TGT GGC GCG GTA TTA TCC CGT ATT GAC GCC GGG CAA GAG CAA CTC GGT 351Cys Gly Ala Val Leu Ser Arg Ile Asp Ala Gly Gln Glu Gln Leu Gly 240 245 250CGC CGC ATA CAC TAT TCT CAG AAT GAC TTG GTT GAG TAC TCA CCA GTC 399Arg Arg Ile His Tyr Ser Gln Asn Asp Leu Val Glu Tyr Ser Pro Val 255 260 265ACA GAA AAG CAT CTT ACG GAT GGC ATG ACA GTA AGA GAA TTA TGC AGT 447Thr Glu Lys His Leu Thr Asp Gly Met Thr Val Arg Glu Leu Cys Ser270 275 280 285GCT GCC ATA ACC ATG AGT GAT AAC ACT GCG GCC AAC TTA CTT CTG ACA 495Ala Ala Ile Thr Met Ser Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr 290 295 300ACG ATC GGA GGA CCG AAG GAG CTA ACC GCT TTT TTG CAC AAC ATG GGG 543Thr Ile Gly Gly Pro Lys Glu Leu Thr Ala Phe Leu His Asn Met Gly 305 310 315GAT CAT GTA ACT CGC CTT GAT CGT TGG GAA CCG GAG CTG AAT GAA GCC 591Asp His Val Thr Arg Leu Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala 320 325 330ATA CCA AAC GAC GAG CGT GAC ACC ACG ATG CCT GTA GCA ATG GCA ACA 639Ile Pro Asn Asp Glu Arg Asp Thr Thr Met Pro Val Ala Met Ala Thr 335 340 345ACG TTG CGC AAA CTA TTA ACT GGC GAA CTA CTT ACT CTA GCT TCC CGG 687Thr Leu Arg Lys Leu Leu Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg350 355 360 365CAA CAG TTA ATA GAC TGG ATG GAG GCG GAT AAA GTT GCA GGA CCA CTT 735Gln Gln Leu Ile Asp Trp Met Glu Ala Asp Lys Val Ala Gly Pro Leu 370 375 380CTG CGC TCG GCC CTT CCG GCT GGC TGG TTT ATT GCT GAT AAA TCT GGA 783Leu Arg Ser Ala Leu Pro Ala Gly Trp Phe Ile Ala Asp Lys Ser Gly 385 390 395GCC GGT GAG CGT GGG TCT CGC GGT ATC ATT GCA GCA CTG GGG CCA GAT 831Ala Gly Glu Arg Gly Ser Arg Gly Ile Ile Ala Ala Leu Gly Pro Asp 400 405 410GGT AAG CCC TCC CGT ATC GTA GTT ATC TAC ACG ACG GGG AGT CAG GCA 879Gly Lys Pro Ser Arg Ile Val Val Ile Tyr Thr Thr Gly Ser Gln Ala 415 420 425ACT ATG GAT GAA CGA AAT AGA CAG ATC GCT GAG ATA GGT GCC TCA CTG 927Thr Met Asp Glu Arg Asn Arg Gln Ile Ala Glu Ile Gly Ala Ser Leu430 435 440 445ATT AAG CAT TGG GTA ACT GTC AGA CCA AGT TTA CTC ATA TAT ACT TTA 975Ile Lys His Trp Val Thr Val Arg Pro Ser Leu Leu Ile Tyr Thr Leu 450 455 460GAT TGATTTAAAA CTTCATTTTT AATTTAAAAG GATCTAGGTG AAGATCCTTT 1028AspTTGATAATCT CATGACCAAA ATCCCTTAAC GTGAGTTTTC GTTCCACTGA GCGTCAGACC 1088CCGTAGAAAA GATCAAAGGA TCTTCTTGAG ATCCTTTTTG ATAATGGCCG GCCCCCCCCC 1148TTAATTAAGG GGGGG 1163 299 amino acids amino acid linear protein 285Met Ser Ile Gln His Phe Arg Val Ala Leu Ile Pro Phe Phe Ala Ala 1 5 10 15Phe Cys Leu Pro Val Phe Ala His Pro Glu Thr Leu Val Lys Val Lys 20 25 30Asp Ala Glu Asp Gln Leu Gly Ala Arg Val Gly Tyr Ile Glu Leu Asp 35 40 45Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe Arg Pro Glu Glu Arg Phe 50 55 60Pro Met Met Ser Thr Phe Lys Val Leu Leu Cys Gly Ala Val Leu Ser 65 70 75 80Arg Ile Asp Ala Gly Gln Glu Gln Leu Gly Arg Arg Ile His Tyr Ser 85 90 95Gln Asn Asp Leu Val Glu Tyr Ser Pro Val Thr Glu Lys His Leu Thr 100 105 110Asp Gly Met Thr Val Arg Glu Leu Cys Ser Ala Ala Ile Thr Met Ser 115 120 125Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr Ile Gly Gly Pro Lys 130 135 140Glu Leu Thr Ala Phe Leu His Asn Met Gly Asp His Val Thr Arg Leu145 150 155 160Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala Ile Pro Asn Asp Glu Arg 165 170 175Asp Thr Thr Met Pro Val Ala Met Ala Thr Thr Leu Arg Lys Leu Leu 180 185 190Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg Gln Gln Leu Ile Asp Trp 195 200 205Met Glu Ala Asp Lys Val Ala Gly Pro Leu Leu Arg Ser Ala Leu Pro 210 215 220Ala Gly Trp Phe Ile Ala Asp Lys Ser Gly Ala Gly Glu Arg Gly Ser225 230 235 240Arg Gly Ile Ile Ala Ala Leu Gly Pro Asp Gly Lys Pro Ser Arg Ile 245 250 255Val Val Ile Tyr Thr Thr Gly Ser Gln Ala Thr Met Asp Glu Arg Asn 260 265 270Arg Gln Ile Ala Glu Ile Gly Ala Ser Leu Ile Lys His Trp Val Thr 275 280 285Val Arg Pro Ser Leu Leu Ile Tyr Thr Leu Asp 290 295 470 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 286GCTAGCACGC GCCCTGTAGC GGCGCATTAA GCGCGGCGGG TGTGGTGGTT ACGCGCAGCG 60TGACCGCTAC ACTTGCCAGC GCCCTAGCGC CCGCTCCTTT CGCTTTCTTC CCTTCCTTTC 120TCGCCACGTT CGCCGGCTTT CCCCGTCAAG CTCTAAATCG GGGGCTCCCT TTAGGGTTCC 180GATTTAGTGC TTTACGGCAC CTCGACCCCA AAAAACTTGA TTAGGGTGAT GGTTCTCGTA 240GTGGGCCATC GCCCTGATAG ACGGTTTTTC GCCCTTTGAC GTTGGAGTCC ACGTTCTTTA 300ATAGTGGACT CTTGTTCCAA ACTGGAACAA CACTCAACCC TATCTCGGTC TATTCTTTTG 360ATTTATAAGG GATTTTGCCG ATTTCGGCCT ATTGGTTAAA AAATGAGCTG ATTTAACAAA 420AATTTAACGC GAATTTTAAC AAAATATTAA CGTTTACAAT TTCATGTACA 470 832 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 287AGATCTAATA AGATGATCTT CTTGAGATCG TTTTGGTCTG CGCGTAATCT CTTGCTCTGA 60AAACGAAAAA ACCGCCTTGC AGGGCGGTTT TTCGTAGGTT CTCTGAGCTA CCAACTCTTT 120GAACCGAGGT AACTGGCTTG GAGGAGCGCA GTCACTAAAA CTTGTCCTTT CAGTTTAGCC 180TTAACCGGCG CATGACTTCA AGACTAACTC CTCTAAATCA ATTACCAGTG GCTGCTGCCA 240GTGGTGCTTT TGCATGTCTT TCCGGGTTGG ACTCAAGACG ATAGTTACCG GATAAGGCGC 300AGCGGTCGGA CTGAACGGGG GGTTCGTGCA TACAGTCCAG CTTGGAGCGA ACTGCCTACC 360CGGAACTGAG TGTCAGGCGT GGAATGAGAC AAACGCGGCC ATAACAGCGG AATGACACCG 420GTAAACCGAA AGGCAGGAAC AGGAGAGCGC AGGAGGGAGC CGCCAGGGGG AAACGCCTGG 480TATCTTTATA GTCCTGTCGG GTTTCGCCAC CACTGATTTG AGCGTCAGAT TTCGTGATGC 540TTGTCAGGGG GGCGGAGCCT ATGGAAAAAC GGCTTTGCCG CGGCCCTCTC ACTTCCCTGT 600TAAGTATCTT CCTGGCATCT TCCAGGAAAT CTCCGCCCCG TTCGTAAGCC ATTTCCGCTC 660GCCGCAGTCG AACGACCGAG CGTAGCGAGT CAGTGAGCGA GGAAGCGGAA TATATCCTGT 720ATCACATATT CTGCTGACGC ACCGGTGCAG CCTTTTTTCT CCTGCCACAT GAAGCACTTC 780ACTGACACCC TCATCAGTGC CAACATAGTA AGCCAGTATA CACTCCGCTA GC 832 49 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 288AGATCTCATA ACTTCGTATA ATGTATGCTA TACGAAGTTA TTCAGATCT 49 96 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 289TCTAGAGCAT GCGTAGGAGA AAATAAAATG AAACAAAGCA CTATTGCACT GGCACTCTTA 60CCGTTGCTCT TCACCCCTGT TACCAAAGCC GAATTC 96 120 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 290TCTAGAGCAT GCGTAGGAGA AAATAAAATG AAACAAAGCA CTATTGCACT GGCACTCTTA 60CCGTTGCTCT TCACCCCTGT TACCAAAGCC GACTACAAAG ATGAAGTGCA ATTGGAATTC 120 96 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic DNA cassette“ 291TCTAGAGGTT GAGGTGATTT TATGAAAAAG AATATCGCAT TTCTTCTTGC ATCTATGTTC 60GTTTTTTCTA TTGCTACAAA TGCATACGCT GAATTC 96 1221 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene cassette“ CDS 79..1158 /product= ”lacI“ 292GCTAGCATCG AATGGCGCAA AACCTTTCGC GGTATGGCAT GATAGCGCCC GGAAGAGAGT 60CAATTCAGGG TGGTGAAT GTG AAA CCA GTA ACG TTA TAC GAT GTC GCA GAG 111 Val Lys Pro Val Thr Leu Tyr Asp Val Ala Glu 300 305 310TAT GCC GGT GTC TCT TAT CAG ACC GTT TCC CGC GTG GTG AAC CAG GCC 159Tyr Ala Gly Val Ser Tyr Gln Thr Val Ser Arg Val Val Asn Gln Ala 315 320 325AGC CAC GTT TCT GCG AAA ACG CGG GAA AAA GTG GAA GCG GCG ATG GCG 207Ser His Val Ser Ala Lys Thr Arg Glu Lys Val Glu Ala Ala Met Ala 330 335 340GAG CTG AAT TAC ATT CCT AAC CGC GTG GCA CAA CAA CTG GCG GGC AAA 255Glu Leu Asn Tyr Ile Pro Asn Arg Val Ala Gln Gln Leu Ala Gly Lys 345 350 355CAG TCG TTG CTG ATT GGC GTT GCC ACC TCC AGT CTG GCC CTG CAC GCG 303Gln Ser Leu Leu Ile Gly Val Ala Thr Ser Ser Leu Ala Leu His Ala 360 365 370CCG TCG CAA ATT GTC GCG GCG ATT AAA TCT CGC GCC GAT CAA CTG GGT 351Pro Ser Gln Ile Val Ala Ala Ile Lys Ser Arg Ala Asp Gln Leu Gly375 380 385 390GCC AGC GTG GTC GTG TCG ATG GTA GAA CGA AGC GGC GTC GAA GCC TGT 399Ala Ser Val Val Val Ser Met Val Glu Arg Ser Gly Val Glu Ala Cys 395 400 405AAA GCG GCG GTG CAC AAT CTT CTC GCG CAA CGT GTC AGT GGG CTG ATT 447Lys Ala Ala Val His Asn Leu Leu Ala Gln Arg Val Ser Gly Leu Ile 410 415 420ATT AAC TAT CCG CTG GAT GAC CAG GAT GCT ATT GCT GTG GAA GCT GCC 495Ile Asn Tyr Pro Leu Asp Asp Gln Asp Ala Ile Ala Val Glu Ala Ala 425 430 435TGC ACT AAT GTT CCG GCG TTA TTT CTT GAT GTC TCT GAC CAG ACA CCC 543Cys Thr Asn Val Pro Ala Leu Phe Leu Asp Val Ser Asp Gln Thr Pro 440 445 450ATC AAC AGT ATT ATT TTC TCC CAT GAG GAC GGT ACG CGA CTG GGC GTG 591Ile Asn Ser Ile Ile Phe Ser His Glu Asp Gly Thr Arg Leu Gly Val455 460 465 470GAG CAT CTG GTC GCA TTG GGC CAC CAG CAA ATC GCG CTG TTA GCT GGC 639Glu His Leu Val Ala Leu Gly His Gln Gln Ile Ala Leu Leu Ala Gly 475 480 485CCA TTA AGT TCT GTC TCG GCG CGT CTG CGT CTG GCT GGC TGG CAT AAA 687Pro Leu Ser Ser Val Ser Ala Arg Leu Arg Leu Ala Gly Trp His Lys 490 495 500TAT CTC ACT CGC AAT CAA ATT CAG CCG ATA GCG GAA CGG GAA GGC GAC 735Tyr Leu Thr Arg Asn Gln Ile Gln Pro Ile Ala Glu Arg Glu Gly Asp 505 510 515TGG AGT GCC ATG TCC GGT TTT CAA CAA ACC ATG CAA ATG CTG AAT GAG 783Trp Ser Ala Met Ser Gly Phe Gln Gln Thr Met Gln Met Leu Asn Glu 520 525 530GGC ATC GTT CCC ACT GCG ATG CTG GTT GCC AAC GAT CAG ATG GCG CTG 831Gly Ile Val Pro Thr Ala Met Leu Val Ala Asn Asp Gln Met Ala Leu535 540 545 550GGC GCA ATG CGT GCC ATT ACC GAG TCC GGG CTG CGC GTT GGT GCG GAC 879Gly Ala Met Arg Ala Ile Thr Glu Ser Gly Leu Arg Val Gly Ala Asp 555 560 565ATC TCG GTA GTG GGA TAC GAC GAT ACC GAG GAC AGC TCA TGT TAT ATC 927Ile Ser Val Val Gly Tyr Asp Asp Thr Glu Asp Ser Ser Cys Tyr Ile 570 575 580CCG CCG CTG ACC ACC ATC AAA CAG GAT TTT CGC CTG CTG GGG CAA ACC 975Pro Pro Leu Thr Thr Ile Lys Gln Asp Phe Arg Leu Leu Gly Gln Thr 585 590 595AGC GTG GAC CGC TTG CTG CAA CTC TCT CAG GGC CAG GCG GTG AAG GGC 1023Ser Val Asp Arg Leu Leu Gln Leu Ser Gln Gly Gln Ala Val Lys Gly 600 605 610AAT CAG CTG TTG CCC GTC TCA CTG GTG AAA AGA AAA ACC ACC CTG GCT 1071Asn Gln Leu Leu Pro Val Ser Leu Val Lys Arg Lys Thr Thr Leu Ala615 620 625 630CCC AAT ACG CAA ACC GCC TCT CCC CGC GCG TTG GCC GAT TCA CTG ATG 1119Pro Asn Thr Gln Thr Ala Ser Pro Arg Ala Leu Ala Asp Ser Leu Met 635 640 645CAG CTG GCA CGA CAG GTT TCC CGA CTG GAA AGC GGG CAG TGAGGCTACC 1168Gln Leu Ala Arg Gln Val Ser Arg Leu Glu Ser Gly Gln 650 655CGATAAAAGC GGCTTCCTGA CAGGAGGCCG TTTTGTTTTG CAGCCCACTT AAG 1221 360 amino acids amino acid linear protein 293Val Lys Pro Val Thr Leu Tyr Asp Val Ala Glu Tyr Ala Gly Val Ser 1 5 10 15Tyr Gln Thr Val Ser Arg Val Val Asn Gln Ala Ser His Val Ser Ala 20 25 30Lys Thr Arg Glu Lys Val Glu Ala Ala Met Ala Glu Leu Asn Tyr Ile 35 40 45Pro Asn Arg Val Ala Gln Gln Leu Ala Gly Lys Gln Ser Leu Leu Ile 50 55 60Gly Val Ala Thr Ser Ser Leu Ala Leu His Ala Pro Ser Gln Ile Val 65 70 75 80Ala Ala Ile Lys Ser Arg Ala Asp Gln Leu Gly Ala Ser Val Val Val 85 90 95Ser Met Val Glu Arg Ser Gly Val Glu Ala Cys Lys Ala Ala Val His 100 105 110Asn Leu Leu Ala Gln Arg Val Ser Gly Leu Ile Ile Asn Tyr Pro Leu 115 120 125Asp Asp Gln Asp Ala Ile Ala Val Glu Ala Ala Cys Thr Asn Val Pro 130 135 140Ala Leu Phe Leu Asp Val Ser Asp Gln Thr Pro Ile Asn Ser Ile Ile145 150 155 160Phe Ser His Glu Asp Gly Thr Arg Leu Gly Val Glu His Leu Val Ala 165 170 175Leu Gly His Gln Gln Ile Ala Leu Leu Ala Gly Pro Leu Ser Ser Val 180 185 190Ser Ala Arg Leu Arg Leu Ala Gly Trp His Lys Tyr Leu Thr Arg Asn 195 200 205Gln Ile Gln Pro Ile Ala Glu Arg Glu Gly Asp Trp Ser Ala Met Ser 210 215 220Gly Phe Gln Gln Thr Met Gln Met Leu Asn Glu Gly Ile Val Pro Thr225 230 235 240Ala Met Leu Val Ala Asn Asp Gln Met Ala Leu Gly Ala Met Arg Ala 245 250 255Ile Thr Glu Ser Gly Leu Arg Val Gly Ala Asp Ile Ser Val Val Gly 260 265 270Tyr Asp Asp Thr Glu Asp Ser Ser Cys Tyr Ile Pro Pro Leu Thr Thr 275 280 285Ile Lys Gln Asp Phe Arg Leu Leu Gly Gln Thr Ser Val Asp Arg Leu 290 295 300Leu Gln Leu Ser Gln Gly Gln Ala Val Lys Gly Asn Gln Leu Leu Pro305 310 315 320Val Ser Leu Val Lys Arg Lys Thr Thr Leu Ala Pro Asn Thr Gln Thr 325 330 335Ala Ser Pro Arg Ala Leu Ala Asp Ser Leu Met Gln Leu Ala Arg Gln 340 345 350Val Ser Arg Leu Glu Ser Gly Gln 355 360 2380 base pairs nucleic acid double circular other nucleic acid /desc = ”synthetic vector“ CDS complement (51..707) /product= ”cat resistance“ 294GATCTAGCAC CAGGCGTTTA AGGGCACCAA TAACTGCCTT AAAAAAATTA CGCCCCGCCC 60TGCCACTCAT CGCAGTACTG TTGTAATTCA TTAAGCATTC TGCCGACATG GAAGCCATCA 120CAAACGGCAT GATGAACCTG AATCGCCAGC GGCATCAGCA CCTTGTCGCC TTGCGTATAA 180TATTTGCCCA TAGTGAAAAC GGGGGCGAAG AAGTTGTCCA TATTGGCTAC GTTTAAATCA 240AAACTGGTGA AACTCACCCA GGGATTGGCT GAGACGAAAA ACATATTCTC AATAAACCCT 300TTAGGGAAAT AGGCCAGGTT TTCACCGTAA CACGCCACAT CTTGCGAATA TATGTGTAGA 360AACTGCCGGA AATCGTCGTG GTATTCACTC CAGAGCGATG AAAACGTTTC AGTTTGCTCA 420TGGAAAACGG TGTAACAAGG GTGAACACTA TCCCATATCA CCAGCTCACC GTCTTTCATT 480GCCATACGGA ACTCCGGGTG AGCATTCATC AGGCGGGCAA GAATGTGAAT AAAGGCCGGA 540TAAAACTTGT GCTTATTTTT CTTTACGGTC TTTAAAAAGG CCGTAATATC CAGCTGAACG 600GTCTGGTTAT AGGTACATTG AGCAACTGAC TGAAATGCCT CAAAATGTTC TTTACGATGC 660CATTGGGATA TATCAACGGT GGTATATCCA GTGATTTTTT TCTCCATTTT AGCTTCCTTA 720GCTCCTGAAA ATCTCGATAA CTCAAAAAAT ACGCCCGGTA GTGATCTTAT TTCATTATGG 780TGAAAGTTGG AACCTCACCC GACGTCTAAT GTGAGTTAGC TCACTCATTA GGCACCCCAG 840GCTTTACACT TTATGCTTCC GGCTCGTATG TTGTGTGGAA TTGTGAGCGG ATAACAATTT 900CACACAGGAA ACAGCTATGA CCATGATTAC GAATTTCTAG ACCCCCCCCC CGCATGCCAT 960AACTTCGTAT AATGTACGCT ATACGAAGTT ATAAGCTTGA CCTGTGAAGT GAAAAATGGC 1020GCAGATTGTG CGACATTTTT TTTGTCTGCC GTTTAATTAA AGGGGGGGGG GGGCCGGCCT 1080GGGGGGGGGT GTACATGAAA TTGTAAACGT TAATATTTTG TTAAAATTCG CGTTAAATTT 1140TTGTTAAATC AGCTCATTTT TTAACCAATA GGCCGAAATC GGCAAAATCC CTTATAAATC 1200AAAAGAATAG ACCGAGATAG GGTTGAGTGT TGTTCCAGTT TGGAACAAGA GTCCACTATT 1260AAAGAACGTG GACTCCAACG TCAAAGGGCG AAAAACCGTC TATCAGGGCG ATGGCCCACT 1320ACGAGAACCA TCACCCTAAT CAAGTTTTTT GGGGTCGAGG TGCCGTAAAG CACTAAATCG 1380GAACCCTAAA GGGAGCCCCC GATTTAGAGC TTGACGGGGA AAGCCGGCGA ACGTGGCGAG 1440AAAGGAAGGG AAGAAAGCGA AAGGAGCGGG CGCTAGGGCG CTGGCAAGTG TAGCGGTCAC 1500GCTGCGCGTA ACCACCACAC CCGCCGCGCT TAATGCGCCG CTACAGGGCG CGTGCTAGCG 1560GAGTGTATAC TGGCTTACTA TGTTGGCACT GATGAGGGTG TCAGTGAAGT GCTTCATGTG 1620GCAGGAGAAA AAAGGCTGCA CCGGTGCGTC AGCAGAATAT GTGATACAGG ATATATTCCG 1680CTTCCTCGCT CACTGACTCG CTACGCTCGG TCGTTCGACT GCGGCGAGCG GAAATGGCTT 1740ACGAACGGGG CGGAGATTTC CTGGAAGATG CCAGGAAGAT ACTTAACAGG GAAGTGAGAG 1800GGCCGCGGCA AAGCCGTTTT TCCATAGGCT CCGCCCCCCT GACAAGCATC ACGAAATCTG 1860ACGCTCAAAT CAGTGGTGGC GAAACCCGAC AGGACTATAA AGATACCAGG CGTTTCCCCC 1920TGGCGGCTCC CTCCTGCGCT CTCCTGTTCC TGCCTTTCGG TTTACCGGTG TCATTCCGCT 1980GTTATGGCCG CGTTTGTCTC ATTCCACGCC TGACACTCAG TTCCGGGTAG GCAGTTCGCT 2040CCAAGCTGGA CTGTATGCAC GAACCCCCCG TTCAGTCCGA CCGCTGCGCC TTATCCGGTA 2100ACTATCGTCT TGAGTCCAAC CCGGAAAGAC ATGCAAAAGC ACCACTGGCA GCAGCCACTG 2160GTAATTGATT TAGAGGAGTT AGTCTTGAAG TCATGCGCCG GTTAAGGCTA AACTGAAAGG 2220ACAAGTTTTA GTGACTGCGC TCCTCCAAGC CAGTTACCTC GGTTCAAAGA GTTGGTAGCT 2280CAGAGAACCT ACGAAAAACC GCCCTGCAAG GCGGTTTTTT CGTTTTCAGA GCAAGAGATT 2340ACGCGCAGAC CAAAACGATC TCAAGAAGAT CATCTTATTA 2380 219 amino acids amino acid linear protein 295Met Glu Lys Lys Ile Thr Gly Tyr Thr Thr Val Asp Ile Ser Gln Trp 1 5 10 15His Arg Lys Glu His Phe Glu Ala Phe Gln Ser Val Ala Gln Cys Thr 20 25 30Tyr Asn Gln Thr Val Gln Leu Asp Ile Thr Ala Phe Leu Lys Thr Val 35 40 45Lys Lys Asn Lys His Lys Phe Tyr Pro Ala Phe Ile His Ile Leu Ala 50 55 60Arg Leu Met Asn Ala His Pro Glu Phe Arg Met Ala Met Lys Asp Gly 65 70 75 80Glu Leu Val Ile Trp Asp Ser Val His Pro Cys Tyr Thr Val Phe His 85 90 95Glu Gln Thr Glu Thr Phe Ser Ser Leu Trp Ser Glu Tyr His Asp Asp 100 105 110Phe Arg Gln Phe Leu His Ile Tyr Ser Gln Asp Val Ala Cys Tyr Gly 115 120 125Glu Asn Leu Ala Tyr Phe Pro Lys Gly Phe Ile Glu Asn Met Phe Phe 130 135 140Val Ser Ala Asn Pro Trp Val Ser Phe Thr Ser Phe Asp Leu Asn Val145 150 155 160Ala Asn Met Asp Asn Phe Phe Ala Pro Val Phe Thr Met Gly Lys Tyr 165 170 175Tyr Thr Gln Gly Asp Lys Val Leu Met Pro Leu Ala Ile Gln Val His 180 185 190His Ala Val Cys Asp Gly Phe His Val Gly Arg Met Leu Asn Glu Leu 195 200 205Gln Gln Tyr Cys Asp Glu Trp Gln Gly Gly Ala 210 215 3488 base pairs nucleic acid double circular other nucleic acid /desc = ”synthetic vector“ CDS complement (1341..1997) /product= ”cat resistance“ CDS complement (2521..3417) /product= ”bla resistance“ 296GTACATGAAA TTGTAAACGT TAATATTTTG TTAAAATTCG CGTTAAATTT TTGTTAAATC 60AGCTCATTTT TTAACCAATA GGCCGAAATC GGCAAAATCC CTTATAAATC AAAAGAATAG 120ACCGAGATAG GGTTGAGTGT TGTTCCAGTT TGGAACAAGA GTCCACTATT AAAGAACGTG 180GACTCCAACG TCAAAGGGCG AAAAACCGTC TATCAGGGCG ATGGCCCACT ACGAGAACCA 240TCACCCTAAT CAAGTTTTTT GGGGTCGAGG TGCCGTAAAG CACTAAATCG GAACCCTAAA 300GGGAGCCCCC GATTTAGAGC TTGACGGGGA AAGCCGGCGA ACGTGGCGAG AAAGGAAGGG 360AAGAAAGCGA AAGGAGCGGG CGCTAGGGCG CTGGCAAGTG TAGCGGTCAC GCTGCGCGTA 420ACCACCACAC CCGCCGCGCT TAATGCGCCG CTACAGGGCG CGTGCTAGCG GAGTGTATAC 480TGGCTTACTA TGTTGGCACT GATGAGGGTG TCAGTGAAGT GCTTCATGTG GCAGGAGAAA 540AAAGGCTGCA CCGGTGCGTC AGCAGAATAT GTGATACAGG ATATATTCCG CTTCCTCGCT 600CACTGACTCG CTACGCTCGG TCGTTCGACT GCGGCGAGCG GAAATGGCTT ACGAACGGGG 660CGGAGATTTC CTGGAAGATG CCAGGAAGAT ACTTAACAGG GAAGTGAGAG GGCCGCGGCA 720AAGCCGTTTT TCCATAGGCT CCGCCCCCCT GACAAGCATC ACGAAATCTG ACGCTCAAAT 780CAGTGGTGGC GAAACCCGAC AGGACTATAA AGATACCAGG CGTTTCCCCC TGGCGGCTCC 840CTCCTGCGCT CTCCTGTTCC TGCCTTTCGG TTTACCGGTG TCATTCCGCT GTTATGGCCG 900CGTTTGTCTC ATTCCACGCC TGACACTCAG TTCCGGGTAG GCAGTTCGCT CCAAGCTGGA 960CTGTATGCAC GAACCCCCCG TTCAGTCCGA CCGCTGCGCC TTATCCGGTA ACTATCGTCT 1020TGAGTCCAAC CCGGAAAGAC ATGCAAAAGC ACCACTGGCA GCAGCCACTG GTAATTGATT 1080TAGAGGAGTT AGTCTTGAAG TCATGCGCCG GTTAAGGCTA AACTGAAAGG ACAAGTTTTA 1140GTGACTGCGC TCCTCCAAGC CAGTTACCTC GGTTCAAAGA GTTGGTAGCT CAGAGAACCT 1200ACGAAAAACC GCCCTGCAAG GCGGTTTTTT CGTTTTCAGA GCAAGAGATT ACGCGCAGAC 1260CAAAACGATC TCAAGAAGAT CATCTTATTA GATCTAGCAC CAGGCGTTTA AGGGCACCAA 1320TAACTGCCTT AAAAAAATTA CGCCCCGCCC TGCCACTCAT CGCAGTACTG TTGTAATTCA 1380TTAAGCATTC TGCCGACATG GAAGCCATCA CAAACGGCAT GATGAACCTG AATCGCCAGC 1440GGCATCAGCA CCTTGTCGCC TTGCGTATAA TATTTGCCCA TAGTGAAAAC GGGGGCGAAG 1500AAGTTGTCCA TATTGGCTAC GTTTAAATCA AAACTGGTGA AACTCACCCA GGGATTGGCT 1560GAGACGAAAA ACATATTCTC AATAAACCCT TTAGGGAAAT AGGCCAGGTT TTCACCGTAA 1620CACGCCACAT CTTGCGAATA TATGTGTAGA AACTGCCGGA AATCGTCGTG GTATTCACTC 1680CAGAGCGATG AAAACGTTTC AGTTTGCTCA TGGAAAACGG TGTAACAAGG GTGAACACTA 1740TCCCATATCA CCAGCTCACC GTCTTTCATT GCCATACGGA ACTCCGGGTG AGCATTCATC 1800AGGCGGGCAA GAATGTGAAT AAAGGCCGGA TAAAACTTGT GCTTATTTTT CTTTACGGTC 1860TTTAAAAAGG CCGTAATATC CAGCTGAACG GTCTGGTTAT AGGTACATTG AGCAACTGAC 1920TGAAATGCCT CAAAATGTTC TTTACGATGC CATTGGGATA TATCAACGGT GGTATATCCA 1980GTGATTTTTT TCTCCATTTT AGCTTCCTTA GCTCCTGAAA ATCTCGATAA CTCAAAAAAT 2040ACGCCCGGTA GTGATCTTAT TTCATTATGG TGAAAGTTGG AACCTCACCC GACGTCTAAT 2100GTGAGTTAGC TCACTCATTA GGCACCCCAG GCTTTACACT TTATGCTTCC GGCTCGTATG 2160TTGTGTGGAA TTGTGAGCGG ATAACAATTT CACACAGGAA ACAGCTATGA CCATGATTAC 2220GAATTTCTAG ACCCCCCCCC CGCATGCCAT AACTTCGTAT AATGTACGCT ATACGAAGTT 2280ATAAGCTTGA CCTGTGAAGT GAAAAATGGC GCAGATTGTG CGACATTTTT TTTGTCTGCC 2340GTTTAATTAA GGGGGGGGGC CGGCCATTAT CAAAAAGGAT CTCAAGAAGA TCCTTTGATC 2400TTTTCTACGG GGTCTGACGC TCAGTGGAAC GAAAACTCAC GTTAAGGGAT TTTGGTCATG 2460AGATTATCAA AAAGGATCTT CACCTAGATC CTTTTAAATT AAAAATGAAG TTTTAAATCA 2520ATCTAAAGTA TATATGAGTA AACTTGGTCT GACAGTTACC CAATGCTTAA TCAGTGAGGC 2580ACCTATCTCA GCGATCTGTC TATTTCGTTC ATCCATAGTT GCCTGACTCC CCGTCGTGTA 2640GATAACTACG ATACGGGAGG GCTTACCATC TGGCCCCAGT GCTGCAATGA TACCGCGAGA 2700CCCACGCTCA CCGGCTCCAG ATTTATCAGC AATAAACCAG CCAGCCGGAA GGGCCGAGCG 2760CAGAAGTGGT CCTGCAACTT TATCCGCCTC CATCCAGTCT ATTAACTGTT GCCGGGAAGC 2820TAGAGTAAGT AGTTCGCCAG TTAATAGTTT GCGCAACGTT GTTGCCATTG CTACAGGCAT 2880CGTGGTGTCA CGCTCGTCGT TTGGTATGGC TTCATTCAGC TCCGGTTCCC AACGATCAAG 2940GCGAGTTACA TGATCCCCCA TGTTGTGCAA AAAAGCGGTT AGCTCCTTCG GTCCTCCGAT 3000CGTTGTCAGA AGTAAGTTGG CCGCAGTGTT ATCACTCATG GTTATGGCAG CACTGCATAA 3060TTCTCTTACT GTCATGCCAT CCGTAAGATG CTTTTCTGTG ACTGGTGAGT ACTCAACCAA 3120GTCATTCTGA GAATAGTGTA TGCGGCGACC GAGTTGCTCT TGCCCGGCGT CAATACGGGA 3180TAATACCGCG CCACATAGCA GAACTTTAAA AGTGCTCATC ATTGGAAAAC GTTCTTCGGG 3240GCGAAAACTC TCAAGGATCT TACCGCTGTT GAGATCCAGT TCGATGTAAC CCACTCGCGC 3300ACCCAACTGA TCCTCAGCAT CTTTTACTTT CACCAGCGTT TCTGGGTGAG CAAAAACAGG 3360AAGGCAAAAT GCCGCAAAAA AGGGAATAAG GGCGACACGG AAATGTTGAA TACTCATACT 3420CTTCCTTTTT CAATATTATT GAAGCATTTA TCAGGGTTAT TGTCTCATGA GCGGATACAT 3480ATTTGAAT 3488 219 amino acids amino acid linear protein 297Met Glu Lys Lys Ile Thr Gly Tyr Thr Thr Val Asp Ile Ser Gln Trp 1 5 10 15His Arg Lys Glu His Phe Glu Ala Phe Gln Ser Val Ala Gln Cys Thr 20 25 30Tyr Asn Gln Thr Val Gln Leu Asp Ile Thr Ala Phe Leu Lys Thr Val 35 40 45Lys Lys Asn Lys His Lys Phe Tyr Pro Ala Phe Ile His Ile Leu Ala 50 55 60Arg Leu Met Asn Ala His Pro Glu Phe Arg Met Ala Met Lys Asp Gly 65 70 75 80Glu Leu Val Ile Trp Asp Ser Val His Pro Cys Tyr Thr Val Phe His 85 90 95Glu Gln Thr Glu Thr Phe Ser Ser Leu Trp Ser Glu Tyr His Asp Asp 100 105 110Phe Arg Gln Phe Leu His Ile Tyr Ser Gln Asp Val Ala Cys Tyr Gly 115 120 125Glu Asn Leu Ala Tyr Phe Pro Lys Gly Phe Ile Glu Asn Met Phe Phe 130 135 140Val Ser Ala Asn Pro Trp Val Ser Phe Thr Ser Phe Asp Leu Asn Val145 150 155 160Ala Asn Met Asp Asn Phe Phe Ala Pro Val Phe Thr Met Gly Lys Tyr 165 170 175Tyr Thr Gln Gly Asp Lys Val Leu Met Pro Leu Ala Ile Gln Val His 180 185 190His Ala Val Cys Asp Gly Phe His Val Gly Arg Met Leu Asn Glu Leu 195 200 205Gln Gln Tyr Cys Asp Glu Trp Gln Gly Gly Ala 210 215 299 amino acids amino acid linear protein 298Met Ser Ile Gln His Phe Arg Val Ala Leu Ile Pro Phe Phe Ala Ala 1 5 10 15Phe Cys Leu Pro Val Phe Ala His Pro Glu Thr Leu Val Lys Val Lys 20 25 30Asp Ala Glu Asp Gln Leu Gly Ala Arg Val Gly Tyr Ile Glu Leu Asp 35 40 45Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe Arg Pro Glu Glu Arg Phe 50 55 60Pro Met Met Ser Thr Phe Lys Val Leu Leu Cys Gly Ala Val Leu Ser 65 70 75 80Arg Ile Asp Ala Gly Gln Glu Gln Leu Gly Arg Arg Ile His Tyr Ser 85 90 95Gln Asn Asp Leu Val Glu Tyr Ser Pro Val Thr Glu Lys His Leu Thr 100 105 110Asp Gly Met Thr Val Arg Glu Leu Cys Ser Ala Ala Ile Thr Met Ser 115 120 125Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr Ile Gly Gly Pro Lys 130 135 140Glu Leu Thr Ala Phe Leu His Asn Met Gly Asp His Val Thr Arg Leu145 150 155 160Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala Ile Pro Asn Asp Glu Arg 165 170 175Asp Thr Thr Met Pro Val Ala Met Ala Thr Thr Leu Arg Lys Leu Leu 180 185 190Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg Gln Gln Leu Ile Asp Trp 195 200 205Met Glu Ala Asp Lys Val Ala Gly Pro Leu Leu Arg Ser Ala Leu Pro 210 215 220Ala Gly Trp Phe Ile Ala Asp Lys Ser Gly Ala Gly Glu Arg Gly Ser225 230 235 240Arg Gly Ile Ile Ala Ala Leu Gly Pro Asp Gly Lys Pro Ser Arg Ile 245 250 255Val Val Ile Tyr Thr Thr Gly Ser Gln Ala Thr Met Asp Glu Arg Asn 260 265 270Arg Gln Ile Ala Glu Ile Gly Ala Ser Leu Ile Lys His Trp Val Thr 275 280 285Val Arg Pro Ser Leu Leu Ile Tyr Thr Leu Asp 290 295 2728 base pairs nucleic acid double circular other nucleic acid /desc = ”synthetic vector“ CDS complement (471..1367) /product= ”bla resistance“ 299GATCTCATAA CTTCGTATAA TGTATGCTAT ACGAAGTTAT GACGTCTAAT GTGAGTTAGC 60TCACTCATTA GGCACCCCAG GCTTTACACT TTATGCTTCC GGCTCGTATG TTGTGTGGAA 120TTGTGAGCGG ATAACAATTT CACACAGGAA ACAGCTATGA CCATGATTAC GAATTTCTAG 180ACCCCCCCCC CGCATGCCAT AACTTCGTAT AATGTACGCT ATACGAAGTT ATAAGCTTGA 240CCTGTGAAGT GAAAAATGGC GCAGATTGTG CGACATTTTT TTTGTCTGCC GTTTAATTAA 300GGGGGGGGGC CGGCCATTAT CAAAAAGGAT CTCAAGAAGA TCCTTTGATC TTTTCTACGG 360GGTCTGACGC TCAGTGGAAC GAAAACTCAC GTTAAGGGAT TTTGGTCATG AGATTATCAA 420AAAGGATCTT CACCTAGATC CTTTTAAATT AAAAATGAAG TTTTAAATCA ATCTAAAGTA 480TATATGAGTA AACTTGGTCT GACAGTTACC CAATGCTTAA TCAGTGAGGC ACCTATCTCA 540GCGATCTGTC TATTTCGTTC ATCCATAGTT GCCTGACTCC CCGTCGTGTA GATAACTACG 600ATACGGGAGG GCTTACCATC TGGCCCCAGT GCTGCAATGA TACCGCGAGA CCCACGCTCA 660CCGGCTCCAG ATTTATCAGC AATAAACCAG CCAGCCGGAA GGGCCGAGCG CAGAAGTGGT 720CCTGCAACTT TATCCGCCTC CATCCAGTCT ATTAACTGTT GCCGGGAAGC TAGAGTAAGT 780AGTTCGCCAG TTAATAGTTT GCGCAACGTT GTTGCCATTG CTACAGGCAT CGTGGTGTCA 840CGCTCGTCGT TTGGTATGGC TTCATTCAGC TCCGGTTCCC AACGATCAAG GCGAGTTACA 900TGATCCCCCA TGTTGTGCAA AAAAGCGGTT AGCTCCTTCG GTCCTCCGAT CGTTGTCAGA 960AGTAAGTTGG CCGCAGTGTT ATCACTCATG GTTATGGCAG CACTGCATAA TTCTCTTACT 1020GTCATGCCAT CCGTAAGATG CTTTTCTGTG ACTGGTGAGT ACTCAACCAA GTCATTCTGA 1080GAATAGTGTA TGCGGCGACC GAGTTGCTCT TGCCCGGCGT CAATACGGGA TAATACCGCG 1140CCACATAGCA GAACTTTAAA AGTGCTCATC ATTGGAAAAC GTTCTTCGGG GCGAAAACTC 1200TCAAGGATCT TACCGCTGTT GAGATCCAGT TCGATGTAAC CCACTCGCGC ACCCAACTGA 1260TCCTCAGCAT CTTTTACTTT CACCAGCGTT TCTGGGTGAG CAAAAACAGG AAGGCAAAAT 1320GCCGCAAAAA AGGGAATAAG GGCGACACGG AAATGTTGAA TACTCATACT CTTCCTTTTT 1380CAATATTATT GAAGCATTTA TCAGGGTTAT TGTCTCATGA GCGGATACAT ATTTGAATGT 1440ACATGAAATT GTAAACGTTA ATATTTTGTT AAAATTCGCG TTAAATTTTT GTTAAATCAG 1500CTCATTTTTT AACCAATAGG CCGAAATCGG CAAAATCCCT TATAAATCAA AAGAATAGAC 1560CGAGATAGGG TTGAGTGTTG TTCCAGTTTG GAACAAGAGT CCACTATTAA AGAACGTGGA 1620CTCCAACGTC AAAGGGCGAA AAACCGTCTA TCAGGGCGAT GGCCCACTAC GAGAACCATC 1680ACCCTAATCA AGTTTTTTGG GGTCGAGGTG CCGTAAAGCA CTAAATCGGA ACCCTAAAGG 1740GAGCCCCCGA TTTAGAGCTT GACGGGGAAA GCCGGCGAAC GTGGCGAGAA AGGAAGGGAA 1800GAAAGCGAAA GGAGCGGGCG CTAGGGCGCT GGCAAGTGTA GCGGTCACGC TGCGCGTAAC 1860CACCACACCC GCCGCGCTTA ATGCGCCGCT ACAGGGCGCG TGCTAGCGGA GTGTATACTG 1920GCTTACTATG TTGGCACTGA TGAGGGTGTC AGTGAAGTGC TTCATGTGGC AGGAGAAAAA 1980AGGCTGCACC GGTGCGTCAG CAGAATATGT GATACAGGAT ATATTCCGCT TCCTCGCTCA 2040CTGACTCGCT ACGCTCGGTC GTTCGACTGC GGCGAGCGGA AATGGCTTAC GAACGGGGCG 2100GAGATTTCCT GGAAGATGCC AGGAAGATAC TTAACAGGGA AGTGAGAGGG CCGCGGCAAA 2160GCCGTTTTTC CATAGGCTCC GCCCCCCTGA CAAGCATCAC GAAATCTGAC GCTCAAATCA 2220GTGGTGGCGA AACCCGACAG GACTATAAAG ATACCAGGCG TTTCCCCCTG GCGGCTCCCT 2280CCTGCGCTCT CCTGTTCCTG CCTTTCGGTT TACCGGTGTC ATTCCGCTGT TATGGCCGCG 2340TTTGTCTCAT TCCACGCCTG ACACTCAGTT CCGGGTAGGC AGTTCGCTCC AAGCTGGACT 2400GTATGCACGA ACCCCCCGTT CAGTCCGACC GCTGCGCCTT ATCCGGTAAC TATCGTCTTG 2460AGTCCAACCC GGAAAGACAT GCAAAAGCAC CACTGGCAGC AGCCACTGGT AATTGATTTA 2520GAGGAGTTAG TCTTGAAGTC ATGCGCCGGT TAAGGCTAAA CTGAAAGGAC AAGTTTTAGT 2580GACTGCGCTC CTCCAAGCCA GTTACCTCGG TTCAAAGAGT TGGTAGCTCA GAGAACCTAC 2640GAAAAACCGC CCTGCAAGGC GGTTTTTTCG TTTTCAGAGC AAGAGATTAC GCGCAGACCA 2700AAACGATCTC AAGAAGATCA TCTTATTA 2728 299 amino acids amino acid linear protein 300Met Ser Ile Gln His Phe Arg Val Ala Leu Ile Pro Phe Phe Ala Ala 1 5 10 15Phe Cys Leu Pro Val Phe Ala His Pro Glu Thr Leu Val Lys Val Lys 20 25 30Asp Ala Glu Asp Gln Leu Gly Ala Arg Val Gly Tyr Ile Glu Leu Asp 35 40 45Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe Arg Pro Glu Glu Arg Phe 50 55 60Pro Met Met Ser Thr Phe Lys Val Leu Leu Cys Gly Ala Val Leu Ser 65 70 75 80Arg Ile Asp Ala Gly Gln Glu Gln Leu Gly Arg Arg Ile His Tyr Ser 85 90 95Gln Asn Asp Leu Val Glu Tyr Ser Pro Val Thr Glu Lys His Leu Thr 100 105 110Asp Gly Met Thr Val Arg Glu Leu Cys Ser Ala Ala Ile Thr Met Ser 115 120 125Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr Ile Gly Gly Pro Lys 130 135 140Glu Leu Thr Ala Phe Leu His Asn Met Gly Asp His Val Thr Arg Leu145 150 155 160Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala Ile Pro Asn Asp Glu Arg 165 170 175Asp Thr Thr Met Pro Val Ala Met Ala Thr Thr Leu Arg Lys Leu Leu 180 185 190Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg Gln Gln Leu Ile Asp Trp 195 200 205Met Glu Ala Asp Lys Val Ala Gly Pro Leu Leu Arg Ser Ala Leu Pro 210 215 220Ala Gly Trp Phe Ile Ala Asp Lys Ser Gly Ala Gly Glu Arg Gly Ser225 230 235 240Arg Gly Ile Ile Ala Ala Leu Gly Pro Asp Gly Lys Pro Ser Arg Ile 245 250 255Val Val Ile Tyr Thr Thr Gly Ser Gln Ala Thr Met Asp Glu Arg Asn 260 265 270Arg Gln Ile Ala Glu Ile Gly Ala Ser Leu Ile Lys His Trp Val Thr 275 280 285Val Arg Pro Ser Leu Leu Ile Tyr Thr Leu Asp 290 295 45 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 301TATGAGATCT CATAACTTCG TATAATGTAC GCTATACGAA GTTAT 45 45 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 302TAATAACTTC GTATAGCATA CATTATACGA AGTTATGAGA TCTCA 45 91 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 303CATTTTTTGC CCTCGTTATC TACGCATGCG ATAACTTCGT ATAGCGTACA TTATACGAAG 60TTATTCTAGA CATGGTCATA GCTGTTTCCT G 91 52 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 304GGGGGGAATT CGGTGGTGGT GGATCTGCGT GCGCTGAAAC GGTTGAAAGT TG 52 32 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 305CCCCCCCAAG CTTATCAAGA CTCCTTATTA CG 32 34 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 306GGGGGGGGAA TTCGGAGGCG GTTCCGGTGG TGGC 34 74 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 307GGGGGGGGAA TTCGAGCAGA AGCTGATCTC TGAGGAGGAT CTGTAGGGTG GTGGCTCTGG 60TTCCGGTGAT TTTG 74 37 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 308CCATAACTTC GTATAATGTA CGCTATACGA AGTTATA 37 45 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 309AGCTTATAAC TTCGTATAGC GTACATTATA CGAAGTTATG GCATG 45 76 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 310AGCTTGACCT GTGAAGTGAA AAATGGCGCA GATTGTGCGA CATTTTTTTT GTCTGCCGTT 60TAATTAAAGG GGGGGT 76 75 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 311GTACACCCCC CCCCAGGCCG GCCCCCCCCC CCCTTTAATT AAACGGCAGA CAAAAAAAAT 60GTCGCACAAT CTGCG 75 35 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 312GGGGGGGTGT ACATTCAAAT ATGTATCCGC TCATG 35 22 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 313GGGTTACATC GAACTGGATC TC 22 59 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 314CCAGTTCGAT GTAACCCACT CGCGCACCCA ACTGATCCTC AGCATCTTTT ACTTTCACC 59 43 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 315ACTCTAGCTT CCCGGCAACA GTTAATAGAC TGGATGGAGG CGG 43 24 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 316CTGTTGCCGG GAAGCTAGAG TAAG 24 58 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 317CCCCCCCTTA ATTAAGGGGG GGGGCCGGCC ATTATCAAAA AGGATCTCAA GAAGATCC 58 37 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 318GGGGGGGGCT AGCACGCGCC CTGTAGCGGC GCATTAA 37 38 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 319CCCCCCCTGT ACATGAAATT GTAAACGTTA ATATTTTG 38 36 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 320GGGCGATGGC CCACTACGAG AACCATCACC CTAATC 36 32 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 321GGGGGGAGAT CTAATAAGAT GATCTTCTTG AG 32 45 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 322GAGTTGGTAG CTCAGAGAAC CTACGAAAAA CCGCCCTGCA AGGCG 45 24 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 323GTAGGTTCTC TGAGCTACCA ACTC 24 43 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 324GTTTCCCCCT GGCGGCTCCC TCCTGCGCTC TCCTGTTCCT GCC 43 24 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 325AGGAGGGAGC CGCCAGGGGG AAAC 24 26 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 326GACATCAGCG CTAGCGGAGT GTATAC 26 43 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 327GATCTCATAA CTTCGTATAA TGTATGCTAT ACGAAGTTAT TCA 43 45 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 328GATCTGAATA ACTTCGTATA GCATACATTA TACGAAGTTA TGAGA 45 35 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 329GGGGGGGAGA TCTGACCAAA ATCCCTTAAC GTGAG 35 35 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 330GGTATCTGCG CTCTGCTGTA GCCAGTTACC TTCGG 35 35 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 331CCCCCCCGCT AGCCATGTGA GCAAAAGGCC AGCAA 35 23 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 332GGGACGTCGG GTGAGGTTCC AAC 23 29 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 333CCATACGGAA CTCCGGGTGA GCATTCATC 29 16 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 334CCGGAGTTCC GTATGG 16 19 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 335ACGTTTAAAT CAAAACTGG 19 69 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 336CCAGTTTTGA TTTAAACGTA GCCAATATGG ACAACTTCTT CGCCCCCGTT TTCACTATGG 60GCAAATATT 69 26 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 337GGAAGATCTA GCACCAGGCG TTTAAG 26 27 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 338GAGGCCGGCC ATCGAATGGC GCAAAAC 27 31 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 339CGCGTACCGT CCTCATGGGA GAAAATAATA C 31 83 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 340CCATGAGGAC GGTACGCGAC TGGGCGTGGA GCATCTGGTC GCATTGGGTC ACCAGCAAAT 60CCGCTGTTAG CTGGCCCATT AAG 83 42 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 341GTCAGCGGCG GGATATAACA TGAGCTGTCC TCGGTATCGT CG 42 30 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 342GTTATATCCC GCCGCTGACC ACCATCAAAC 30 65 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ conflict replace(42..44, ”“) /note= ”in Fig.35b, M41, LAC6 T4T; but see Fig.35a, M41 LAC6 pos.1055-1119 on complementary strand, 1076 to 1078 TAT“ 343CATCAGTGAA TCGGCCAACG CGCGGGGAGA GGCGGTTTGC GTATTGGGAG CCAGGGTGGT 60TTTTC 65 73 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 344GGTTAATTAA CCTCACTGCC CGCTTTCCAG TCGGGAAACC TGTCGTGCCA GCTGCATCAG 60TGAATCGGCC AAC 73 50 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 345CTAGACTAGT GTTTAAACCG GACCGGGGGG GGGCTTAAGG GGGGGGGGGG 50 50 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 346CTAGCCCCCC CCCCCCTTAA GCCCCCCCCC GGTCCGGTTT AAACACTAGT 50 50 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 347CTAGACTAGT GTTTAAACCG GACCGGGGGG GGGCTTAAGG GGGGGGGGGG 50 82 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 348CCCCCCCTTA AGTGGGCTGC AAAACAAAAC GGCCTCCTGT CAGGAAGCCG CTTTTATCGG 60GTAGCCTCAC TGCCCGCTTT CC 82 40 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 349GTTGTTGTGC CACGCGGTTA GGAATGTAAT TCAGCTCCGC 40 19 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 350AACCGCGTGG CACAACAAC 19 41 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 351CTTCGTTCTA CCATCGACAC GACCACGCTG GCACCCAGTT G 41 20 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 352GTGTCGATGG TAGAACGAAG 20 67 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 353CCACAGCAAT AGCATCCTGG TCATCCAGCG GATAGTTAAT AATCAGCCCA CTGACACGTT 60GCGCGAG 67 22 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 354GACCAGGATG CTATTGCTGT GG 22 37 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 355CAGCGCGATT TGCTGGTGGC CCAATGCGAC CAGATGC 37 18 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 356CACCAGCAAA TCGCGCTG 18 37 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 357CCCGGACTCG GTAATGGCAC GCATTGCGCC CAGCGCC 37 18 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 358GCCATTACCG AGTCCGGG 18 29 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 359AATTCCACCA TCATCACCAT TGACGTCTA 29 29 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 360AGCTTAGACG TCAATGGTGA TGATGGTGG 29 1289 base pairs nucleic acid double linear other nucleic acid /desc = ”synthetic gene cassette“ CDS complement (280..1137) /product= ”bla resistance“ 361CGCGTTAACC TCAGGTGACC AAGCCCCTGG CCAAGGTCCC GTACGTTCGA AGATTACCAT 60CACGTGGATC CGGTACCAGG CCGGCCATTA TCAAAAAGGA TCTCAAGAAG ATCCTTTGAT 120CTTTTCTACG GGGTCTGACG CTCAGTGGAA CGAAAACTCA CGTTAAGGGA TTTTGGTCAT 180GAGATTATCA AAAAGGATCT TCACCTAGAT CCTTTTAAAT TAAAAATGAA GTTTTAAATC 240AATCTAAAGT ATATATGAGT AAACTTGGTC TGACAGTTAC CAATGCTTAA TCAGTGAGGC 300ACCTATCTCA GCGATCTGTC TATTTCGTTC ATCCATAGTT GCCTGACTCC CCGTCGTGTA 360GATAACTACG ATACGGGAGG GCTTACCATC TGGCCCCAGT GCTGCAATGA TACCGCGAGA 420CCCACGCTCA CCGGCTCCAG ATTTATCAGC AATAAACCAG CCAGCCGGAA GGGCCGAGCG 480CAGAAGTGGT CCTGCAACTT TATCCGCCTC CATCCAGTCT ATTAACTGTT GCCGGGAAGC 540TAGAGTAAGT AGTTCGCCAG TTAATAGTTT GCGCAACGTT GTTGCCATTG CTACAGGCAT 600CGTGGTGTCA CGCTCGTCGT TTGGTATGGC TTCATTCAGC TCCGGTTCCC AACGATCAAG 660GCGAGTTACA TGATCCCCCA TGTTGTGCAA AAAAGCGGTT AGCTCCTTCG GTCCTCCGAT 720CGTTGTCAGA AGTAAGTTGG CCGCAGTGTT ATCACTCATG GTTATGGCAG CACTGCATAA 780TTCTCTTACT GTCATGCCAT CCGTAAGATG CTTTTCTGTG ACTGGTGAGT ACTCAACCAA 840GTCATTCTGA GAATAGTGTA TGCGGCGACC GAGTTGCTCT TGCCCGGCGT CAATACGGGA 900TAATACCGCG CCACATAGCA GAACTTTAAA AGTGCTCATC ATTGGAAAAC GTTCTTCGGG 960GCGAAAACTC TCAAGGATCT TACCGCTGTT GAGATCCAGT TCGATGTAAC CCACTCGTGC 1020ACCCAACTGA TCTTCAGCAT CTTTTACTTT CACCAGCGTT TCTGGGTGAG CAAAAACAGG 1080AAGGCAAAAT GCCGCAAAAA AGGGAATAAG GGCGACACGG AAATGTTGAA TACTCATACT 1140CTTCCTTTTT CAATATTATT GAAGCATTTA TCAGGGTTAT TGTCTCATGA GCGGATACAT 1200ATTTGAATGT ACTCGGCCGC ACGAGCTGCA GGCGCCATTA ATGGCTCGAG CGCGCTTCAG 1260CGCTTTGTCT TCCGGATGTA CATGAAATT 1289 286 amino acids amino acid linear protein 362Met Ser Ile Gln His Phe Arg Val Ala Leu Ile Pro Phe Phe Ala Ala 1 5 10 15Phe Cys Leu Pro Val Phe Ala His Pro Glu Thr Leu Val Lys Val Lys 20 25 30Asp Ala Glu Asp Gln Leu Gly Ala Arg Val Gly Tyr Ile Glu Leu Asp 35 40 45Leu Asn Ser Gly Lys Ile Leu Glu Ser Phe Arg Pro Glu Glu Arg Phe 50 55 60Pro Met Met Ser Thr Phe Lys Val Leu Leu Cys Gly Ala Val Leu Ser 65 70 75 80Arg Ile Asp Ala Gly Gln Glu Gln Leu Gly Arg Arg Ile His Tyr Ser 85 90 95Gln Asn Asp Leu Val Glu Tyr Ser Pro Val Thr Glu Lys His Leu Thr 100 105 110Asp Gly Met Thr Val Arg Glu Leu Cys Ser Ala Ala Ile Thr Met Ser 115 120 125Asp Asn Thr Ala Ala Asn Leu Leu Leu Thr Thr Ile Gly Gly Pro Lys 130 135 140Glu Leu Thr Ala Phe Leu His Asn Met Gly Asp His Val Thr Arg Leu145 150 155 160Asp Arg Trp Glu Pro Glu Leu Asn Glu Ala Ile Pro Asn Asp Glu Arg 165 170 175Asp Thr Thr Met Pro Val Ala Met Ala Thr Thr Leu Arg Lys Leu Leu 180 185 190Thr Gly Glu Leu Leu Thr Leu Ala Ser Arg Gln Gln Leu Ile Asp Trp 195 200 205Met Glu Ala Asp Lys Val Ala Gly Pro Leu Leu Arg Ser Ala Leu Pro 210 215 220Ala Gly Trp Phe Ile Ala Asp Lys Ser Gly Ala Gly Glu Arg Gly Ser225 230 235 240Arg Gly Ile Ile Ala Ala Leu Gly Pro Asp Gly Lys Pro Ser Arg Ile 245 250 255Val Val Ile Tyr Thr Thr Gly Ser Gln Ala Thr Met Asp Glu Arg Asn 260 265 270Arg Gln Ile Ala Glu Ile Gly Ala Ser Leu Ile Lys His Trp 275 280 285 18 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 363GCCCTGCAAG CGGAAGAC 18 20 base pairs nucleic acid single linear other nucleic acid 364GGCTTTCGAA TGGCCAAAGG 20 81 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide misc_feature 25..27 /product= “random codon by trinucleotide mutagenesis (ACT/GTT)” misc_feature 37..39 /product= “random codon by trinucleotides (TTT,CAT,CTT,ATG,CAG)” misc_feature 43..45 /product= “random codon by trinucleotides (18 codons, no Pro, no Cys)” misc_feature 46..48 /product= “random codon by trinucleotides (GAT, GGT, AAT, TCT, TAT)” misc_feature 49..51 /product= “random codon by trinucleotides (GAT, GGT, AAT, TCT)” misc_feature 52..54 /product= “random codon by trinucleotide mutagenesis (19aa, no Cys)” misc_feature 55..57 /product= “random codon by trinucleotides (CCT/TCT)” misc_feature 58..60 /product= “random codon by trinucleotide mutagenesis (19 aa, no Cys)” 365GCCCTGCAAG CGGAAGACTT TGCGRYTTAT TATTGCHWKC AGNNKDVTDV TNNKYCTNNK 60ACCTTTGGCC ATTCGAAAGC C 81 81 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide misc_feature 37..39 /product= ”random codon by trinucleotides (TTT,CAT,CTT,ATG,CAG)“ misc_feature 43..45 /product= ”random codon by trinucleotides (18 codons, no Pro, no Cys)“ misc_feature 46..48 /product= ”random codon by trinucleotides (GAT, GGT, AAT, TCT, TAT)“ misc_feature 49..51 /product= ”random codon by trinucleotides (GAT, GGT, AAT, TCT)“ misc_feature 52..54 /product= ”random codon by trinucleotide mutagenesis (19aa, no Cys)“ misc_feature 55..57 /product= ”random codon by trinucleotides (CCT/TCT)“ misc_feature 58..60 /product= ”random codon by trinucleotide mutagenesis (19 aa, no Cys)“ 366GCCCTGCAAG CGGAAGACGT GGGCGTGTAT TATTGCHWKC AGNNKDVTDV TNNKYCTNNK 60ACCTTTGGCC ATTCGAAAGC C 81 81 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide misc_feature 37..39 /product= “random codon by trinucleotides (TTT,CAT,CTT,ATG,CAG)” misc_feature 43..45 /product= “random codon by trinucleotides (18 codons, no Pro, no Cys)” misc_feature 46..48 /product= “random codon by trinucleotides (GAT, GGT, AAT, TCT, TAT)” misc_feature 49..51 /product= “random codon by trinucleotides (GAT, GGT, AAT, TCT)” misc_feature 52..54 /product= “random codon by trinucleotide mutagenesis (19aa, no Cys)” misc_feature 55..57 /product= “random codon by trinucleotides (CCT/TCT)” misc_feature 58..60 /product= “random codon by trinucleotide mutagenesis (19 aa, no Cys)” 367GCCCTGCAAG CGGAAGACGT GGCGGTGTAT TATTGCHWKC AGNNKDVTDV TNNKYCTNNK 60ACCTTTGGCC ATTCGAAAGC C 81 108 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide misc_feature 41..43 /product= ”random codon by trinucleotides (CGT, TGG, TAT)“ misc_feature 47..61 /product= ”random codons by trinucleotides (18 aa, no Trp, no Cys)“ misc_feature 62..64 /product= ”random codon by trinucleotide mutagenesis (19aa, no Cys)“ 368CCTGCAAGCG GAAGACGAAG CGGATTATTA TTGCCAGAGC YRKGACNNKN NKNNKNNKNN 60KNNKGGCGGC GGCACGAAGT TAACCGTTCT TGGCCAGGAA TTCGAGCC 108 105 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide misc_feature 41..43 /product= “random codon by trinucleotides (CGT, TGG, TAT)” misc_feature 47..58 /product= “random codons by trinucleotides (18 aa, no Trp, no Cys)” misc_feature 59..61 /product= “random codon by trinucleotide mutagenesis (19aa, no Cys)” 369CCTGCAAGCG GAAGACGAAG CGGATTATTA TTGCCAGAGC YRKGACNNKN NKNNKNNKNN 60KGGCGGCGGC ACGAAGTTAA CCGTTCTTGG CCAGGAATTC GAGCC 105 102 base pairs nucleic acid single linear other nucleic acid /desc = “synthetic oligonucleotide misc_feature 41..43 /product= ”random codon by trinucleotides (CGT, TGG, TAT)“ misc_feature 47..55 /product= ”random codons by trinucleotides (18 aa, no Trp, no Cys)“ misc_feature 56..58 /product= ”random codon by trinucleotide mutagenesis (19aa, no Cys)“ 370CCTGCAAGCG GAAGACGAAG CGGATTATTA TTGCCAGAGC YRKGACNNKN NKNNKNNKGG 60CGGCGGCACG AAGTTAACCG TTCTTGGCCA GGAATTCGAG CC 102 17 base pairs nucleic acid single linear other nucleic acid /desc = ”synthetic oligonucleotide“ 371GGCTCGAATT CCTGGCC 17 157 amino acids amino acid linear protein 372Gly Gly Gly Ser Gly Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn 1 5 10 15Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp Glu Asn Ala Leu Gln 20 25 30Ser Asp Ala Lys Gly Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly Ala 35 40 45Ala Ile Asp Gly Phe Ile Gly Asp Val Ser Gly Leu Ala Asn Gly Asn 50 55 60Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn Ser Gln Met Ala Gln Val 65 70 75 80Gly Asp Gly Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gln Tyr Leu 85 90 95Pro Ser Leu Pro Gln Ser Val Glu Cys Arg Pro Phe Val Phe Gly Ala 100 105 110Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn Leu Phe 115 120 125Arg Gly Val Phe Ala Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr Val 130 135 140Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser145 150 155 157 amino acids amino acid linear protein 373Gly Gly Gly Ser Gly Ser Gly Asp Phe Asp Tyr Glu Lys Met Ala Asn 1 5 10 15Ala Asn Lys Gly Ala Met Thr Glu Asn Ala Asp Glu Asn Ala Leu Gln 20 25 30Ser Asp Ala Lys Gly Lys Leu Asp Ser Val Ala Thr Asp Tyr Gly Ala 35 40 45Ala Ile Asp Gly Phe Ile Gly Asp Val Ser Gly Leu Ala Asn Gly Asn 50 55 60Gly Ala Thr Gly Asp Phe Ala Gly Ser Asn Ser Gln Met Ala Gln Val 65 70 75 80Gly Asp Gly Asp Asn Ser Pro Leu Met Asn Asn Phe Arg Gln Tyr Leu 85 90 95Pro Ser Leu Pro Gln Ser Val Glu Cys Arg Pro Phe Val Phe Gly Ala 100 105 110Gly Lys Pro Tyr Glu Phe Ser Ile Asp Cys Asp Lys Ile Asn Leu Phe 115 120 125Arg Gly Val Phe Ala Phe Leu Leu Tyr Val Ala Thr Phe Met Tyr Val 130 135 140Phe Ser Thr Phe Ala Asn Ile Leu Arg Asn Lys Glu Ser145 150 155

Claims

1. A method of obtaining an antibody or antibody fragment specific for an antigen, comprising:(a) contacting the antigen with a display library of antibodies or antibody fragments; and; (b) selecting one or more antibodies or antibody fragments that bind to said antigen; wherein each antibody or antibody fragment in said display library comprises a human immunoglobulin VH domain and a human immunoglobulin VL domain, wherein each VH domain and each VL domain comprises a consensus framework sequence comprising four framework regions interspaced with three complementarity determining regions CDR1, CDR2, and CDR3, wherein each consensus VH framework sequence and consensus VL framework sequence is selected from a set of consensus framework sequences, wherein each member of said set of framework sequences is encoded by a nucleic acid comprising DNA cleavage sites at the boundary between each framework region and complementarity determining region, and wherein each of said cleavage sites is unique within said nucleic acid but common to all nucleic acid sequences of said set at corresponding positions.

2. The method according to claim 1, wherein said human VH immunoglobulin domains comprise sequences selected from the framework sequences of VH1A (SEQ ID NO:57), VH1B (SEQ ID NO: 59), VH2 (SEQ ID NO: 61), VH3 (SEQ ID NO: 63), VH4 (SEQ ID NO: 65), VH5 (SEQ ID NO: 67), and VH6 (SEQ ID NO: 69).

3. The method according to claim 2 wherein said CDR1 is selected from the group consisting of VH CDR1 germline sequences.

4. The method according to claim 3, wherein said CDR1 is selected from the group consisting of the CDR1 region sequences of VH1-12-1, VH1-13-16, VH2-31-10, VH3-13-8, VH4-11-7, CH5-12-1, and VH6-35-1.

5. The method according to claim 2, wherein said CDR2 is selected from the group consisting of VH CDR2 germline sequences.

6. The method according to claim 5, wherein said CDR2 is selected from the group consisting of the CDR2 region sequences of VH1-12-1, VH1-13-6, VH2-31-3, VH3-13-8, VH4-11-8, VH4-31-17, VH5-12-1, and VH6-35-1.

7. The method according to claim 2, wherein said CDR3 is selected from random amino acid sequences.

8. The method according to claim 2, wherein said CDR1 and said CDR2 are independently selected from the group consisting of the CDR1 and CDR2 sequences of VH1-12-1, VH1-13-16, VH2-31-10, VH3-13-8, VH4-11-7, CH5-12-1, and VH6-35-1.

9. The method according to claim 8, wherein said CDR3 is selected from random amino acid sequences.

10. The method according to claim 1, wherein said human VL domains comprise framework region sequences selected from the group consisting of the framework region sequences of Vκ1 (SEQ ID NO:43), Vκ2 (SEQ ID NO: 45), Vκ3 (SEQ ID NO: 47), and Vκ4 (SEQ ID NO: 49).

11. The method according to claim 10, wherein said CDR1 is selected from the group consisting of Vκ CDR1 germline sequences.

12. The method according to claim 11, wherein said CDR1 is selected from the group consisting of the CDR1 region sequences of Vκ1-14, Vκ2-6, Vκ3-1, and Vκ4-1.

13. The method according to claim 11, wherein said CDR2 is selected from the group consisting of Vκ CDR2 germline sequences.

14. The method according to claim 13, wherein said CDR2 is selected from the group consisting of the CDR2 region sequences of Vκ1-14, Vκ2-6, Vκ3-1, and Vκ4-1.

15. The method according to claim 10, wherein said CDR3 is selected from random amino acid sequences.

16. The method according to claim 10 wherein said CDR1 and said CDR2 sequences are independently selected from the group consisting of the CDR1 and CDR2 region sequences of Vκ1-14, Vκ2-6, Vκ3-1, and Vκ4-1.

17. The method according to claim 16, wherein said CDR3 is selected from random amino acid sequences.

18. The method according to claim 1, wherein said human VL immunoglobulin sequences comprise consensus framework regions selected from the group consisting of the framework region sequences of Vλ1 (SEQ ID NO: 51), Vλ2 (SEQ ID NO: 53), and Vλ3 (SEQ ID NO: 55).

19. The method according to claim 18, wherein said CDR1 is selected from the group consisting of Vλ CDR1 germline sequences.

20. The method according to claim 19, wherein said CDR1 is selected from the group consisting of the CDR1 region sequences of VHUMLV86, DPL11, and DPL23.

21. The method according to claim 18, wherein said CDR2 is selected from the group consisting of Vλ CDR2 germline sequences.

22. The method according to claim 21, wherein said CDR2 is selected from the group consisting of the CDR2 region sequences of DPL5, DPL12, and HUMLV318.

23. The method according to claim 18, wherein said CDR3 is selected from random amino acid sequences.

24. The method according to claim 18, wherein said CDR1 and said CDR2 are independently selected from the group consisting of the CDR1 and CDR2 region sequences of VHUMLV86, DPL11, and DPL23.

25. The method according to claim 24, wherein said CDR3 is selected from random amino acid sequences.

26. The method according to claim 1, wherein said human immunoglobulin sequences comprise human VH, Vλ, and Vκ immunoglobulin sequences.

27. The method according to claim 26,wherein said human VH immunoglobulin sequences comprise consensus framework regions selected from the group consisting of the framework region sequences of VH1A (SEQ ID NO:57), VH1B (SEQ ID NO: 59), VH2 (SEQ ID NO: 61), VH3 (SEQ ID NO: 63), VH4 (SEQ ID NO: 65), VH5 (SEQ ID NO: 67), and VH6 (SEQ ID NO: 69), wherein said human Vκ immunoglobulin sequences comprise framework region sequences selected from the group consisting of the framework region sequences of Vκ1 (SEQ ID NO:43), Vκ2 (SEQ ID NO: 45), Vκ3 (SEQ ID NO: 47), and Vκ4 (SEQ ID NO: 49), and wherein said human Vλ immunoglobulin sequences comprise framework region sequences selected from the group consisting of the framework region sequences of Vλ1 (SEQ ID NO: 51), Vλ2 (SEQ ID NO: 53), and Vλ3 (SEQ ID NO: 55).

28. The method according to claim 26,wherein said human VH immunoglobulin sequences comprise consensus framework, CDR1, and CDR2 regions selected from the group consisting of the framework region sequences of VH1A (SEQ ID NO:57), VH1B (SEQ ID NO: 59), VH2 (SEQ ID NO: 61), VH3 (SEQ ID NO: 63), VH4 (SEQ ID NO: 65), VH5 (SEQ ID NO: 67), and VH6 (SEQ ID NO: 69), wherein said human Vκ immunoglobulin sequences comprise framework, CDR1, and CDR2 region sequences selected from the group consisting of the framework region sequences of Vκ1 (SEQ ID NO:43), Vκ2 (SEQ ID NO: 45), Vκ3 (SEQ ED NO: 47), and Vκ4 (SEQ ID NO: 49), and wherein said human Vλ immunoglobulin sequences comprise framework, CDR1, and CDR2 region sequences selected from the group consisting of the framework region sequences of Vλ1 (SEQ ID NO: 51), Vλ2 (SEQ ID NO: 53), and Vλ3 (SEQ ID NO: 55).

29. The method according to claim 1, wherein said display library is a phage display library.

30. The method according to claim 29, wherein said display library is encoded on a phagemid vector.

31. The method according to claim 29, wherein said phage display library is in Fab format.

32. The method according to claim 29, wherein said phage display library is in single chain Fv format.

33. The method according to claim 1, wherein the nucleic acid which encodes the a selected antibody or antibody fragment is used to express said antibody or antibody fragment in a recombinant host cell.

34. The method according to claim 1, wherein the nucleic acids encoding said display library of antibodies or antibody fragments comprise codons that are frequently used in said host cell.

35. The method according to claim 33, wherein said recombinant host cell is E. coli.