Patent Application
20250057980
The instant application contains a Sequence Listing with 577, which has been submitted via Patent Center and is hereby incorporated by reference in its entirety. Said XML copy, created on Dec. 22, 2022, is named 50699PCT-SequenceListing.xml, and is 780,344 bytes in size.
Programmable, efficient, and multiplexed genome integration of large, diverse DNA cargo independent of DNA repair remains an unsolved challenge of genome editing. Current gene integration approaches require double strand breaks that evoke DNA damage responses and rely on repair pathways that are inactive in terminally differentiated cells. Furthermore, CRISPR-based approaches that bypass double stranded breaks, such as Prime editing, are limited to modification or insertion of short sequences.
There is a need in the art for techniques which address and overcome these shortcomings and enable the co-delivery of gene editor constructs and associated donor templates for the insertion and/or deletion of large sequences into cells for therapeutic and circuit-based uses for broad purposes, across eukaryotic as well as prokaryotic systems.
The present disclosure describes co-delivering (i.e., “dual delivery”) to a cell a (i) gene editor construct and a (ii) donor (i.e., “cargo” or “payload”) template that enables in vivo beacon placement and in vivo integration of a template polynucleotide. In typical embodiments, the gene editor construct is comprised of a polynucleotide sequence that encodes the gene editor construct. In typical embodiments, the gene editor construct, upon polynucleotide expression or direct delivery of the gene editor protein and associated guide RNAs (gRNAs (e.g., atgRNA), can incorporate an integrase target recognition site (i.e., “beacon” or “landing pad”) or a recombinase target recognition site at a DNA locus. The gene editor polynucleotide construct is packaged within a lipid nanoparticle (LNP) that is capable of localizing the gene editor polynucleotide construct to a cell cytoplasm. The gene editor polynucleotide construct packaged in a LNP is co-delivered with a donor template (i.e., “cargo” or “payload”) polynucleotide construct packaged into a separate vector that is capable of localizing the donor template to a cell nucleus. In certain embodiments, the donor template vector is AAV, helper dependent adenovirus, or integration deficient lentivirus. In typical embodiments, the donor template is integrated into the genomic integrase target recognition site by an integrase, optionally by an integrase fused/linked to a gene editor protein. Also provided herein are methods using LNP mixtures, including a split LNP approach to deliver precise ratios of mRNA encoding the gene editor protein to atgRNAs. These ratios enable robust in vivo beacon placement in both neonatal and adult mice model systems.
The present disclosure provides a co-delivery platform for site-specific genetic engineering using Programmable Addition via Site-Specific Targeting Elements (PASTE) (see Ionnidi et al.; doi: 10.1101/2021.11.01.466786; the entirety of Ionnidi et al. is incorporated by reference), transposon-mediated gene editing, or other suitable gene editing or gene incorporation technology.
Described herein is a method of co-delivering (i.e., “dual delivery”) to a cell a (i) gene editor construct and a (ii) template polynucleotide (i.e., “cargo” or “payload”). In typical embodiments, the gene editor construct is comprised of a polynucleotide sequence that encodes the gene editor construct. In typical embodiments, the gene editor construct, upon polynucleotide expression or direct delivery of the gene editor protein and associated guide RNAs, can incorporate an integrase target recognition site (i.e., “beacon” or “landing pad”) or a recombinase target recognition site at a DNA locus. The gene editor polynucleotide construct is packaged within a lipid nanoparticle (LNP) that is capable of localizing the gene editor polynucleotide construct to a cell cytoplasm. The gene editor can be packaged into the LNP as a protein along with associated guide RNAs and delivered to the cell cytoplasm or to cell nucleus. The gene editor polynucleotide construct packaged in a LNP is co-delivered with a donor template (i.e., “cargo” or “payload”) polynucleotide construct packaged into a separate vector that is capable of localizing the donor template to a cell nucleus. In certain embodiments, the donor template vector is AAV, helper dependent adenovirus, or integration deficient lentivirus. In typical embodiments, the donor template is integrated into the genomic integrase target recognition site by an integrase, optionally by an integrase fused/linked to a gene editor protein.
The present disclosure provides a co-delivery platform for site-specific genetic engineering using Programmable Addition via Site-Specific Targeting Elements (PASTE) (see Ionnidi et al.; doi: 10.1101/2021.11.01.466786; U.S. application Ser. No. 17/649,308; PCT Publication No. WO 2022/087235A; each of which is herein incorporated by reference in its entirety), transposon-mediated gene editing, or other suitable gene editing or gene incorporation technology.
In one aspect, this disclosure features a method for delivering a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the method comprising:
In some embodiments, the gene editor polynucleotide is capable of localizing to a cell cytoplasm.
In some embodiments, the template polynucleotide is capable of localizing to a cell nucleus.
In some embodiments, the gene editor polynucleotide comprises: a polynucleotide sequence encoding a prime editor system.
In some embodiments, the prime editor system comprises a nucleotide sequence encoding a nickase and a nucleotide sequence encoding a reverse transcriptase.
In some embodiments, the nucleotide sequence encoding the nickase and the nucleotide sequence encoding the reverse transcriptase are positioned in the gene editor polynucleotide such that when expressed the nickase is linked to the reverse transcriptase.
In some embodiments, the nickase is linked to the reverse transcriptase by in-frame fusion. In some embodiments, the nickase is linked to the reverse transcriptase by a linker. In some embodiments, the linker is a peptide fused in-frame between the nickase and reverse transcriptase.
In some embodiments, the gene editor polynucleotide further comprises: a polynucleotide sequence encoding at least a first integrase.
In some embodiments, the linked nickase-reverse transcriptase are further linked to the first integrase.
In some embodiments, the method also includes co-delivering a second vector.
In some embodiments, the second vector comprises a polynucleotide sequence encoding at least a first integrase.
In some embodiments, the first integrase is selected from BxB1, Bcec, Sscd, Sacd, Int10, or Pa01.
In some embodiments, the gene editor polynucleotide further comprises a polynucleotide sequence encoding a recombinase. In some embodiments, the recombinase is FLP or Cre.
In some embodiments, the first atgRNA comprises: (i) a domain that is capable of guiding the prime editor system to a target sequence; and (ii) a reverse transcriptase (RT) template that comprises at least a portion of an at least first integration recognition site.
In some embodiments, the RT template comprises the entirety of the first integration recognition site.
In some embodiments, the vector further comprises a second atgRNA.
In some embodiments, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence; the first atgRNA further includes a first RT template that comprises at least a portion of an at least first integration recognition site; the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site.
In some embodiments, the vector further comprises a nicking gRNA.
In some embodiments, the LNPs further comprises a nicking gRNA.
In some embodiments, the template polynucleotide comprises at least one of the following: a gene, an expression cassette, a logic gate system, or any combination thereof.
In some embodiments, the template polynucleotide comprises a second integration recognition site.
In some embodiments, the second integration recognition site is a cognate pair with the first integration recognition site.
In some embodiments, the template polynucleotide comprises at least a third integration recognition site.
In some embodiments, the template polynucleotide further comprises at least a fourth integration recognition site.
In some embodiments, the third integration recognition site and the fourth integration recognition site are selected from attB, attB2, attP, or attP2.
In some embodiments, the vector further comprises a sub-sequence that is capable of self-circularizing to form a self-circular nucleic acid.
In some embodiments, the sub-sequence of the vector that is capable of self-circularizing includes the template polynucleotide, whereby upon self-circularizing the self-circular nucleic acid comprises the template polynucleotide.
In some embodiments, the sub-sequence is flanked by the third integration recognition site and the fourth integration recognition site.
In some embodiments, self-circularizing is mediated by recombination of the third integration recognition site and a fourth integration recognition site by the integrase.
In some embodiments, the self-circular nucleic acid comprises one or more additional integration recognition sites that enable integration of additional nucleic acid cargo.
In some embodiments, the vector is a vector selected from: an adenovirus, an AAV, a lentivirus, a HSV, an annelovirus, a retrovirus, a Doggybone™ DNA (dbDNA), a minicircle, a plasmid, a miniDNA, an exosome, a fusosome, or a nanoplasmid.
In some embodiments, the LNP and the vector are concurrently delivered.
In some embodiments, the LNP and the vector are delivered separately.
In some embodiments, the LNP and the vector are delivered at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, or 8 weeks apart.
In some embodiments, the cell is in vivo.
In another aspect, this disclosure features a method for delivering a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the method comprising:
In another aspect, this disclosure features a method for delivering a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the method comprising:
In another aspect, this disclosure features a method for delivering a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the method comprising:
In some embodiments, the gene editor polynucleotide comprises:
In some embodiments, the prime editor system comprises a nucleotide sequence encoding a nickase and a nucleotide sequence encoding a reverse transcriptase.
In some embodiments, the nucleotide sequence encoding the nickase and the nucleotide sequence encoding the reverse transcriptase are positioned in the gene editor polynucleotide such that when expressed the nickase is linked to the reverse transcriptase.
In some embodiments, the nickase is linked to the reverse transcriptase by in-frame fusion.
In some embodiments, the nickase is linked to the reverse transcriptase by a linker.
In some embodiments, the linker is a peptide fused in-frame between the nickase and reverse transcriptase.
In some embodiments, the gene editor polynucleotide construct further comprises: a polynucleotide sequence encoding at least a first integrase.
In some embodiments, the linked nickase-reverse transcriptase are further linked to the integrase.
In some embodiments, the method also includes delivering a second vector.
In some embodiments, the second vector comprises a polynucleotide sequence encoding at least a first integrase.
In some embodiments, the first integrase is selected from BxB1, Bcec, Sscd, Sacd, Int10, or Pa01.
In some embodiments, the gene editor polynucleotide construct further comprises a polynucleotide sequence encoding a recombinase.
In some embodiments, the recombinase is FLP or Cre.
In some embodiments, the first atgRNA comprises: (i) a domain that is capable of guiding the prime editor system to a target sequence; and (ii) a reverse transcriptase (RT) template that comprises at least a portion of an at least first integration recognition site.
In some embodiments, the RT template comprises the entirety of the first integration recognition site.
In some embodiments, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence; the first atgRNA further includes a first RT template that comprises at least a portion of the first integration recognition site; the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site.
In some embodiments, the template polynucleotide comprises at least one of the following: a gene, an expression cassette, a logic gate system, or any combination thereof.
In some embodiments, the template polynucleotide comprises a second integration recognition site.
In some embodiments, the second integration recognition site is a cognate pair with the first integration recognition site.
In some embodiments, the template polynucleotide comprises at least a third integration recognition site.
In some embodiments, the template polynucleotide further comprises at least a fourth integration recognition site.
In some embodiments, the third integration recognition site and the fourth integration recognition site are selected from attB, attB2, attP, or attP2.
In some embodiments, the vector further comprises a sub-sequence that is capable of self-circularizing to form a self-circular nucleic acid.
In some embodiments, the sub-sequence of the vector that is capable of self-circularizing includes the template polynucleotide, whereby upon self-circularizing the self-circular nucleic acid comprises the template polynucleotide.
In some embodiments, the sub-sequence is flanked by the third integration recognition site and the fourth integration recognition site.
In some embodiments, self-circularizing is mediated by recombination of the third integration recognition site and the fourth integration recognition site by the integrase.
In some embodiments, the self-circular nucleic acid comprises one or more additional integration recognition sites that enable integration of additional nucleic acid cargo.
In some embodiments, the vector is a vector selected from: an adenovirus, an AAV, a lentivirus, a HSV, an annelovirus, a retrovirus, a Doggybone™ DNA (dbDNA), a minicircle, a plasmid, a miniDNA, a exosome, a fusosome, or a nanoplasmid.
In some embodiments, the LNP and the vector are concurrently delivered.
In some embodiments, the LNP and the vector are delivered separately.
In some embodiments, the LNP and the vector are delivered at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, or 8 weeks apart.
In some embodiments, the cell is in vivo.
In another aspect, this disclosure features a method of co-delivering a system capable of site-specifically integrating at least a first integration recognition site into the genome of a cell, the method comprising:
In some embodiments, the method also includes mixing the first LNP and the second LNP prior to co-delivering to the cell.
In some embodiments, the first LNP and the second LNP are mixed at a ratio of 1:0.25, 1:0.5, 1:0.75, 1:1, 0.75:1, 0.5:1, or 0.25:1.
In some embodiments, the first gene editor polynucleotide construct, the second gene editor polynucleotide construct, or both comprise: a polynucleotide sequence encoding a prime editor system.
In some embodiments, the prime editor system comprises a nucleotide sequence encoding a nickase and a nucleotide sequence encoding a reverse transcriptase.
In some embodiments, the nucleotide sequence encoding the nickase and the nucleotide sequence encoding the reverse transcriptase are positioned in the gene editor polynucleotide such that when expressed the nickase is linked to the reverse transcriptase.
In some embodiments, the nickase is linked to the reverse transcriptase by in-frame fusion.
In some embodiments, the nickase is linked to the reverse transcriptase by a linker.
In some embodiments, the linker is a peptide fused in-frame between the nickase and reverse transcriptase.
In some embodiments, the first gene editor polynucleotide, construct, the second gene editor polynucleotide construct, or both, further comprise:
In some embodiments, the linked nickase-reverse transcriptase are further linked to the integrase.
In some embodiments, the first gene editor polynucleotide, the second gene editor polynucleotide, or both, further comprise: a polynucleotide sequence encoding a recombinase.
In some embodiments, the linked nickase-reverse transcriptase are further linked to the recombinase.
In some embodiments, the first gene editor polynucleotide and the second gene editor polynucleotide are the same.
In some embodiments, the first gene editor polynucleotide is mRNA, the second gene editor polynucleotide is mRNA, or both the first and second gene editor polynucleotides are mRNA.
In some embodiments, the first LNP comprises a ratio of mRNA to atgRNA of 1:0.25, 1:0.5, 1:0.75, 1:1, 0.75:1, 0.5:1, or 0.25:1.
In some embodiments, the second LNP comprises a ratio of mRNA to atgRNA of 1:0.25, 1:0.5, 1:0.75, 1:1, 0.75:1, 0.5:1, or 0.25:1.
In some embodiments, the method also includes delivering an integrase.
In some embodiments, delivering the integrase comprises co-delivering the integrase with (a) and (b).
In some embodiments, the method comprises delivering a polynucleotide sequence encoding the integrase.
In some embodiments, the polynucleotide sequence is encoded in a first vector.
In some embodiments, the first vector is a vector selected from: an adenovirus, an AAV, a lentivirus, a HSV, an annelovirus, a retrovirus, a Doggybone™ DNA (dbDNA), a minicircle, a plasmid, a miniDNA, an exosome, a fusosome, or a nanoplasmid.
In some embodiments, the first vector further comprises a template polynucleotide and a sequence that is an integration cognate with the first integration recognition site.
In some embodiments, the method also includes delivering a recombinase.
In some embodiments, delivering the recombinase comprises co-delivering the recombinase with (a) and (b).
In some embodiments, the method comprises delivering a polynucleotide sequence encoding the recombinase.
In some embodiments, the polynucleotide sequence is encoded in the first vector.
In some embodiments, the method also includes delivering a second vector.
In some embodiments, the second vector comprises a template polynucleotide and a sequence that is an integration cognate with the first integration recognition site.
In some embodiments, the second vector is a vector selected from: an adenovirus, an AAV, a lentivirus, an HSV, an annelovirus, a retrovirus, Doggybone™ DNA (dbDNA), a minicircle, a plasmid, a miniDNA, an exosome, a fusosome, or a nanoplasmid.
In some embodiments, the template polynucleotide comprises at least one of the following: a gene, an expression cassette, a logic gate system, or any combination thereof.
In some embodiments, the template polynucleotide comprises a second integration recognition site.
In some embodiments, the second integration recognition site is a cognate pair with the first integration recognition site.
In some embodiments, the template polynucleotide comprises at least a third integration recognition site.
In some embodiments, the template polynucleotide further comprises at least a fourth integration recognition site.
In some embodiments, the third integration recognition site and the fourth integration recognition site are selected from attB, attB2, attP, or attP2.
In some embodiments, the vector further comprises a sub-sequence that is capable of self-circularizing to form a self-circular nucleic acid.
In some embodiments, the sub-sequence of the vector that is capable of self-circularizing includes the template polynucleotide, whereby upon self-circularizing the self-circular nucleic acid comprises the template polynucleotide.
In some embodiments, the sub-sequence is flanked by the third integration recognition site and the fourth integration recognition site.
In some embodiments, self-circularizing is mediated by recombination of the third integration recognition site and a fourth integration recognition site by the integrase.
In some embodiments, the self-circular nucleic acid comprises one or more additional integration recognition sites that enable integration of additional nucleic acid cargo.
In some embodiments, the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence; the first atgRNA further includes a first RT template that comprises at least a portion of a first integration recognition site; the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site.
In some embodiments, the first integration site is an AttB sequence, a FRT sequence, or a VOX sequence.
In some embodiments, the first atgRNA, the second atgRNA or both are synthetic.
In some embodiments, the integrase is selected from BxB1, Bcec, Sscd, Sacd, Int10, or Pa01.
In some embodiments, the cell is in vivo.
In another aspect, this disclosure features a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the system comprising:
In some embodiments of the system, the gene editor polynucleotide construct comprises a polynucleotide sequence encoding a prime editor system.
In some embodiments of the system, the prime editor system comprises a nucleotide sequence encoding a nickase and a nucleotide sequence encoding a reverse transcriptase.
In some embodiments of the system, the nucleotide sequence encoding the nickase and the nucleotide sequence encoding the reverse transcriptase are positioned in the gene editor polynucleotide such that when expressed the nickase is linked to the reverse transcriptase. In some embodiments of the system, the nickase is linked to the reverse transcriptase by in-frame fusion. In some embodiments of the system, the nickase is linked to the reverse transcriptase by a linker.
In some embodiments of the system, the linker is a peptide fused in-frame between the nickase and reverse transcriptase.
In some embodiments of the system, the gene editor polynucleotide construct further comprises: a polynucleotide sequence encoding at least a first integrase.
In some embodiments of the system, the linked nickase-reverse transcriptase are further linked to the first integrase.
In some embodiments of the system, the system also includes a second vector.
In some embodiments of the system, the second vector comprises a polynucleotide sequence encoding at least a first integrase. In some embodiments of the system, the first integrase is selected from BxB1, Bcec, Sscd, Sacd, Int10, or Pa01.
In some embodiments of the system, the gene editor polynucleotide construct further comprises a polynucleotide sequence encoding a recombinase. In some embodiments of the system, the recombinase is FLP or Cre.
In some embodiments of the system, the first atgRNA comprises: (i) a domain that is capable of guiding the prime editor system to a target sequence; and (ii) a reverse transcriptase (RT) template that comprises at least a portion of an at least first integration recognition site.
In some embodiments of the system, the RT template comprises the entirety of the first integration recognition site.
In some embodiments of the system, the vector further comprises a second atgRNA.
In some embodiments of the system, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence; the first atgRNA further includes a first RT template that comprises at least a portion of the first integration recognition site; the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site.
In some embodiments of the system, the vector further comprises a nicking gRNA.
In some embodiments of the system, the LNP further comprises a nicking gRNA.
In some embodiments of the system, the template polynucleotide comprises at least one of the following: a gene, an expression cassette, a logic gate system, or any combination thereof.
In some embodiments of the system, the template polynucleotide comprises a second integration recognition site.
In some embodiments of the system, the second integration recognition site is a cognate pair with the first integration recognition site.
In some embodiments of the system, the template polynucleotide comprises at least a third integration recognition site.
In some embodiments of the system, the template polynucleotide construct further comprises at least a fourth integration recognition site.
In some embodiments of the system, the third integration recognition site and the fourth integration recognition site are selected from attB, attB2, attP, or attP2.
In some embodiments of the system, the vector further comprises a sub-sequence that is capable of self-circularizing to form a self-circular nucleic acid.
In some embodiments of the system, the sub-sequence of vector that is capable of self-circularizing includes the template polynucleotide, whereby upon self-circularizing the self-circular nucleic acid comprises the template polynucleotide.
In some embodiments of the system, the sub-sequence is flanked by the third integration recognition site and the fourth integration recognition site.
In some embodiments of the system, self-circularizing is mediated by recombination of the third integration recognition site and the fourth integration recognition site by the integrase.
In some embodiments of the system, the self-circular nucleic acid comprises one or more additional integration recognition sites that enable integration of additional nucleic acid cargo.
In some embodiments of the system, the vector is a recombinant adenovirus, a helper dependent adenovirus, or an adeno-associated virus.
In another aspect, this disclosure features a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the system comprising:
In another aspect, this disclosure features a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the system comprising:
In another aspect, this disclosure features a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the system comprising:
In some embodiments of the system, the gene editor polynucleotide comprises: a polynucleotide sequence encoding a prime editor system.
In some embodiments of the system, the prime editor system comprises a nucleotide sequence encoding a nickase and a nucleotide sequence encoding a reverse transcriptase.
In some embodiments of the system, the nucleotide sequence encoding the nickase and the nucleotide sequence encoding the reverse transcriptase are positioned in the gene editor polynucleotide such that when expressed the nickase is linked to the reverse transcriptase. In some embodiments of the system, the nickase is linked to the reverse transcriptase by in-frame fusion. In some embodiments of the system, the nickase is linked to the reverse transcriptase by a linker.
In some embodiments of the system, the linker is a peptide fused in-frame between the nickase and reverse transcriptase.
In some embodiments of the system, the gene editor polynucleotide further comprises:
In some embodiments of the system, the linked nickase-reverse transcriptase are further linked to the first integrase.
In some embodiments of the system, the system also includes a second vector.
In some embodiments of the system, the second vector comprises a polynucleotide sequence encoding at least a first integrase.
In some embodiments of the system, the first integrase is selected from BxB1, Bcec, Sscd, Sacd, Int10, or Pa01.
In some embodiments of the system, the gene editor polynucleotide further comprises a polynucleotide sequence encoding a recombinase.
In some embodiments of the system, the recombinase is FLP or Cre.
In some embodiments of the system, the first atgRNA comprises: (i) a domain that is capable of guiding the prime editor system to a target sequence; and (ii) a reverse transcriptase (RT) template that comprises at least a portion of an at least first integration recognition site.
In some embodiments of the system, the RT template comprises the entirety of the first integration recognition site.
In some embodiments of the system, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence; the first atgRNA further includes a first RT template that comprises at least a portion of the first integration recognition site; the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site.
In some embodiments of the system, the template polynucleotide comprises at least one of the following: a gene, an expression cassette, a logic gate system, or any combination thereof.
In some embodiments of the system, the template polynucleotide comprises a second integration recognition site.
In some embodiments of the system, the second integration recognition site is a cognate pair with the first integration recognition site.
In some embodiments of the system, the template polynucleotide comprises at least a third integration recognition site.
In some embodiments of the system, the template polynucleotide construct further comprises at least a fourth integration recognition site.
In some embodiments of the system, the third integration recognition site and the fourth integration recognition site are selected from attB, attB2, attP, or attP2.
In some embodiments of the system, the vector further comprises a sub-sequence that is capable of self-circularizing to form a self-circular nucleic acid.
In some embodiments of the system, the sub-sequence of vector that is capable of self-circularizing includes the template polynucleotide, whereby upon self-circularizing the self-circular nucleic acid comprises the template polynucleotide.
In some embodiments of the system, the sub-sequence is flanked by the third integration recognition site and the fourth integration recognition site.
In some embodiments of the system, self-circularizing is mediated by recombination of the third integration recognition site and the fourth integration recognition site by the integrase.
In some embodiments of the system, the self-circular nucleic acid comprises one or more additional integration recognition sites that enable integration of additional nucleic acid cargo.
In some embodiments of the system, the vector is recombinant adenovirus, helper dependent adenovirus, or an adeno-associated virus.
In another aspect, this disclosure features a system capable of site-specifically integrating at least a first integration recognition site into the genome of a cell, the system comprising:
In some embodiments of the system, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs.
In some embodiments of the system, the first LNP and the second LNP are mixed at a ratio of 1:0.25, 1:0.5, 1:0.75, 1:1, 0.75:1, 0.5:1, or 0.25:1.
In some embodiments of the system, the first gene editor polynucleotide, the second gene editor polynucleotide, or both comprise:
In some embodiments of the system, the prime editor system comprises a nucleotide sequence encoding a nickase and a nucleotide sequence encoding a reverse transcriptase.
In some embodiments of the system, the nucleotide sequence encoding the nickase and the nucleotide sequence encoding the reverse transcriptase are positioned in the gene editor polynucleotide such that when expressed the nickase is linked to the reverse transcriptase.
In some embodiments of the system, the nickase is linked to the reverse transcriptase by in-frame fusion.
In some embodiments of the system, the nickase is linked to the reverse transcriptase by a linker.
In some embodiments of the system, the linker is a peptide fused in-frame between the nickase and reverse transcriptase.
In some embodiments of the system, the first gene editor polynucleotide, the second gene editor polynucleotide, or both, further comprise: a polynucleotide sequence encoding an integrase.
In some embodiments of the system, the linked nickase-reverse transcriptase are further linked to the integrase.
In some embodiments of the system, the first gene editor polynucleotide, the second gene editor polynucleotide, or both, further comprise: a polynucleotide sequence encoding a recombinase.
In some embodiments of the system, the nickase-reverse transcriptase are further linked to the recombinase.
In some embodiments of the system, the first gene editor polynucleotide and the second gene editor polynucleotide are the same.
In some embodiments of the system, the first gene editor polynucleotide is mRNA, the second gene editor polynucleotide is mRNA, or both the first and second gene editor polynucleotides are mRNA.
In some embodiments of the system, the first LNP comprises a ratio of mRNA to atgRNA of 1:0.25, 1:0.5, 1:0.75, 1:1, 0.75:1, 0.5:1, or 0.25:1.
In some embodiments of the system, the second LNP comprises a ratio of mRNA to atgRNA of 1:0.25, 1:0.5, 1:0.75, 1:1, 0.75:1, 0.5:1, or 0.25:1.
In some embodiments of the system, the system also includes an integrase.
In some embodiments of the system, the system comprises a polynucleotide sequence encoding the integrase.
In some embodiments of the system, the polynucleotide sequence is encoded in a first vector.
In some embodiments of the system, the first vector is a vector selected from: an adenovirus, an AAV, a lentivirus, a HSV, an annelovirus, a retrovirus, a Doggybone™ DNA (dbDNA), a minicircle, a plasmid, a miniDNA, an exosome, a fusosome, or a nanoplasmid.
In some embodiments of the system, the first vector further comprises a template polynucleotide and a sequence that is an integration cognate with the first integration recognition site.
In some embodiments of the system, the system also includes delivering a recombinase.
In some embodiments of the system, delivering the recombinase comprises co-delivering the recombinase with (a) and (b).
In some embodiments of the system, the system comprises delivering a polynucleotide sequence encoding the recombinase.
In some embodiments of the system, the polynucleotide sequence is encoded in the first vector.
In some embodiments of the system, the system also includes co-delivering a second vector.
In some embodiments of the system, the second vector comprises a template polynucleotide and a sequence that is an integration cognate with the first integration recognition site.
In some embodiments of the system, the second vector is a vector selected from: an adenovirus, an AAV, a lentivirus, a HSV, an annelovirus, a retrovirus, a Doggybone™ DNA (dbDNA), a minicircle, a plasmid, a miniDNA, an exosome, a fusosome, or a nanoplasmid.
In some embodiments of the system, the template polynucleotide comprises at least one of the following: a gene, an expression cassette, a logic gate system, or any combination thereof.
In some embodiments of the system, the template polynucleotide comprises a second integration recognition site.
In some embodiments of the system, the second integration recognition site is a cognate pair with the first integration recognition site.
In some embodiments of the system, the template polynucleotide comprises at least a third integration recognition site.
In some embodiments of the system, the template polynucleotide further comprises at least a fourth integration recognition site.
In some embodiments of the system, the third integration recognition site and the fourth integration recognition site are selected from attB, attB2, attP, or attP2.
In some embodiments of the system, the vector further comprises a sub-sequence that is capable of self-circularizing to form a self-circular nucleic acid.
In some embodiments of the system, the sub-sequence of the vector that is capable of self-circularizing includes the template polynucleotide, whereby upon self-circularizing the self-circular nucleic acid comprises the template polynucleotide.
In some embodiments of the system, the sub-sequence is flanked by the third integration recognition site and the fourth integration recognition site.
In some embodiments of the system, self-circularizing is mediated by recombination of the third integration recognition site and the fourth integration recognition site by the integrase.
In some embodiments of the system, the self-circular nucleic acid comprises one or more additional integration recognition sites that enable integration of additional nucleic acid cargo.
In some embodiments of the system, the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence; the first atgRNA further includes a first RT template that comprises at least a portion of a first integration recognition site; the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site.
In some embodiments, the first integration site is an AttB sequence, a FRT sequence, or a VOX sequence.
In some embodiments of the system, the first atgRNA, the second atgRNA or both are synthetic.
In some embodiments of the system, the integrase is selected from BxB1, Bcec, Sscd, Sacd, Int10, or Pa01.
In some embodiments of the system, the recombinase is FLP or Cre.
In another aspect, this disclosure features a cell comprising any of the delivery systems or any of the co-delivery systems described herein.
In another aspect, this disclosure features a pharmaceutical composition comprising the any of the delivery systems described herein or any of the co-delivery systems described herein.
In another aspect, this disclosure features a method of treating a patient in need thereof, the method comprising administering an effective amount of any of the systems described herein, any of the cells described herein, or any of the pharmaceutical compositions described herein.
In another aspect, this disclosure features a method of treating a patient in need thereof, the method comprising: administering an effective amount of any of the LNPs described herein, any of the first vectors described herein, or any of the second vectors described herein as a first dose and an effective amount of any of the LNPs described herein, any of the first vectors described herein, or any of the second vectors described herein as a second dose.
In some embodiments, the first dose and the second dose are separately administered by multiple administrations.
In some embodiments, the first dose and the second dose are administered at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days apart.
In some embodiments, the first dose and the second dose are administered at least 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, or 8 weeks apart.
These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description, and accompanying drawings, where:
Described herein is a method of co-delivering (i.e., “dual delivery”) to a cell a (i) gene editor construct and a (ii) donor (i.e., “cargo” or “payload”) template. The gene editor construct is comprised of a polynucleotide sequence that encodes the gene editor construct. In typical embodiments, the gene editor construct, upon polynucleotide expression or direct delivery of the gene editor protein and associated guide RNAs, can incorporate an integrase target recognition site (i.e., “beacon” or “landing pad”) or a recombinase target recognition site at a DNA locus. The gene editor polynucleotide construct is packaged within a lipid nanoparticle (LNP) that is capable of localizing the gene editor polynucleotide construct to a cell cytoplasm. The gene editor polynucleotide construct packaged in a LNP is co-delivered with a donor template (i.e., “cargo” or “payload”) polynucleotide construct packaged into a separate vector that is capable of localizing the donor template to a cell nucleus. In certain embodiments, the donor template vector is AAV, helper dependent adenovirus, or integration deficient lentivirus. In typical embodiments, the donor template is integrated into the genomic integrase target recognition site by an integrase, optionally by an integrase fused/linked to a gene editor protein.
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. As used herein, the following terms have the meanings ascribed to them below.
“Gene editor” as used herein, is a protein that that can be used to perform gene editing, gene modification, gene insertion, gene deletion, or gene inversion. As used herein, the terms “gene editor polynucleotide” refers to polynucleotide sequence encoding the gene editor protein. Such an enzyme or enzyme fusion may contain DNA or RNA targetable nuclease protein (i.e., Cas protein, ADAR, or ADAT), wherein target specificity is mediated by a complexed nucleic acid (i.e., guide RNA). Such an enzyme or enzyme fusion may be a DNA/RNA targetable protein, wherein target specificity is mediated by internal, conjugated, fused, or linked amino acids, such as within TALENs, ZFNs, or meganucleases. The skilled person in the art would appreciate that the gene editor can demonstrate targeted nuclease activity, targeted binding with no nuclease activity, or targeted nickase activity (or cleavase activity). A gene editor comprising a targetable protein may be fused, linked, complexed, operate in cis or trans to one or more proteins or protein fragment motifs. Gene editors may be fused or linked to one or more integrase, recombinase, polymerase, telomerase, reverse transcriptase, or invertase. A gene editor can be a prime editor fusion protein or a gene writer fusion protein.
“Prime editor fusion protein” as used herein, describes a protein that is used in prime editing. “Prime editor system” as used herein describes the components used in prime editing. Prime editing uses CRISPR enzyme that nicks or cuts only single strand of double stranded DNA, i.e., a nickase; the nickase can occur either naturally or by mutation or modification of a nuclease that makes double stranded cuts. The nickase is programmed (directed) with a prime-editing guide RNA (pegRNA). The skilled person in the art would appreciate that the pegRNA both specifies the target site and encodes the desired edit. Described herein are attachment site containing guide RNA (atgRNA) that both specifies the target and encodes for the desired integrase target recognition site. The nickase may be programmed (directed) with an atgRNA. Advantageously the nickase is a catalytically impaired Cas9 endonuclease, a Cas9 nickase, that is fused to the reverse transcriptase. During genetic editing, the Cas9 nickase part of the protein is guided to the DNA target site by the atgRNA (or pegRNA), whereby a nick or single stranded cut occurs. The reverse transcriptase domain then uses the atgRNA (or pegRNA) to template reverse transcription of the desired edit, directly polymerizing DNA onto the nicked target DNA strand. The edited DNA strand replaces the original DNA strand, creating a heteroduplex containing one edited strand and one unedited strand. Afterward, optionally, the prime editor (PE) guides resolution of the heteroduplex to favor copying the edit onto the unedited strand, completing the process (typically achieved with a nickase gRNA). Other enzymes that can be used to nick or cut only a single strand of double stranded DNA includes a cleavase (e.g., cleavase I enzyme).
In some embodiments, an additional agent or agents may be added that improve the efficiency and outcome purity of the prime edit. In some embodiments, the agent may be chemical or biological and disrupt DNA mismatch repair (MMR) processes at or near the edit site (i.e., PE4 and PE5 and PEmax architecture by Chen et al. Cell, 184, 1-18, Oct. 28, 2021; Chen et al. is incorporated herein by reference). In typical embodiments, the agent is a MMR-inhibiting protein. In certain embodiments, the MMR-inhibiting protein is dominant negative MMR protein. In certain embodiments, the dominant negative MMR protein is MLH1dn. In particular embodiments, the MMR-inhibiting agent is incorporated into the co-delivery method described herein. In some embodiments, the MMR-inhibiting agent is linked or fused to the prime editor protein fusion, which may or may not have a linked or fused integrase. In some embodiments, the MMR-inhibiting agent is linked or fused to the Gene Writer™ protein, which may or may not have a linked or fused integrase.
The prime editor or gene editor system can be used to achieve DNA deletion and replacement. In some embodiments, the DNA deletion replacement is induced using a pair of atgRNAs or pegRNA that target opposite DNA strands, programming not only the sites that are nicked but also the outcome of the repair (i.e., PrimeDel by Choi et al. Nat. Biotechnology, Oct. 14, 2021; Choi et al. is incorporated herein by reference and TwinPE by Anzalone et al. BioRxiv, Nov. 2, 2021; Anzalone et al. is incorporated herein by reference). In some embodiments described herein, the DNA deletion is induced using a single atgRNA. In some embodiments, the DNA deletion and replacement is induced using a wild type Cas9 prime editor (PE-Cas9) system (i.e., PEDAR by Jiang et al. Nat. Biotechnology, Oct. 14, 2021; Jiang et al. is incorporated herein by reference in its entirety). In some embodiments, the DNA replacement is an integrase target recognition site or recombinase target recognition site. In certain embodiments, the constructs and methods described herein may be utilized to incorporate the pair of pegRNAs (or atgRNAs) used in PrimeDel, TwinPE (WO2021226558 incorporated by reference herein in its entirety), or PEDAR, the prime editor fusion protein or Gene Writer protein, optionally a nickase guide RNA (ngRNA), an integrase, a nucleic acid cargo, and optionally a recombinase into a LNP delivery system or vector delivery system (e.g., AAV or Adenovirus). The integrase may be directly linked, for example by a peptide linker, to the prime editor fusion or gene writer protein.
In some embodiments, the prime editors can refer to a retrovirus or lentivirus reverse transcriptase such as a Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (RT) fused to a CRISPR enzyme nickase such as a Cas9 H840A nickase, a Cas9nickase. In some embodiments, the prime editors can refer to a retrovirus or lentivirus reverse transcriptase such as a Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (RT) fused to a cleavase. In some embodiments the RT can be fused at, near or to the C-terminus of a Cas9nickase, e.g., Cas9 H840A. Fusing the RT to the C-terminus region, e.g., to the C-terminus, of the Cas9 nickase may result in higher editing efficiency. Such a complex is called PEI. In some embodiments, the CRISPR enzyme nickase, e.g., Cas9(H840A), i.e., a Cas9nickase, can be linked to a non-M-MLV reverse transcriptase such as an AMV-RT or XRT (Cas9(H840A)-AMV-RT or XRT). In some embodiments, instead of the CRISPR enzyme nickase being a Cas9 (H840A), i.e., instead of being a Cas9 nickase, the CRISPR enzyme nickase instead can be a CRISPR enzyme that naturally is a nickase or cuts a single strand of double stranded DNA; for instance, the CRISPR enzyme nickase can be Cas12a/b. Alternatively, the CRISPR enzyme nickase can be another mutation of Cas9, such as Cas9(D10A). A CRISPR enzyme, such as a CRISPR enzyme nickase, such as Cas9 (wild type), Cas9(H840A), Cas9(D10A) or Cas 12a/b nickase can be fused in some embodiments to a pentamutant of M-MLV RT (D200N/L603W/T330P/T306K/W313F), whereby there can be up to about 45-fold higher efficiency, and this is called PE2. In some embodiments, the M-MLV RT comprise one or more of the mutations Y8H, P51L, S56A, S67R, E69K, V129P, L139P, T197A, H204R, V223H, T246E, N249D, E286R, Q2911, E302K, E302R, F309N, M320L, P330E, L435G, L435R, N454K, D524A, D524G, D524N, E562Q, D583N, H594Q, E607K, D653N, and L671P. Specific M-MLV RT mutations are shown in Table 1.
In some embodiments, the reverse transcriptase can also be a wild-type or modified transcription xenopolymerase (RTX), avian myeloblastosis virus reverse transcriptase (AMV RT), Feline Immunodeficiency Virus reverse transcriptase (FIV-RT), FeLV-RT (Feline leukemia virus reverse transcriptase), HIV-RT (Human Immunodeficiency Virus reverse transcriptase). In some embodiments, the reverse transcriptase can be a fusion of MMuLV to the Sto7d DNA binding domain (see Ionnidi et al.; https://doi.org/10.1101/2021.11.01.466786). The fusion of MMuLV to the Sto7d DNA binding domain sequence is given in Table 2.
atgactcactatcaggcctt
PE3, PE3b, PE4, PE5, and/or PEmax, which a skilled person can incorporate into the co-delivery system described herein, involves nicking the non-edited strand, potentially causing the cell to remake that strand using the edited strand as the template to induce HR. The nicking of the non-edited strand can involve the use of a nicking guide RNA (ngRNA).
The skilled person can readily incorporate into the co-delivery system described herein described herein a prime editing or CRISPR system. Examples of prime editors can be found in the following: WO2020/191153, WO2020/191171, WO2020/191233, WO2020/191234, WO2020/191239, WO2020/191241, WO2020/191242, WO2020/191243, WO2020/191245, WO2020/191246, WO2020/191248, WO2020/191249, each of which is incorporated by reference herein in its entirety. In addition, mention is made, and can be used herein, of CRISPR Patent Applications and Patents of the Zhang laboratory and/or Broad Institute, Inc. and Massachusetts Institute of Technology and/or Broad Institute, Inc., Massachusetts Institute of Technology and President and Fellows of Harvard College and/or Editas Medicine, Inc. Broad Institute, Inc., The University of Iowa Research Foundation and Massachusetts Institute of Technology, including those claiming priority to U.S. Application 61/736,527, filed Dec. 12, 2012, including U.S. Pat. Nos. 11,104,937, 11,091,798, 11,060,115, 11,041,173, 11,021,740, 11,008,588, 11,001,829, 10,968,257, 10,954,514, 10,946,108, 10,930,367, 10,876,100, 10,851,357, 10,781,444, 10,711,285, 10,689,691, 10,648,020, 10,640,788, 10,577,630, 10,550,372, 10,494,621, 10,377,998, 10,266,887, 10,266,886, 10,190,137, 9,840,713, 9,822,372, 9,790,490, 8,999,641, 8,993,233, 8,945,839, 8,932,814, 8,906,616, 8,895,308, 8,889,418, 8,889,356, 8,871,445, 8,865,406, 8,795,965, 8,771,945, and 8,697,359; CRISPR Patent Applications and Patents of the Doudna laboratory and/or of Regents of the University of California, the University of Vienna and Emmanuelle Charpentier, including those claiming priority to U.S. application 61/652,086, filed May 25, 2012, and/or 61/716,256, filed Oct. 19, 2012, and/or 61/757,640, filed Jan. 28, 2013, and/or 61/765,576, filed Feb. 15, 2013 and/or Ser. No. 13/842,859, including U.S. Pat. Nos. 11,028,412, 11,008,590, 11,008,589, 11,001,863, 10,988,782, 10,988,780, 10,982,231, 10,982,230, 10,900,054, 10,793,878, 10,774,344, 10,752,920, 10,676,759, 10,669,560, 10,640,791, 10,626,419, 10,612,045, 10,597,680, 10,577,631, 10,570,419, 10,563,227, 10,550,407, 10,533,190, 10,526,619, 10,519,467, 10,513,712, 10,487,341, 10,443,076, 10,428,352, 10,421,980, 10,415,061, 10,407,697, 10,400,253, 10,385,360, 10,358,659, 10,358,658, 10,351,878, 10,337,029, 10,308,961, 10,301,651, 10,266,850, 10,227,611, 10,113,167, and 10,000,772; CRISPR Patent Applications and Patents of Vilnius University and/or the Siksnys laboratory, including those claiming priority to U.S. application 62/046,384 and/or 61/625,420 and/or 61/613,373 and/or PCT/IB2015/056756, including U.S. Pat. No. 10,385,336; CRISPR Patent Applications and Patents of the President and Fellows of Harvard College, including those of George Church's laboratory and/or claiming priority to U.S. application 61/738,355, filed Dec. 17, 2012, including 11,111,521, 11,085,072, 11,064,684, 10,959,413, 10,925,263, 10,851,369, 10,787,684, 10,767,194, 10,717,990, 10,683,490, 10,640,789, 10,563,225, 10,435,708, 10,435,679, 10,375,938, 10,329,587, 10,273,501, 10,100,291, 9,970,024, 9,914,939, 9,777,262, 9,587,252, 9,267,135, 9,260,723, 9,074,199, 9,023,649; CRISPR Patent Applications and Patents of the President and Fellows of Harvard College, including those of David Liu's laboratory, including 11,111,472, 11,104,967, 11,078,469, 11,071,790, 11,053,481, 11,046,948, 10,954,548, 10,947,530, 10,912,833, 10,858,639, 10,745,677, 10,704,062, 10,682,410, 10,612,011, 10,597,679, 10,508,298, 10,465,176, 10,323,236, 10,227,581, 10,167,457, 10,113,163, 10,077,453, 9,999,671, 9,840,699, 9,737,604, 9,526,784, 9,388,430, 9,359,599, 9,340,800, 9,340,799, 9,322,037, 9,322,006, 9,228,207, 9,163,284, and 9,068,179; and CRISPR Patent Applications and Patents of Toolgen Incorporated and/or the Kim laboratory and/or claiming priority to U.S. application 61/717,324, filed Oct. 23, 2012 and/or 61/803,599, filed Mar. 20, 2013 and/or 61/837,481, filed Jun. 20, 2013 and/or 62/033,852, filed Aug. 6, 2014 and/or PCT/KR2013/009488 and/or PCT/KR2015/008269, including U.S. Pat. Nos. 10,851,380, and 10,519,454; and CRISPR Patent Applications and Patents of Sigma and/or Millipore and/or the Chen laboratory and/or claiming priority to U.S. application 61/734,256, filed Dec. 6, 2012 and/or 61/758,624, filed Jan. 30, 2013 and/or 61/761,046, filed Feb. 5, 2013 and/or 61/794,422, filed Mar. 15, 2013, including U.S. Pat. No. 10,731,181, each of which is hereby incorporated herein by reference, and from the disclosures of the foregoing, the skilled person can readily make and use a prime editing or CRISPR system, and can especially appreciate impaired endonucleases, such as a mutated Cas9 that only nicks a single strand of DNA and is hence a nickase, or a CRISPR enzyme that only makes a single-stranded cut that can be employed in a PASTE system of the invention. Further, from the disclosures of the foregoing, the skilled person can incorporate the selected CRISPR enzyme, as part of the prime editor fusion or gene editor fusion, into the co-delivery method described herein.
Prior to RT-mediated edit incorporation, the prime editor protein (or system) (1) site-specifically targets a genomic locus and (2) performs a catalytic cut or nick. These steps are typically performed by a CRISPR-Cas. However, in some embodiments the Cas protein may be substituted by other nucleic acid programmable DNA binding proteins (napDNAbp) such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or meganucleases. In addition, to the extent the “targeting rules” of other napDNAbp are known or are newly determined, it becomes possible to use new napDNAbp, beyond Cas9, to site specifically target and modify genomic sites of interest.
Similar to a prime editor protein, a Gene Writer can introduce novel DNA elements, such as an integration target site, into a DNA locus. A Gene Writer protein comprises: (A) a polypeptide or a nucleic acid encoding a polypeptide, wherein the polypeptide comprises (i) a reverse transcriptase domain, and either (x) an endonuclease domain that contains DNA binding functionality or (y) an endonuclease domain and separate DNA binding domain; and (B) a template RNA comprising (i) a sequence that binds the polypeptide and (ii) a heterologous insert sequence. Examples of such Gene Writer™ proteins and related systems can be found in US20200109398, which is incorporated by reference herein in its entirety.
In some embodiments, the prime editor or Gene Writer protein fusion or prime editor protein linked or fused to an integrase is expressed as a split construct. In typical embodiments, the split construct in reconstituted in a cell. In some embodiments, the split construct can be fused or ligated via intein protein splicing. In some embodiments, the split construct can be reconstituted via protein-protein inter-molecular bonding and/or interactions. In some embodiments, the split construct can be reconstituted via chemical, biological, or environmental induced oligomerization. In certain embodiments, the split construct can be adapted into one or more delivery vectors described herein.
In some embodiments, an integrase or recombinase is directly linked or fused, for example by a peptide linker, which may be cleavable or non-cleavable, to the prime editor fusion protein (i.e., fused Cas9 nickase-reverse transcriptase) or Gene Writer protein. Suitable linkers, for example between the Cas9, RT, and integrase, may be selected from Table 3:
In some embodiments, the prime editor or Gene Writer protein fusion or prime editor protein linked or fused to an integrase is expressed as a split construct. In typical embodiments, the split construct in reconstituted in a cell. In some embodiments, the split construct can be fused or ligated via intein protein splicing. In some embodiments, the split construct can be reconstituted via protein-protein inter-molecular bonding and/or interactions. In some embodiments, the split construct can be reconstituted via chemical, biological, or environmental induced oligomerization. In certain embodiments, the split construct can be adapted into one or more nucleic acid constructs described herein.
The skilled person can incorporate a selected CRISPR enzyme, described below, as part of the prime editor fusion, into the co-delivery method described herein. Streptococcus pyogenes Cas9 (SpCas9), the most common enzyme used in genome-editing applications, is a large nuclease of 1368 amino acid residues. Advantages of SpCas9 include its short, 5′-NGG-3′ PAM and very high average editing efficiency. SpCas9 consists of two lobes: a recognition (REC) lobe and a nuclease (NUC) lobe. The REC lobe can be divided into three regions, a long a helix referred to as the bridge helix (residues 60-93), the REC1 (residues 94-179 and 308-713) domain, and the REC2 (residues 180-307) domain. The NUC lobe consists of the RuvC (residues 1-59, 718-769, and 909-1098), HNH (residues 775-908), and PAM-interacting (PI) (residues 1099-1368) domains. The negatively charged sgRNA:target DNA heteroduplex is accommodated in a positively charged groove at the interface between the REC and NUC lobes. In the NUC lobe, the RuvC domain is assembled from the three split RuvC motifs (RuvC I-III) and interfaces with the PI domain to form a positively charged surface that interacts with the 30 tail of the sgRNA. The HNH domain lies between the RuvC II-III motifs and forms only a few contacts with the rest of the protein. Structural aspects of SpCas9 are described by Nishimasu et al., Crystal Structure of Cas9 in Complex with Guide RNA and Target DNA, Cell 156, 935-949, Feb. 27, 2014.
REC lobe: The REC lobe includes the REC1 and REC2 domains. The REC2 domain does not contact the bound guide:target heteroduplex, indicating that truncation of REC lobe may be tolerated by SpCas9. Further, SpCas9 mutant lacking the REC2 domain (D175-307) retained ˜50% of the wild-type Cas9 activity, indicating that the REC2 domain is not critical for DNA cleavage. In striking contrast, the deletion of either the repeat-interacting region (D97-150) or the anti-repeat-interacting region (D312-409) of the REC1 domain abolished the DNA cleavage activity, indicating that the recognition of the repeat:anti-repeat duplex by the REC1 domain is critical for the Cas9 function.
PAM-Interacting domain: The NUC lobe contains the PAM-interacting (PI) domain that is positioned to recognize the PAM sequence on the noncomplementary DNA strand. The PI domain of SpCas9 is required for the recognition of 5′-NGG-3′ PAM, and deletion of the PI domain (A1099-1368) abolished the cleavage activity, indicating that the PI domain is critical for SpCas9 function and a major determinant for the PAM specificity.
RuvC domain: The RuvC nucleases of SpCas9 have an RNase H fold and four catalytic residues, Asp10 (Ala), Glu762, His983, and Asp986, that are critical for the two-metal cleavage of the noncomplementary strand of the target DNA. In addition to the conserved RNase H fold, the Cas9 RuvC domain has other structural elements involved in interactions with the guide:target heteroduplex (an end-capping loop between α42 and α43) and the PI domain/stem loop 3 (β hairpin formed by β3 and β4).
HNH domain: SpCas9 HNH nucleases have three catalytic residues, Asp839, His840, and Asn863 and cleave the complementary strand of the target DNA through a single-metal mechanism.
sgRNA:DNA recognition: The sgRNA guide region is primarily recognized by the REC lobe. The backbone phosphate groups of the guide region (nucleotides 2, 4-6, and 13-20) interact with the REC1 domain (Arg165, Gly166, Arg403, Asn407, Lys510, Tyr515, and Arg661) and the bridge helix (Arg63, Arg66, Arg70, Arg71, Arg74, and Arg78). The 20-hydroxyl groups of G1, C15, U16, and G19 hydrogen bond with Val1009, Tyr450, Arg447/Ile448, and Thr404, respectively.
A mutational analysis demonstrated that the R66A, R70A, and R74A mutations on the bridge helix markedly reduced the DNA cleavage activities, highlighting the functional significance of the recognition of the sgRNA “seed” region by the bridge helix. Although Arg78 and Arg165 also interact with the “seed” region, the R78A and R165A mutants showed only moderately decreased activities. These results are consistent with the fact that Arg66, Arg70, and Arg74 form multiple salt bridges with the sgRNA backbone, whereas Arg78 and Arg165 form a single salt bridge with the sgRNA backbone. Moreover, the alanine mutations of the repeat:anti-repeat duplex-interacting residues (Arg75 and Lys163) and the stemloop-1-interacting residue (Arg69) resulted in decreased DNA cleavage activity, confirming the functional importance of the recognition of the repeat:anti-repeat duplex and stem loop 1 by Cas9.
RNA-guided DNA targeting: SpCas9 recognizes the guide:target heteroduplex in a sequence-independent manner. The backbone phosphate groups of the target DNA (nucleotides 1, 9-11, 13, and 20) interact with the REC1 (Asn497, Trp659, Arg661, and Gln695), RuvC (Gln926), and PI (Glu1108) domains. The C2′ atoms of the target DNA (nucleotides 5, 7, 8, 11, 19, and 20) form van der Waals interactions with the REC1 domain (Leu169, Tyr450, Met495, Met694, and His698) and the RuvC domain (Ala728). The terminal base pair of the guide:target heteroduplex (G1:C20′) is recognized by the RuvC domain via end-capping interactions; the sgRNA G1 and target DNA C20′ nucleobases interact with the Tyr1013 and Val1015 side chains, respectively, whereas the 20-hydroxyl and phosphate groups of sgRNA G1 interact with Val1009 and Gln926, respectively.
Repeat:Anti-Repeat duplex recognition: The nucleobases of U23/A49 and A42/G43 hydrogen bond with the side chain of Arg1122 and the main-chain carbonyl group of Phe351, respectively. The nucleobase of the flipped U44 is sandwiched between Tyr325 and His328, with its N3 atom hydrogen bonded with Tyr325, whereas the nucleobase of the unpaired G43 stacks with Tyr359 and hydrogen bonds with Asp364.
The nucleobases of G21 and U50 in the G21:U50 wobble pair stack with the terminal C20:G10 pair in the guide:target heteroduplex and Tyr72 on the bridge helix, respectively, with the U50 O4 atom hydrogen bonded with Arg75. Notably, A51 adopts the syn conformation and is oriented in the direction opposite to U50. The nucleobase of A51 is sandwiched between Phe1105 and U63, with its N1, N6, and N7 atoms hydrogen bonded with G62, Gly1103, and Phe1105, respectively.
Stem-loop recognition: Stem loop 1 is primarily recognized by the REC lobe, together with the PI domain. The backbone phosphate groups of stem loop 1 (nucleotides 52, 53, and 59-61) interact with the REC1 domain (Leu455, Ser460, Arg467, Thr472, and Ile473), the PI domain (Lys1123 and Lys1124), and the bridge helix (Arg70 and Arg74), with the 20-hydroxyl group of G58 hydrogen bonded with Leu455. A52 interacts with Phe1105 through a face-to-edge p-p stacking interaction, and the flipped U59 nucleobase hydrogen bonds with Asn77.
The single-stranded linker and stem loops 2 and 3 are primarily recognized by the NUC lobe. The backbone phosphate groups of the linker (nucleotides 63-65 and 67) interact with the RuvC domain (Glu57, Lys742, and Lys1097), the PI domain (Thr1102), and the bridge helix (Arg69), with the 20-hydroxyl groups of U64 and A65 hydrogen bonded with Glu57 and His721, respectively. The C67 nucleobase forms two hydrogen bonds with Val1100.
Stem loop 2 is recognized by Cas9 via the interactions between the NUC lobe and the non-Watson-Crick A68:G81 pair, which is formed by direct (between the A68 N6 and G81 O6 atoms) and water-mediated (between the A68 N1 and G81 N1 atoms) hydrogen-bonding interactions. The A68 and G81 nucleobases contact Ser1351 and Tyr1356, respectively, whereas the A68:G81 pair interacts with Thr1358 via a water-mediated hydrogen bond. The 20-hydroxyl group of A68 hydrogen bonds with His1349, whereas the G81 nucleobase hydrogen bonds with Lys33.
Stem loop 3 interacts with the NUC lobe more extensively, as compared to stem loop 2. The backbone phosphate group of G92 interacts with the RuvC domain (Arg40 and Lys44), whereas the G89 and U90 nucleobases hydrogen bond with Gln1272 and Glu1225/Ala1227, respectively. The A88 and C91 nucleobases are recognized by Asn46 via multiple hydrogen-bonding interactions.
Cas9 proteins smaller than SpCas9 allow more efficient packaging of nucleic acids encoding CRISPR systems, e.g., Cas9 and sgRNA into one rAAV (“all-in-one-AAV”) particle. In addition, efficient packaging of CRISPR systems can be achieved in other viral vector systems (i.e., lentiviral, integration deficient lentiviral, hd-AAV, etc.) and non-viral vector systems (i.e., lipid nanoparticle). Small Cas9 proteins can be advantageous for multidomain-Cas-nuclease-based systems for prime editing. Well characterized smaller Cas9 proteins include Staphylococcus aureus (SauCas9, 1053 amino acid residues) and Campylobacter jejuni (CjCas9, 984 amino residues). However, both recognize longer PAMs, 5′-NNGRRT-3′ for SauCas9 (R=A or G) and 5′-NNNNRYAC-3′ for CjCas9 (Y=C or T), which reduces the number of uniquely addressable target sites in the genome, in comparison to the NGG SpCas9 PAM. Among smaller Cas9s, Schmidt et al. identified Staphylococcus lugdunensis (Slu) Cas9 as having genome-editing activity and provided homology mapping to SpCas9 and SauCas9 to facilitate generation of nickases and inactive (“dead”) enzymes (Schmidt et al., 2021, Improved CRISPR genome editing using small highly active and specific engineered RNA-guided nucleases. Nat Commun 12, 4219. doi.org/10.1038/s41467-021-24454-5) and engineered nucleases with higher cleavage activity by fragmenting and shuffling Cas9 DNAs. The small Cas9s and nickases are useful in the instant invention.
Besides dead Cas9 and Cas9 nickase variants, the Cas9 proteins used herein may also include other “Cas9 variants” having at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to any reference Cas9 protein, including any wild type Cas9, or mutant Cas9 (e.g., a dead Cas9 or Cas9 nickase), or fragment Cas9, or circular permutant Cas9, or other variant of Cas9 disclosed herein or known in the art. In some embodiments, a Cas9 variant may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acid changes compared to a reference Cas9. In some embodiments, the Cas9 variant comprises a fragment of a reference Cas9 (e.g., a gRNA binding domain or a DNA-cleavage domain), such that the fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the corresponding fragment of wild type Cas9. In some embodiments, the fragment is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% identical, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid length of a corresponding wild type Cas9 (e.g., SEQ ID NO: 18).
In some embodiments, the disclosure also may utilize Cas9 fragments that retain their functionality and that are fragments of any herein disclosed Cas9 protein. In some embodiments, the Cas9 fragment is at least 100 amino acids in length. In some embodiments, the fragment is at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, or at least 1300 amino acids in length.
In various embodiments, the prime editors disclosed herein may comprise one of the Cas9 variants described as follows, or a Cas9 variant thereof having at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to any reference Cas9 variants.
Streptococcus
pyogenes
Staphylococcus
aureus
Campylobacter
jejuni
Streptococcus
thermophilus
Parvibaculum
lavamentivorans
Corynebacterium
diphtheriae
Streptococcus
pasteurianus
Neisseria
cinerea
Campylobacter
lari Cas9
Sutterella
wadsworthensis
Legionella
pneumophila
Treponema
denticola
Filifactor
alocis
Staphylococcus
pseudintermedius
Lactobacillus
johnsonii
Mycoplasma
gallisepticum
Bergeyella
zoohelcum
Coprococcus
catus
Neisseria
meningitidis
Elusimicrobium
minutum
Treponema
Staphylococcus
lugdunensis
Streptococcus
thermophilus
Bacteroides
fragilis
Veillonella
atypica
Ilyobacter
polytropus
Parabacteroides
Fructobacillus
fructosus
Bacillus
smithii
Mycoplasma
canis PG
Odoribacter
laneus YIT
muciniphila
Dinoroseobacter
shibae
Wolinella
succinogenes
Parasutterella
excrementihominis
Streptococcus
sanguinis
Actinomyces
Rhodovulum
Bifidobacterium
bifidum
Barnesiella
intestinihominis
Aminomonas
paucivorans
Ralstonia
syzygii R24
Catenibacterium
mitsuokai
Mycoplasma
synoviae
Flavobacterium
branchiophilum
Eubacterium
yurii
Acidovorax
ebreus
Porphyromonas
Mycoplasma
ovipneumoniae
Wolinella
succinogenes
Streptococcus
mutans
Prevotella
timonensis
Clostridium
cellulolyticum
Francisella
tularensis
novicida
Azospirillum
Peptoniphilus
duerdenii
Lactobacillus
coryniformis
torquens
Ignavibacterium
album
Ruminococcus
albus 8
Lactobacillus
farciminis
Eubacterium
dolichum
Nitratifractor
salsuginis
Rhodospirillum
rubrum
Finegoldia
magna
Eubacterium
rectale
Corynebacterium
diphtheriae
Roseburia
inulinivorans
Alicycliphilus
denitrificans
Sphaerochaeta
lobosa
Fusobacterium
nucleatum
vincentii
Pasteurella
multocida
multocida
Alcanivorax
pacificus
Mycoplasma
mobile
Planococcus
antarcticus
Prevotella
Alicyclobacillus
hesperidum
Lactobacillus
rhamnosus
Enterococcus
faecalis
Candidatus
Puniceispirillum
marinum
Oenococcus
kitaharae
Helicobacter
mustelae
Bradyrhizobium
Acidaminococcus
Methylosinus
trichosporium
Actinomyces
coleocanis
Caenispirillum
salinarum
Coriobacterium
glomerans
In some embodiments, prime editors utilized herein comprise CRISPR-Cas system enzymes other than type II enzymes. In certain embodiments, prime editors comprise type V or type VI CRISPR-Cas system enzymes. It will be appreciated that certain CRISPR enzymes exhibit promiscuous ssDNA cleavage activity and appropriate precautions should be considered. In certain embodiments, prime editors comprise a nickase or a dead CRISPR with nuclease function comprised in a different component.
In various embodiments, the nucleic acid programmable DNA binding proteins utilized herein include, without limitation, Cas9 (e.g., dCas9 and nCas9), Cas12a (Cpf1), Cas12b1 (C2c1), Cas12b2, Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), C2c4, C2c5, C2c8, C2c9, C2c10, Cas13a (C2c2), Cas13b (C2c6), Cas13c (C2c7), Cas13d, and Argonaute. Cas-equivalents further include those described in Makarova et al., “C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector,” Science 2016; 353(6299) and Makarova et al., “Classification and Nomenclature of CRISPR-Cas Systems: Where from Here?,” The CRISPR Journal, Vol. 1. No. 5, 2018, the contents of which are incorporated herein by reference. One example of a nucleic acid programmable DNA-binding protein that has different PAM specificity than Cas9 is Clustered Regularly Interspaced Short Palindromic Repeats from Prevotella and Francisella 1 (i.e, Cas12a (Cpf1)). Similar to Cas9, Cas12a (Cpf1) is also a Class 2 CRISPR effector, but it is a member of type V subgroup of enzymes, rather than the type II subgroup. It has been shown that Cas12a (Cpf1) mediates robust DNA interference with features distinct from Cas9. Cas12a (Cpf1) is a single RNA-guided endonuclease lacking tracrRNA, and it utilizes a T-rich protospacer-adjacent motif (TTN, TTTN, or YTN). Moreover, Cpf1 cleaves DNA via a staggered DNA double-stranded break. Out of 16 Cpf1-family proteins, two enzymes from Acidaminococcus and Lachnospiraceae are shown to have efficient genome-editing activity in human cells. Cpf1 proteins are known in the art and have been described previously, for example Yamano et al., “Crystal structure of Cpf1 in complex with guide RNA and target DNA.” Cell (165) 2016, p. 949-962; the entire contents of which is hereby incorporated by reference.
In some embodiments, prime editors used herein comprise the type V CRISPR family includes Francisella novicida U112 Cpf1 (FnCpf1) also known as FnCas12a. FnCpf1 adopts a bilobed architecture with the two lobes connected by the wedge (WED) domain. The N-terminal REC lobe consists of two a-helical domains (REC1 and REC2) that have been shown to coordinate the crRNA-target DNA heteroduplex. The C-terminal NUC lobe consists of the C-terminal RuvC and Nuc domains involved in target cleavage, the arginine-rich bridge helix (BH), and the PAM-interacting (PI) domain. The repeat-derived segment of the crRNA forms a pseudoknot stabilized by intra-molecular base-pairing and hydrogen-bonding interactions. The pseudoknot is coordinated by residues from the WED, RuvC, and REC2 domains, as well as by two hydrated magnesium cations. Notably, nucleotides 1-5 of the crRNA are ordered in the central cavity of FnCas12a and adopt an A-form-like helical conformation. Conformational ordering of the seed sequence is facilitated by multiple interactions between the ribose and phosphate moieties of the crRNA backbone and FnCpf1 residues in the WED and REC1 domains. These include residues Thr16, Lys595, His804, and His881 from the WED domain and residues Tyr47, Lys51, Phe182, and Arg186 from the REC1 domain. The structure of the FnCas12a-crRNA complex further reveals that the bases of the seed sequence are solvent exposed and poised for hybridization with target DNA. Structural aspects of FnCpf1 are described by Swarts et al., Structural Basis for Guide RNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a, Molecular Cell 66, 221-233, Apr. 20, 2017.
Pre-crRNA processing: Essential residues for crRNA processing include His843, Lys852, and Lys869. Structural observations are consistent with an acid-base catalytic mechanism in which Lys869 acts as the general base catalyst to deprotonate the attacking 2′-hydroxyl group of U(−19), while His843 acts as a general acid to protonate the 5′-oxygen leaving group of A(−18). In turn, the side chain of Lys852 is involved in charge stabilization of the transition state. Collectively, these interactions facilitate the intra-molecular attack of the 20-hydroxyl group of U(−19) on the scissile phosphate and promote the formation of the 2′,3′-cyclic phosphate product.
R-loop formation: The crRNA-target DNA strand heteroduplex is enclosed in the central cavity formed by the REC and NUC lobes and interacts extensively with the REC1 and REC2 domains. The PAM-containing DNA duplex comprises target strand nucleotides dT0-dT8 and non-target strand nucleotides dA(8)*-dA0* and is contacted by the PI, WED, and REC1 domains. The 5′-TTN-3′ PAM is recognized in FnCas12a by a mechanism combining the shape-specific recognition of a narrowed minor groove, with base-specific recognition of the PAM bases by two invariant residues, Lys671 and Lys613. Directly downstream of the PAM, the duplex of the target DNA is disrupted by the side chain of residue Lys667, which is inserted between the DNA strands and forms a cation-n stacking interaction with the dA0-dT0* base pair. The phosphate group linking target strand residues dT(−1) and dT0 is coordinated by hydrogen-bonding interactions with the side chain of Lys823 and the backbone amide of Gly826. Target strand residue dT(−1) bends away from residue TO, allowing the target strand to interact with the seed sequence of the crRNA. The non-target strand nucleotides dT1*-dT5* interact with the Arg692-Ser702 loop in FnCas12a through hydrogen-bonding and ionic interactions between backbone phosphate groups and side chains of Arg692, Asn700, Ser702, and Gln704, as well as main-chain amide groups of Lys699, Asn700, and Ser702. Alanine substitution of Q704 or replacement of residues Thr698-Ser702 in FnCas12a with the sequence Ala-Gly3 (SEQ ID NO: 115) substantially reduced DNA cleavage activity, suggesting that these residues contribute to R-loop formation by stabilizing the displaced conformation of the nontarget DNA strand.
In the FnCas12a R-loop complex, the crRNA-target strand heteroduplex is terminated by a stacking interaction with a conserved aromatic residue (Tyr410). This prevents base pairing between the crRNA and the target strand beyond nucleotides U20 and dA(−20), respectively. Beyond this point, the target DNA strand nucleotides re-engage the non-target DNA strand, forming a PAM-distal DNA duplex comprising nucleotides dC(−21)-dA(−27) and dG21*-dT27*, respectively. The duplex is confined between the REC2 and Nuc domains at the end of the central channel formed by the REC and NUC lobes.
Target DNA cleavage: FnCpf1 can independently accommodate both the target and non-target DNA strands in the catalytic pocket of the RuvC domain. The RuvC active site contains three catalytic residues (D917, E1006, and D1255). Structural observations suggest that both the target and non-target DNA strands are cleaved by the same catalytic mechanism in a single active site in Cpf1/Cas12a enzymes.
Another type V CRISPR is AsCpf1 from Acidaminococcus sp BV3L6 (Yamano et al., Crystal structure of Cpf1 in complex with guide RNA and target DNA, Cell 165, 949-962, May 5, 2016)
In certain embodiments, the nuclease comprises a Cas12f effector. Small CRISPR-associated effector proteins belonging to the type V-F subtype have been identified through the mining of sequence databases and members classified into Cas12f1 (Cas14a and type V-U3), Cas12f2 (Cas14b) and Cas12f3 (Cas14c, type V-U2 and U4). (See, e.g., Karvelis et al., PAM recognition by miniature CRISPR-Cas12f nucleases triggers programmable double-stranded DNA target cleavage. Nucleic Acids Research, 21 May 2020, 48(9), 5016-23 doi.org/10.1093/nar/gkaa208). Xu et al. described development of a 529 amino acid Cas12f-based system for mammalian genome engineering through multiple rounds of iterative protein engineering and screening. (Xu, X. et al., Engineered Miniature CRISPR-Cas System for Mammalian Genome Regulation and Editing. Molecular Cell, Oct. 21, 2021, 81(20): 4333-45, doi.org/10.1016/j.molcel.2021.08.008).
Exemplary CRISPR-Cas proteins and enzymes used in the prime editors herein include the following without limitation.
Peregrinibacteria
bacterium
bacterium
bovoculi 237]
bovoculi]
bacterium
dextrinosolvens]
bacterium
disiens]
branchiophilum
kunzii]
tularensis]
tularensis]
tularensis]
tularensis subsp.
novicida U112]
Roizmanbacteria
bacterium
eligens CAG: 72]
ramulus]
brevis]
caprae]
inadai]
crevioricanis]
crevioricanis]
crevioricanis]
crevioricanis]
jonesii]
jonesii]
bryantii B14]
albensis]
bryantii B14]
macacae]
proteoclasticus]
Methanoplasma
termitum]
bacterium
bacterium
fibrisolvens]
bacterium
bacterium
bacterium
Methanomethylophilus
alvus]
bacterium
bacterium
bacterium
butyrivibrio
ruminis]
sphenisci]
sphenisci]
Eubacterium
rectale
Eubacterium
rectale
Eubacterium
rectale
Eubacterium sp.
Alicyclobacillus
macrosporangiidus
Bacillus hisashii
Candidatus
Lindowbacteria
Elusimicrobia
bacterium
Omnitrophica
Phycisphaerae
bacterium ST-
Planctomycetes
bacterium
Spirochaetes
bacterium
Verrucomicrobiaceae
bacterium
Alicyclobacillus
kakegawensis
Bacillus sp._
Desulfatirhabdium
butyrativorans
Desulfonatronum
thiodismutans
Lentisphaeria
bacterium
Laceyella
sediminis
Methylobacterium
nodulans
Opitutaceae
bacterium
Thermomonas
hydrothermalis
Methylobacterium
nodulans
Chloracidobacterium
thermophilum
Desulfovibrioinopinatus
Desulfonatronum
thiodismutans
Tuberibacillus
calidus
Bacillus
thermoamylovorans
Bacillus sp.
Alicyclobacillus
acidoterrestris
Alicyclobacillus
hesperidum
Alicyclobacillus
acidiphilus
Alicyclobacillus
macrosporangiidus
Sulfobacillus
thermosulfidooxidans
Spirochaeta sp.
Bacillus hisashii
As used herein, the term “protospacer adjacent sequence” or “protospacer adjacent motif” or “PAM” refers to an approximately 2-6 base pair DNA sequence (or a 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-long nucleotide sequence) that is an important targeting component of a Cas9 nuclease. Typically, the PAM sequence is on either strand, and is downstream in the 5′ to 3′ direction of Cas9 cut site. The canonical PAM sequence (i.e., the PAM sequence that is associated with the Cas9 nuclease of Streptococcus pyogenes or SpCas9) is 5′-NGG-3′ wherein “N” is any nucleobase followed by two guanine (“G”) nucleobases. Different PAM sequences can be associated with different Cas9 nucleases or equivalent proteins from different organisms. In addition, any given Cas9 nuclease may be modified to alter the PAM specificity of the nuclease such that the nuclease recognizes alternative PAM sequence.
For example, with reference to the canonical SpCas9 amino acid sequence, the PAM specificity can be modified by introducing one or more mutations, including (a) D1135V, R1335Q, and T1337R “the VQR variant”, which alters the PAM specificity to NGAN or NGNG, (b) D1135E, R1335Q, and T1337R “the EQR variant”, which alters the PAM specificity to NGAG, and (c) D1135V, G1218R, R1335E, and T1337R “the VRER variant”, which alters the PAM specificity to NGCG. In addition, the D1135E variant of canonical SpCas9 still recognizes NGG, but it is more selective compared to the wild type SpCas9 protein.
It will also be appreciated that Cas9 enzymes from different bacterial species (i.e., Cas9 orthologs) can have varying PAM specificities and some embodiments are therefore chosen based on the desired PAM recognition. For example, Cas9 from Staphylococcus aureus (SaCas9) recognizes NGRRT or NGRRN. In addition, Cas9 from Neisseria meningitis (NmCas) recognizes NNNNGATT. In another example, Cas9 from Streptococcus thermophilis (StCas9) recognizes NNAGAAW. In still another example, Cas9 from Treponema denticola (TdCas) recognizes NAAAAC. These examples are not meant to be limiting. It will be further appreciated that non-SpCas9s bind a variety of PAM sequences, which makes them useful to expand the range of sequences that can be targeted according to the invention. Furthermore, non-SpCas9s may have other characteristics that make them more useful than SpCas9. For example, Cas9 from Staphylococcus aureus (SaCas9) is about 1 kilobase smaller than SpCas9, so it can be packaged into adeno-associated virus (AAV). Further reference may be made to Shah et al., “Protospacer recognition motifs: mixed identities and functional diversity,” RNA Biology, 10(5): 891-899 (which is incorporated herein by reference). Gasiunas used cell-free biochemical screens to identify protospacer adjacent motif (PAM) and guide RNA requirements of 79 Cas9 proteins. (Gasiunas et al., A catalogue of biochemically diverse CRISPR-Cas9 orthologs, Nature Communications 11:5512 doi.org/10.1038/s41467-020-19344-1) The authors described 7 classes of gRNA and 50 different PAM requirement.
Oh, Y. et al. describe linking reverse transcriptase to a Francisella novicida Cas9 [FnCas9(H969A)] nickase module. (Oh, Y. et al., Expansion of the prime editing modality with Cas9 from Francisella novicida, bioRxiv 2021.05.25.445577; doi.org/10.1101/2021.05.25.445577). By increasing the distance to the PAM, the FnCas9(H969A) nickase module expands the region of a reverse transcription template (RTT) following the primer binding site.
“Prime editor fusion protein” describes a protein that is used in prime editing. Prime editing uses CRISPR enzyme that nicks or cuts only single strand of double stranded DNA, i.e., a nickase; and a nickase can occur either naturally or by mutation or modification of a nuclease that makes double stranded cuts. Such an enzyme can be a catalytically-impaired Cas9 endonuclease (a nickase). Such an enzyme can be a Cas12a/b, MAD7, or variant thereof. The nickase is fused to an engineered reverse transcriptase (RT). The nickase is programmed (directed) with a prime-editing guide RNA (pegRNA). The skilled person in the art would appreciate that the pegRNA both specifies the target site and encodes the desired edit. Advantageously the nickase is a catalytically-impaired Cas9 endonuclease, a Cas9 nickase, that is fused to the reverse transcriptase. During genetic editing, the Cas9 nickase part of the protein is guided to the DNA target site by the pegRNA, whereby a nick or single stranded cut occurs. The reverse transcriptase domain then uses the pegRNA to template reverse transcription of the desired edit, directly polymerizing DNA onto the nicked target DNA strand. The edited DNA strand replaces the original DNA strand, creating a heteroduplex containing one edited strand and one unedited strand. Afterward, optionally, the prime editor (PE) guides resolution of the heteroduplex to favor copying the edit onto the unedited strand, completing the process (typically achieved with a nickase gRNA).
As used herein, “PE1” refers to a PE complex comprising a fusion protein comprising Cas9(H840A) and a wild type MMLV RT having the following N-terminus to C-terminus structure: [NLS]-[Cas9(H840A)]-[linker]-[MMLV_RT(wt)]+a desired atgRNA (or PEgRNA). In various embodiments, the prime editors disclosed herein is comprised of PE1.
As used herein, “PE2” refers to a PE complex comprising a fusion protein comprising Cas9(H840A) and a variant MMLV RT having the following N-terminus to C-terminus structure:
[NLS]-[Cas9(H840A)]-[linker]-[MMLV_RT(D200N)(T330P)(L603W)(T306K)(W313F)]+a desired atgRNA (or PEgRNA). In various embodiments, the prime editors disclosed herein are comprised of PE2. In various embodiments, the prime editors disclosed herein is comprised of PE2 and co-expression of MMR protein MLH1dn, that is PE4.
As used herein, “PE3” refers to PE2 plus a second-strand nicking guide RNA that complexes with the PE2 and introduces a nick in the non-edited DNA strand. The induction of the second nick increases the chances of the unedited strand, rather than the edited strand, to be repaired. In various embodiments, the prime editors disclosed herein are comprised of PE3. In various embodiments, the prime editors disclosed herein are comprised of PE3 and co-expression of MMR protein MLH1dn, that is PE5.
As used herein, “PE3b” refers to PE3 but wherein the second-strand nicking guide RNA is designed for temporal control such that the second strand nick is not introduced until after the installation of the desired edit. This is achieved by designing a gRNA with a spacer sequence with mismatches to the unedited original allele that matches only the edited strand. Using this strategy, mismatches between the protospacer and the unedited allele should disfavor nicking by the sgRNA until after the editing event on the PAM strand takes place.
Anzalone et al., 2019 (Nature 576:149) describes prime editing and a prime editing complex using a type II CRISPR and can be used herein. A prime editing complex consists of a type II CRISPR PE protein containing an RNA-guided DNA-nicking domain fused to a reverse transcriptase (RT) domain and complexed with a pegRNA. The pegRNA comprises (5′ to 3′) a spacer that is complementary to the target sequence of a genomic DNA, a nickase (e.g. Cas9) binding site, a reverse transcriptase template including editing positions, and primer binding site (PBS). The PE-pegRNA complex binds the target DNA and the CRISPR protein nicks the PAM-containing strand. The resulting 3′ end of the nicked target hybridizes to the primer-binding site (PBS) of the pegRNA, then primes reverse transcription of new DNA containing the desired edit using the RT template of the pegRNA. The overall structure of the pegRNA is like that of a typical type II sgRNA with a reverse transcriptase template/primer binding site appended to the 3′ end. The structure leaves the PBS at the 3′ end of the pegRNA free to bind to the nicked strand complementary to the target which forms the primer for reverse transcription.
Guide RNAs of CRISPRs differ in overall structure. For example, while the spacer of a type II gRNA is located at the 5′ end, the spacer of a type V gRNA is located towards the 3′ end, with the CRISPR protein (e.g. Cas12a) binding region located toward the 5′ end. Accordingly, the regions of a type V pegRNA are rearranged compared to a type II pegRNA. The overall structure of the pegRNA is like that of a typical type II sgRNA with a reverse transcriptase template/primer binding site appended to the 3′ end. The pegRNA comprises (5′ to 3′) a CRISPR protein-binding region, a spacer which is complementary to the target sequence of a genomic DNA, a reverse transcriptase template including editing positions, and primer binding site (PBS).
In typical embodiments, an atgRNA comprises a reverse transcriptase template that encodes, partially or in its entirety, an integration recognition site (also referred to as an integration target recognition site) or a recombinase recognition site (also referred to as a recombinase target recognition site). The integration target recognition site, which is to be placed at a desired location in the genome or intracellular nucleic acid, is referred to as a “beacon” site or an “attachment site” or a “landing pad” or “landing site.” An integration target recognition site or recombinase target recognition site incorporated into the pegRNA is referred to as an attachment site containing guide RNA (atgRNA).
As used herein, the term “attachment site-containing guide RNA” (atgRNA) and the like refer to an extended single guide RNA (sgRNA) comprising a primer binding site (PBS), a reverse transcriptase (RT) template sequence, and wherein the RT template encodes for an integration recognition site or a recombinase recognition site that can be recognized by a recombinase, integrase, or transposase. In some embodiments, the RT template comprises a clamp sequence and an integration recognition site. As referred to herein an atgRNA may be referred to as a guide RNA. An integration recognition site or recombinase target recognition site incorporated into the pegRNA is referred to as an attachment site containing guide RNA (atgRNA).
As used herein, the term “cognate integration recognition site” or “integration cognate” or “cognate pair” refers to a first integration recognition site (e.g., any of the integration recognition sites described herein) and a second integration recognition site (e.g., any of the integration recognition sites described herein) that can be recombined. Recombination between a first integration recognition site (e.g., any of the integration recognition sites described herein) and a second recognition site (e.g., any of the integration recognition sites described herein) is mediated by functional symmetry between the two integration recognition sites and the central dinucleotide of each of the two integration recognition sites. In some cases, a first integration recognition site (e.g., any of the integration recognition sites described herein) that can be recombined with a second integration recognition site (e.g., any of the integration recognition sites described herein) are referred to as a “cognate pair.” A non-limiting example of a cognate pair include an attB site and an attP site, whereby a serine integrase mediates recombination between the attB site and the attP site.
In typical embodiments, an atgRNA comprises a reverse transcriptase template that encodes, partially or in its entirety, an integration recognition site (also referred to as an integration target recognition site) or a recombinase recognition site (also referred to as a recombinase target recognition site). The integration target recognition site, which is to be placed at a desired location in the genome or intracellular nucleic acid, is referred to as a “beacon,” a “beacon” site or an “attachment site” or a “landing pad” or “landing site.” An integration target recognition site or recombinase target recognition site incorporated into the pegRNA is referred to as an attachment site containing guide RNA (atgRNA).
During genome editing, the primer binding site allows the 3′ end of the nicked DNA strand to hybridize to the atgRNA, while the RT template serves as a template for the synthesis of edited genetic information. The atgRNA is capable for instance, without limitation, of (i) identifying the target nucleotide sequence to be edited and (ii) encoding new genetic information that replaces (or in some cases adds) the targeted sequence. In some embodiments, the atgRNA is capable of (i) identifying the target nucleotide sequence to be edited and (ii) encoding an integration site that replaces (or inserts/deletes within) the targeted sequences.
In some embodiments, the co-delivery system described herein includes a polynucleotide sequence encoding an attachment site-containing guide RNA (atgRNA) packaged in an LNP. In some embodiments, the co-delivery system described herein includes a vector comprising a polynucleotide sequence encoding an atgRNA. In some embodiments, the atgRNA comprises a domain that is capable of guiding the prime editor fusion protein to a target sequence, thereby identifying the target nucleotide sequence to be edited; and a reverse transcriptase (RT) template that comprises a first integration recognition site. In some embodiments, the atgRNA comprises a domain that is capable of guiding the prime editor fusion protein (or prime editor system) to a target sequence, thereby identifying the target nucleotide sequence to be edited; and a reverse transcriptase (RT) template that comprises at least a portion first integration recognition site.
In some embodiments, the co-delivery system described herein includes a polynucleotide sequence encoding a first attachment site-containing guide RNA (atgRNA) and a polynucleotide nucleotide sequence encoding a second attachment site-containing guide RNA (atgRNA) packaged into the same LNP. In some embodiments, the co-delivery system described herein includes a polynucleotide sequence encoding a first attachment site-containing guide RNA (atgRNA) packaged into a first LNP and a polynucleotide nucleotide sequence encoding a second attachment site-containing guide RNA (atgRNA) packaged into a second LNP.
In some embodiments, the co-delivery system described herein includes a vector comprising a polynucleotide sequence encoding a first attachment site-containing guide RNA (atgRNA), a polynucleotide sequence encoding a second atgRNA, or both.
In some embodiments, the co-delivery system described herein includes a polynucleotide sequence encoding a first attachment site-containing guide RNA (atgRNA) packaged into a first LNP and a vector comprising a polynucleotide sequence encoding a second atgRNA.
In some embodiments, where the co-delivery system contains a first atgRNA and a second atgRNA, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, where the at least first pair of atgRNAs have domains that are capable of guiding the gene editor protein or prime editor fusion protein to a target sequence, the first atgRNA further includes a first RT template that comprises at least a portion of the first integration recognition site; and the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site.
In some embodiments, the first atgRNA's reverse transcriptase template encodes for a first single-stranded DNA sequence (i.e., a first DNA flap) that contains a complementary region to a second single-stranded DNA sequence (i.e., a second DNA flap) encoded by a second atgRNA comprising a second reverse transcriptase template. In certain embodiments, the complementary region between the first and second single-stranded DNA sequences is comprised of more than 5 consecutive bases of an integrase target recognition site. In certain embodiments, the complementary region between the first and second single-stranded DNA sequences is comprised of more than 10 consecutive bases of an integrase target recognition site. In certain embodiments, the complementary region between the first and second single-stranded DNA sequences is comprised of more than 20 consecutive bases of an integrase target recognition site. In certain embodiments, the complementary region between the first and second single-stranded DNA sequences is comprised of more than 30 consecutive bases of an integrase target recognition site. Use of two guide RNAs that are (or encode DNA that is) partially complementarity to each other and comprised of consecutive bases of an integrase target recognition site are referred to as dual, paired, annealing, complementary, or twin attachment site-containing guide RNAs (atgRNAs). In certain embodiments, use of two guide RNAs that are (or encode DNA that is) full complementarity to each other and comprised of consecutive bases of an integrase target recognition site are referred to as dual, paired, annealing, complementary, or twin attachment site-containing guide RNAs (atgRNAs).
In some embodiments, upon introducing the nucleic acid construct into a cell, the first atgRNA incorporates the first integration recognition site into the cell's genome at the target sequence.
Table 9 includes atgRNAs, sgRNAs and nicking guides that can be used herein. Spacers are labeled in capital font (SPACER), RT regions in bold capital (RT REGION), AttB sites in bold lower case (attB site), and PBS in capital italics (PBS). Unless otherwise denoted, the AttB is for Bxb1.
ATCATCATCCATGGccggatgatcctgacgacggagaccgccgtcgtcgacaa
gccggcc
TGAGCTGCGAGAA
GGCGATATCATCATCCATGGccggatgatcctgacgacggagaccgccgt
cgtcgacaagccggcc
TGAGCTGCGA GAA
AGCGCGGCGATATCATCATCCATGGcacaattaacatctcaatcaag
gtaaa
TGCTTGAGCTGCGAGAA
AGCGCGGCGATATCATCATCCATGGagcatttaccttgattgagatgt
taattgtg
TGAGCTGCGAGAA
AGCGCGGCGATATCATCATCCATGGcaggtttttgacgaaagtgatc
cagatgatccag
TGAGCTGCGAGAA
AGCGCGGCGATATCATCATCCATGGctggatcatctggatcactttcg
tcaaaaacctg
TGAGCTGCGAGAA
Gtaccgttcgtatagcatacattatacgaagttat
TGAGCTGCGAGAATAGCC
TATCATCATCCATGGtaccgttcgtatagcatacattatacgaagttat
TGAG
CTGCGAGAA
GCGATATCATCATCCATGGccggatgatcctgacgacggagaccgccgtc
gtcgacaagccggcc
TGAGCTGCGAGAA
ATCATCCATGGccggatgatcctgacgacggagaccgccgtcgtcgacaagccgg
cc
TGAGCTGCGAGAA
ATCCATGGccggatgatcctgacgacggagaccgccgtcgtcgacaagccggcc
T
GAGCTGCGAGAA
CATGGccggatgatcctgacgacggagaccgccgtcgtcgacaagccggcc
TGAGC
TGCGAGAA
Gccggatgatcctgacgacggagaccgccgtcgtcgacaagccggcc
TGAGCTGCG
AGAA
GCGATATCATCATCCATGGccggatgatcctgacgacggagaccgccgtc
gtcgacaagccggcc
TGAGCTGCGAGAATAGCC
ATCATCATCCATGGccggatgatcctgacgacggagaccgccgtcgtcgacaa
gccggcc
TGAGCTGCGAGAATAGCC
Gccggatgatcctgacgacggagaccgccgtcgtcgacaagccggcc
TGAGCTGCG
AGAATAGCC
GGCACGGGGGTCGCAGTCGCCATGccggatgatcctgacgacggag
accgccgtcgtcgacaagccggcc
CGGGCGGCGGAGA
GGGGGTCGCAGTCGCCATGccggatgatcctgacgacggagaccgccgt
cgtcgacaagccggcc
CGGGCGGCGGAGA
GTCGCAGTCGCCATGccggatgatcctgacgacggagaccgccgtcgtcgac
aagccggcc
CGGGCGGCGGAGA
AGTCGCCATGccggatgatcctgacgacggagaccgccgtcgtcgacaagccggc
c
CGGGCGGCGGAGA
CCATGccggatgatcctgacgacggagaccgccgtcgtcgacaagccggcc
CGGG
CGGCGGAGA
GGCACGGGGGTCGCAGTCGCCATGccggatgatcctgacgacggag
accgccgtcgtcgacaagccggcc
CGGGCGGCGGAGACAGCG
GGGGGTCGCAGTCGCCATGccggatgatcctgacgacggagaccgccgt
cgtcgacaagccggcc
CGGGCGGCGGAGACAGCG
GTCGCAGTCGCCATGccggatgatcctgacgacggagaccgccgtcgtcgac
aagccggcc
CGGGCGGCGGAGACAGCG
AGTCGCCATGccggatgatcctgacgacggagaccgccgtcgtcgacaagccggc
c
CGGGCGGCGGAGACAGCG
CCATGccggatgatcctgacgacggagaccgccgtcgtcgacaagccggcc
CGGG
CGGCGGAGACAGCG
ATCATCATCCATGGggatgatcctgacgacggagaccgccgtcgtcgacaagc
cgg
TGAGCTGCGAGAA
ATCATCATCCATGGgatgatcctgacgacggagaccgccgtcgtcgacaagcc
g
TGAGCTGCGAGAA
ATCATCATCCATGGatgatcctgacgacggagaccgccgtcgtcgacaagcc
T
GAGCTGCGAGAA
ATCATCATCCATGGtgatcctgacgacggagaccgccgtcgtcgacaagc
TG
AGCTGCGAGAA
GTCGCAGTCGCCATGcggatgatcctgacgacggagaccgccgtcgtcgaca
agccggc
CGGGCGGCGGAGA
GTCGCAGTCGCCATGggatgatcctgacgacggagaccgccgtcgtcgacaa
gccgg
CGGGCGGCGGAGA
GTCGCAGTCGCCATGgatgatcctgacgacggagaccgccgtcgtcgacaag
ccg
CGGGCGGCGGAGA
GTCGCAGTCGCCATGatgatcctgacgacggagaccgccgtcgtcgacaagc
c
CGGGCGGCGGAGA
ATGCCGGCGTCCGCCccggatgatcctgacgacggagaccgccgtcgtcgac
aagccggcc
TCCTCCAGGCAATACGCG
ATGCCGGCGTCCGCCccggatgatcctgacgacggagaccgccgtcgtcgac
aagccggcc
TCCTCCAGGCAAT
ATGCCGGCGTCCGCCcggatgatcctgacgacggagaccgccgtcgtcgaca
agccggc
TCCTCCAGGCAAT
ATGCCGGCGTCCGCCggatgatcctgacgacggagaccgccgtcgtcgacaa
gccgg
TCCTCCAGGCAAT
ATGCCGGCGTCCGCCgatgatcctgacgacggagaccgccgtcgtcgacaag
ccg
TCCTCCAGGCAAT
ATGCCGGCGTCCGCCatgatcctgacgacggagaccgccgtcgtcgacaagc
c
TCCTCCAGGCAAT
CATGGatgatcctgacgacggagaccgccgtcgtcgacaagcc
TGAGCTGCGA
GAA
tgatcctgacgacggagaccgccgtcgtcgacaagcc
TGAGCTGCGAGAA
acgacggagaccgccgtcgtcgacaagcc
TGAGCTGCGAGAA
CATGGatgatcctgacgacggagaccgccgtcgtcgacaagcc
TGAGCTGCG
tgatcctgacgacggagaccgccgtcgtcgacaagcc
TGAGCTGCG
acgacggagaccgccgtcgtcgacaagcc
TGAGCTGCG
GCCATGatgatcctgacgacggagaccgccgtcgtcgacaagcc
CGGGCGGCG
GAGA
atgatcctgacgacggagaccgccgtcgtcgacaagcc
CGGGCGGCGGAGA
gacgacggagaccgccgtcgtcgacaagcc
CGGGCGGCGGAGA
GCCATGatgatcctgacgacggagaccgccgtcgtcgacaagcc
CGGGCGGCG
atgatcctgacgacggagaccgccgtcgtcgacaagcc
CGGGCGGCG
gacgacggagaccgccgtcgtcgacaagcc
CGGGCGGCG
CACAGCCATAccggatgatcctgacgacggagaccgccgtcgtcgacaagccggc
c
CCCCGGACGCCGC
GATCCCGTTGccggatgatcctgacgacggagaccgccgtcgtcgacaagccggc
c
TACATGGCCCCGT
TGGCACCATAccggatgatcctgacgacggagaccgccgtcgtcgacaagccggc
c
CCCCGCCCCACCTGACAC
ATGCAGCCCTCCATCccggatgatcctgacgacggagaccgccgtcgtcgaca
agccggcc
TGCTCGTCTGACC
ATCATCATCCATGGccggatgatcctgacgacggag
XX
cgccgtcgtcgaca
agccggcc
TGAGCTGCGAGAA
XX
: CG, GC, AT, TA, GG, TT, GA, AG, CC, TC, CT, AA, TG, GT, CA, AC
ATCATCATCCATGccggatgatcctgacgacggagACcgccgtcgtcgacaag
ccggcc
TGAGCTGCGAGAA
ATCATCATCCATGccggatgatcctgacgacggagAGcgccgtcgtcgacaag
ccggcc
TGAGCTGCGAGAA
ATGCCGGCGTCCGCCccggatgatcctgacgacggagTCcgccgtcgtcga
caagccggcc
TCCTCCAGGCAATACGCG
GTCGCAGTCGCCATGccggatgatcctgacgacggagCTcgccgtcgtcga
caagccggcc
CGGGCGGCGGAGACAGCG
ATCATCATCCATGGctatgccggatgatcctgacgacggagtccgccgtcgtcg
acaagccggccctagc
TGAGCTGCGAGAA
ATCATCATCCATGGtgccggatgatcctgacgacggagtccgccgtcgtcgaca
agccggcccta
TGAGCTGCGAGAA
ATCATCATCCATGGccggatgatcctgacgacggagtccgccgtcgtcgacaa
gccggcc
TGAGCTGCGAGAA
TCATCATCCATGGggatgatcctgacgacggagtccgccgtcgtcgacaagccg
T
GAGCTGCGAGAA
ATCATCATCCATGGtgatcctgacgacggagtccgccgtcgtcgacaagc
TGA
GCTGCGAGAA
ATCATCATCCATGGatcctgacgacggagtccgccgtcgtcgaca
TGAGCT
GCGAGAA
ATCATCATCCATGGcctgacgacggagtccgccgtcgtcg
TGAGCTGCG
AGAA
TCATCATCCATGGtgacgacggagtccgccgtcg
TGAGCTGCGAGAA
ATCATCATCCATGGacgacggagtccgccg
TGAGCTGCGAGAA
ATCATCATCCATGGgacggagtccg
TGAGCTGCGAGAA
ATCATCATCCATGGcggagt
TGAGCTGCGAGAA
GGCGATATCATCATCCATGGtaccgttcgtatagcatacattatacgaagt
tat
TGAGCTGCGAGAATAGCC
TATCATCATCCATGGtaccgttcgtatagcatacattatacgaagttat
TGAG
CTGCGAGAATAGCC
GGCGATATCATCATCCATGGtaccgttcgtatagcatacattatacgaagt
tat
TGAGCTGCGAGAA
Gtaccgttcgtatagcatacattatacgaagttat
TGAGCTGCGAGAA
ATCATCATCCATGGcattatatgttcttacagtatggcggcccggattgtaaaaa
catataatg
TGAGCTGCGAGAA
ATCATCATCCATGGcgttatagggtattacagtatggcggtcggtactgcaatac
cctataacg
TGAGCTGCGAGAA
ATCATCATCCATGGtgtatcattttcatatagttagcacctgcacactatatgaaa
atgataca
TGAGCTGCGAGAA
ATCATCATCCATGGtgtctactatctgtatatgcgacacatgtggcataaagaca
tagtagaca
TGAGCTGCGAGAA
ATCATCATCCATGGcatcgaccctgacgcatgcggaggcggcgctccatgcgtc
tgacctcatt
TGAGCTGCGAGAA
ATCATCATCCATGGgttagtacccaaatgacaaaaggtcatccttttatcatttgg
gtactaac
TGAGCTGCGAGAA
ATCATCATCCATGGcttattaaaacccgttccgcttctgtcaaagcggcatcggtt
ttataaac
TGAGCTGCGAGAA
ATCATCATCCATGGggcgtgatggtcgtgaacctcaacatgacgacgaacacg
acctcgcggcc
TGAGCTGCGAGAA
ATCATCATCCATGGtctacatcttgaatatatcaagttataactttgaattatatca
gtttata
TGAGCTGCGAGAA
ATCATCATCCATGGaattatatctaaaagcactaagctccgccatactgctttta
gatataata
TGAGCTGCGAGAA
ATCATCATCCATGGgatatggggaagtgaatcagtacaaccgccacagtacc
T
Bacillus_cereus_
GAGCTGCGAGAA
ATCATCATCCATGGggtactgtggcggttgtactgattcacttccccatatc
TGA
Bacillus_cereus_
GCTGCGAGAA
ATCATCATCCATGGtgggtggtacaggtgccacattagttgtaccatttatg
TG
Staphylococcus_
AGCTGCGAGAA
lugdunensis_
ATCATCATCCATGGcataaatggtacaactaatgtggcacctgtaccaccca
T
Staphylococcus_
GAGCTGCGAGAA
lugdunensis_
ATCATCATCCATGGgttgtttttccagatccagttggtcctgtaaatataag
TGA
Bacillus_
GCTGCGAGAA
cytotoxicus_
ATCATCATCCATGGcttatatttacaggaccaactggatctggaaaaacaac
T
Bacillus_
GAGCTGCGAGAA
cytotoxicus_
ATCATCATCCATGGgtactgtggcggttgtactgattcacttccccatat
TGAG
Bacillus_cereus_
CTGCGAGAA
ATCATCATCCATGGtactgtggcggttgtactgattcacttccccata
TGAGC
Bacillus_cereus_
TGCGAGAA
ATCATCATCCATGGactgtggcggttgtactgattcacttccccat
TGAGCTG
Bacillus_cereus_
CGAGAA
ATCATCATCCATGGatatggggaagtgaatcagtacaaccgccacagtac
TG
Bacillus_cereus_
AGCTGCGAGAA
ATCATCATCCATGGtatggggaagtgaatcagtacaaccgccacagta
TGAG
Bacillus_cereus_
CTGCGAGAA
ATCATCATCCATGGatggggaagtgaatcagtacaaccgccacagt
TGAGC
Bacillus_cereus_
TGCGAGAA
ATCATCATCCATGGataaatggtacaactaatgtggcacctgtaccaccc
TGA
Staphylococcus_
GCTGCGAGAA
lugdunensis_
ATCATCATCCATGGtaaatggtacaactaatgtggcacctgtaccacc
TGAG
Staphylococcus_
CTGCGAGAA
lugdunensis_
ATCATCATCCATGGaaatggtacaactaatgtggcacctgtaccac
TGAGCT
Staphylococcus_
GCGAGAA
lugdunensis_
ATCATCATCCATGGgggtggtacaggtgccacattagttgtaccatttat
TGA
Staphylococcus_
GCTGCGAGAA
lugdunensis_
ATCATCATCCATGGggtggtacaggtgccacattagttgtaccattta
TGAGC
Staphylococcus_
TGCGAGAA
lugdunensis_
ATCATCATCCATGGgtggtacaggtgccacattagttgtaccattt
TGAGCT
Staphylococcus_
GCGAGAA
lugdunensis_
ATCATCATCCATGGttatatttacaggaccaactggatctggaaaaacaa
TGA
Bacillus_
GCTGCGAGAA
cytotoxicus_NVH_
ATCATCATCCATGGtatatttacaggaccaactggatctggaaaaaca
TGAG
CTGCGAGAA
ATCATCATCCATGGatatttacaggaccaactggatctggaaaaac
TGAGC
TGCGAGAA
ATCATCATCCATGGttgtttttccagatccagttggtcctgtaaatataa
TGAG
CTGCGAGAA
ATCATCATCCATGGtgtttttccagatccagttggtcctgtaaatata
TGAGCT
GCGAGAA
ATCATCATCCATGGgtttttccagatccagttggtcctgtaaatat
TGAGCTG
CGAGAA
aagtgaatcagtacaaccgccacagtac
CGGGCGGCG
ATGCCGGCGTCCGCCatatggggaagtgaatcagtacaaccgccacagtac
T
CCTCCAGGCAATACGCG
Bacillus_cereus_
CACAGCCATAatatggggaagtgaatcagtacaaccgccacagtac
CCCCGG
ACGCCGC
Bacillus_cereus_
GATCCCGTTGatatggggaagtgaatcagtacaaccgccacagtac
TACATGG
CCCCGT
Bacillus_cereus_
TGGCACCATAatatggggaagtgaatcagtacaaccgccacagtac
CCCCGC
CCCACCTGACAC
Bacillus_cereus_
ATGCAGCCCTCCATCatatggggaagtgaatcagtacaaccgccacagtac
T
GCTCGTCTGACC
B. cereus_
tggggaagtgaatcagtacaaccgccacagtac
CGGGCGGCG
B. cereus_
GA
B. cereus_
GTCGCAGTCGCCATGatatggggaagtgaatcagtacaaccgccacagtac
C
GGGCGGCGGAGA
B. cereus_
TCCAGGCAAT
B. cereus_
TCCGCCatatggggaagtgaatcagtacaaccgccacagtac
TCCTCCAGGCA
AT
TCCGCCatatggggaagtgaatcagtacaaccgccacagtac
TCCTCCAGGCA
ATACGCG
GATCCCGTTGatatggggaagtgaatcagtacaaccgccacagtac
TACATGG
CC
gaagtgaatcagtacaaccgccacagtac
TACATGGCC
gaagtgaatcagtacaaccgccacagtac
TACATGGCCCCGT
In typical embodiments, the co-delivery system described herein contains an integrase and/or a recombinase. In some embodiments, the co-delivery system includes an integrase and/or a recombinase packaged in a LNP. In one embodiment, the co-delivery system includes a polynucleotide encoding an integrase and/or a recombinase. In some embodiments, the co-delivery system includes an integrase or a recombinase packaged in a vector (e.g., a viral vector). In some embodiments, the co-delivery system includes at least a first integrase (e.g., a first integrase and a second integrase) and/or at least a first recombinase (e.g., a first recombinase and a second recombinase).
In some embodiments, the integration enzyme (e.g., the integrase or recombinase) is selected from the group consisting of Dre, Vika, Bxb1, φC31, RDF, φBT1, R1, R2, R3, R4, R5, TP901-1, A118, φFC1, φC1, MR11, TG1, φ370.1, Wβ, BL3, SPBc, K38, Peaches, Veracruz, Rebeuca, Theia, Benedict, KSSJEB, PattyP, Doom, Scowl, Lockley, Switzer, Bob3, Troube, Abrogate, Anglerfish, Sarfire, SkiPole, ConceptII, Museum, Severus, Airmid, Benedict, Hinder, ICleared, Sheen, Mundrea, BxZ2, φRV, retrotransposases encoded by a Tc1/mariner family member including but not limited to retrotransposases encoded by LI, Tol2, Tel, Tc3, Himar 1 (isolated from the horn fly, Haematobia irritans), Mos1 (Mosaic element of Drosophila mauritiana), and Minos, and any mutants thereof. As can be used herein, Xu et al describes methods for evaluating integrase activity in E. coli and mammalian cells and confirmed at least R4, φC31, φBT1, Bxb1, SPBc, TP901-1 and Wβ integrases to be active on substrates integrated into the genome of HT1080 cells (Xu et al., 2013, Accuracy and efficiency define Bxb1 integrase as the best of fifteen candidate serine recombinases for the integration of DNA into the human genome. BMC Biotechnol. 2013 Oct. 20; 13:87. doi: 10.1186/1472-6750-13-87). Durrant describes new large serine recombinases (LSRs) divided into three classes distinguished from one another by efficiency and specificity, including landing pad LSRs which outperform wild-type Bxb1 in episomal and chromosomal integration efficiency, LSRs that achieve both efficient and site-specific integration without a landing pad, and multi-targeting LSRs with minimal site-specificity. Additionally, embodiments can include any serine recombinase such as BceINT, SSCINT, SACINT, and INT10 (see Ionnidi et al., 2021; Drag-and-drop genome insertion without DNA cleavage with CRISPR directed integrases. bioRxiv 2021.11.01.466786, doi.org/10.1101/2021.11.01.466786). In some embodiments, the integration site can be selected from an attB site, an attP site, an attL site, an attR site, a lox71 site a Vox site, or a FRT site.
It will be appreciated that desired activity of integrases, transposases and the like can depend on nuclear localization. In certain embodiments, prokaryotic enzymes are adapted to modulate nuclear localization. In certain embodiments, eukaryotic or vertebrate enzymes are adapted to modulate nuclear localization. In certain embodiments, the invention provides fusion or hybrid proteins. Such modulation can comprise addition or removal of one or more nuclear localization signal (NLS) and/or addition or removal of one or more nuclear export signal (NES). Xu et al compared derivatives of fourteen serine integrases that either possess or lack a nuclear localization signal (NLS) to conclude that certain integrases benefit from addition of an NLS whereas others are transported efficiently without addition, and a major determinant of activity in yeast and vertebrate cells is avoidance of toxicity. (Xu et al., 2016, Comparison and optimization of ten phage encoded serine integrases for genome engineering in Saccharomyces cerevisiae. BMC Biotechnol. 2016 Feb. 9; 16:13. doi: 10.1186/s12896-016-0241-5). Ramakrishnan et al. systematically studied the effect of different NES mutants developed from mariner-like elements (MLEs) on transposase localization and activity and concluded that nuclear export provides a means of controlling transposition activity and maintaining genome integrity. (Ramakrishnan et al. Nuclear export signal (NES) of transposases affects the transposition activity of mariner-like elements Ppmar1 and Ppmar2 of moso bamboo. Mob DNA. 2019 Aug. 19; 10:35. doi:10.1186/s13100-019-0179-y). The methods and constructs are used to modulate nuclear localization of system components of the invention.
In typical embodiments, the integrase used herein is selected from below (Table 10).
Mycobacterium
phage
Lactococcus
phage
Streptomyces
Bacillus
cereus
Bacillus
cytotoxicus
Staphylococcus
lugdunensis
Sequences of insertion sites (i.e., recognition target sites) suitable for use in embodiments of the disclosure are presented below (Table 11).
Bacillus_
cereus_
Staphylococcus_
lugdunensis_
Bacillus_
cytotoxicus_
Bacillus_
cereus_
Bacillus_
cereus_
Bacillus_
cereus_
Bacillus_
cereus_
Bacillus_
cereus_AH187_
Bacillus_
cereus_AH187_
Bacillus_
cytotoxicus_
Bacillus_
cytotoxicus_
Bacillus_
cytotoxicus_
Bacillus_
cytotoxicus_
Bacillus_
cytotoxicus_
Bacillus_
cytotoxicus_
This disclosure features methods of delivering (e.g., co-delivery or dual delivery) a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, where the methods includes delivering to a (i) gene editor construct and a (ii) template polynucleotide, and (iii) at least a first attachment site-containing guide (atgRNA).
This disclosure also features a method for delivering a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, where the method includes: delivering a lipid nanoparticle (LNP) comprising a gene editor polynucleotide (e.g., a gene editor polynucleotide construct) and a vector comprising a template polynucleotide and at least a first attachment site-containing guide RNA (atgRNA). In some embodiments, the first atgRNA comprises (i) a domain that is capable of guiding the prime editor system to a target sequence; and (ii) a reverse transcriptase (RT) template that comprises at least a portion of a first integration recognition site. In some embodiments, where the vector comprises a polynucleotide encoding a first atgRNA, the RT template comprises the entirety of the first integration recognition site. In some embodiments, where the vector comprises a polynucleotide encoding a first atgRNA, the vector also includes a sequence encoding a nicking guide RNA (ngRNA).
This disclosure also features a method for delivering a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, where the method includes: delivering a lipid nanoparticle (LNP) comprising a gene editor polynucleotide (e.g., a gene editor polynucleotide construct) and a vector comprising a template polynucleotide and a first attachment site-containing guide RNA (atgRNA) and a second attachment site-containing guide RNA (atgRNA). In some embodiments, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence, the first atgRNA further includes a first RT template that comprises at least a portion of the at least first integration recognition site; and the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site. In such embodiments, the first atgRNA and second atgRNA include at least a 6 bp overlap (e.g., 6 bp of complementarity).
This disclosure also features a method for delivering a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, where the method includes: delivering into a cell a lipid nanoparticle (LNP) comprising: (i) a gene editor polynucleotide (e.g., a gene editor polynucleotide construct), and (ii) a first attachment site-containing guide RNA (atgRNA); and a vector comprising: (i) a template polynucleotide, and (ii) a second atgRNA. In some embodiments, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence, the first atgRNA further includes a first RT template that comprises at least a portion of the a first integration recognition site; and the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site. In such embodiments, the first atgRNA and second atgRNA include at least a 6 bp overlap (e.g., 6 bp of complementarity).
This disclosure also features a method for delivering a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, where the method includes delivering: a lipid nanoparticle (LNP) comprising: (i) a gene editor polynucleotide (e.g., a gene editor polynucleotide construct), (ii) a first attachment site-containing guide RNA (atgRNA), and (iii) a second atgRNA; and a vector comprising (i) a template polynucleotide. In some embodiments, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence, the first atgRNA further includes a first RT template that comprises at least a portion of the at least first integration recognition site; and the second atgRNA further includes a second RT template that comprises at least a portion of the at least first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site. In such embodiments, the first atgRNA and second atgRNA include at least a 6 bp overlap (e.g., 6 bp of complementarity).
This disclosure also features a method for delivering a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, where the method includes delivering: a lipid nanoparticle (LNP) comprising: (i) a gene editor polynucleotide (e.g., a gene editor polynucleotide construct) and (ii) a first attachment site-containing guide RNA (atgRNA); and a vector comprising: (i) a template polynucleotide, and (ii) a nicking atgRNA. In some embodiments, the first atgRNA comprises (i) a domain that is capable of guiding the prime editor system to a target sequence; and (ii) a reverse transcriptase (RT) template that comprises at least a portion of a first integration recognition site. In some embodiments, where the vector comprises a polynucleotide encoding a first atgRNA, the RT template comprises the entirety of the first integration recognition site.
In some embodiments, where the method includes delivering an LNP and a first vector, the LNP and the first vector are delivered at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, or 8 weeks apart. In some embodiments, where the method includes delivering an LNP and a second vector, the LNP and the second vector are delivered at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, or 8 weeks apart.
This disclosure also features a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the system comprising: a lipid nanoparticle (LNP) comprising a gene editor polynucleotide (e.g., a gene editor polynucleotide construct) and a vector comprising a template polynucleotide and at least a first attachment site-containing guide RNA (atgRNA). In some embodiments, the first atgRNA comprises (i) a domain that is capable of guiding the prime editor system to a target sequence; and (ii) a reverse transcriptase (RT) template that comprises at least a portion of a first integration recognition site. In some embodiments, where the vector comprises a polynucleotide encoding a first atgRNA, the RT template comprises the entirety of the first integration recognition site. In some embodiments, where the vector comprises a polynucleotide encoding a first atgRNA, the vector also includes a sequence encoding a nicking guide RNA (ngRNA).
This disclosure also features a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the system comprising: a lipid nanoparticle (LNP) comprising a gene editor polynucleotide (e.g., a gene editor polynucleotide construct) and a vector comprising a template polynucleotide and a first attachment site-containing guide RNA (atgRNA) and a second attachment site-containing guide RNA (atgRNA). In some embodiments, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence, the first atgRNA further includes a first RT template that comprises at least a portion of the a first integration recognition site; and the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site. In such embodiments, the first atgRNA and second atgRNA include at least a 6 bp overlap.
This disclosure also features a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the system comprising: a lipid nanoparticle (LNP) comprising: (i) a gene editor polynucleotide (e.g., a gene editor polynucleotide construct), and (ii) a first attachment site-containing guide RNA (atgRNA); and a vector comprising: (i) a template polynucleotide, and (ii) a second atgRNA. In some embodiments, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence, the first atgRNA further includes a first RT template that comprises at least a portion of the a first integration recognition site; and the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site. In such embodiments, the first atgRNA and second atgRNA include at least a 6 bp overlap.
This disclosure also features a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the system comprising: co-delivering: a lipid nanoparticle (LNP) comprising: (i) a gene editor polynucleotide (e.g., a gene editor polynucleotide construct), (ii) a first attachment site-containing guide RNA (atgRNA), and (iii) a second atgRNA; and a vector comprising (i) a template polynucleotide. In some embodiments, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence, the first atgRNA further includes a first RT template that comprises at least a portion of the a first integration recognition site; and the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site. In such embodiments, the first atgRNA and second atgRNA include at least a 6 bp overlap.
This disclosure also features a system capable of site-specifically integrating a template polynucleotide into the genome of a cell, the system comprising: a lipid nanoparticle (LNP) comprising: (i) a gene editor polynucleotide (e.g., a gene editor polynucleotide construct) and (ii) a first attachment site-containing guide RNA (atgRNA); and a vector comprising: (i) a template polynucleotide, and (ii) a nicking atgRNA. In some embodiments, the first atgRNA comprises (i) a domain that is capable of guiding the prime editor system to a target sequence; and (ii) a reverse transcriptase (RT) template that comprises at least a portion of a first integration recognition site. In some embodiments, where the vector comprises a polynucleotide encoding a first atgRNA, the RT template comprises the entirety of the first integration recognition site.
In typical embodiments, the LNP comprising a gene editor polynucleotide construct is capable delivering to a cell cytoplasm the gene editor polynucleotide construct. In some embodiments, the LNP comprising a gene editor polynucleotide construct is capable delivering to a cell nucleus the gene editor polynucleotide construct. In some embodiments, the LNP comprises a gene editor protein and associated guide nucleic acids. In some embodiments, the LNP comprises a gene editor protein and associated guide nucleic acids that are capable of localizing to cell nucleus.
In some embodiments, a gene editor polynucleotide construct is delivered to a cell by a fusosome. In some embodiments, a gene editor polynucleotide construct is delivered to a cell cytoplasm by a fusosome. In some embodiments, the fusosome comprises a gene editor protein and associated guide nucleic acids.
In some embodiments, a gene editor polynucleotide construct is delivered to a cell by an exosome. In some embodiments, a gene editor polynucleotide construct is delivered to a cell cytoplasm by an exosome. In some embodiments, the exosome comprises a gene editor protein and associated guide nucleic acids.
In some embodiments, the prime editor or Gene Writer protein fusion, either of which may have a fused/linked integrase, is incorporated (i.e., packaged) into LNP as protein. Further, associated atgRNA and optional ngRNAs may be co-packaged with gene editor proteins in LNP.
In some embodiments, the gene editor polynucleotide construct comprises (a) a polynucleotide sequence encoding a prime editor fusion protein or a Gene Writer™ protein, (b) a polynucleotide sequence encoding an attachment site-containing guide RNA (atgRNA), (c) optionally, a polynucleotide sequence encoding a nickase guide RNA (ngRNA), (d) a polynucleotide sequence encoding an integrase, (e) and optionally, a polynucleotide sequence encoding a recombinase.
In some embodiments, the prime editor or Gene Writer protein fusion, either of which may have a fused/linked integrase, is expressed as a split construct. In typical embodiments, the split construct in reconstituted in a cell. In some embodiments, the split construct can be fused or ligated via intein protein splicing. In some embodiments, the split construct can be reconstituted via protein-protein inter-molecular bonding and/or interactions. In some embodiments, the split construct can be reconstituted via chemical, biological, or environmental induced oligomerization. In certain embodiments, the split construct can be adapted into one or more nucleic acid constructs described herein.
In some embodiments, the systems described include a gene editor polynucleotide that is delivered to a cell using the methods described herein. In some embodiments, the gene editor polynucleotide is delivered as a polynucleotide (e.g., an mRNA). In some embodiments, the gene editor polynucleotide is delivered as a protein. In some embodiments, the gene editor polynucleotide or protein is packaged, and thereby vectorized, within a lipid nanoparticle (LNP). In some embodiments, the gene editor polynucleotide or protein is packaged in a LNP and is co-delivered with a template polynucleotide (i.e., nucleic acid “cargo” or nucleic acid “payload”) packaged into a separate vector (e.g., a viral vector (e.g., an AAV or adenovirus)) or a second lipid nanoparticle (LNP).
In some embodiments, the gene editor polynucleotide is delivered to the cells as a polynucleotide. For example, the gene editor polynucleotide is delivered to the cells as an mRNA encoding the gene editor polynucleotide (e.g., the gene editor protein or the prime editor system). In some embodiments, the mRNA comprises one or more modified uridines. In some embodiments, the mRNA comprises a sequence where each of the uridines is a modified uridine. In some embodiments, the mRNA is uridine depleted. In some embodiments, the mRNA encoding the nickase comprises one or more modified uridines. In some embodiments, the mRNA encoding the reverse transcriptase comprises one or more modified uridines. In some embodiments, the mRNA encoding the nickase comprises one or more modified uridines, and the mRNA encoding the reverse transcriptase comprises one or more modified uridines. In some embodiments, where the integrase is encoded in an mRNA, the mRNA comprises modified uridines. In some embodiments, a modified uridine is a N1-Methylpseudouridine-5′-Triphosphate. In some embodiments, a modified uridine is a pseudouridine. In some embodiments, the mRNA comprises a 5′ cap. In some embodiments, the 5′ cap comprises a molecular formula of C32H43N15O24P4(free acid).
In some embodiments, the gene editor polynucleotide (e.g., a gene editor polynucleotide construct) comprises a polynucleotide sequence encoding a primer editor system (e.g., any of the prime editor systems described herein). In some embodiments, the prime editor system comprises a nucleotide sequence encoding a nickase (e.g., any of the Cas proteins or variants thereof (e.g., nickases) and nickases described herein, see Tables 4-8) and a nucleotide sequence encoding a reverse transcriptase (e.g., any of the reverse transcriptases described herein). In some embodiments, the nucleotide sequence encoding the nickase and the nucleotide sequence encoding the reverse transcriptase are positioned in the construct such that when expressed the nickase is linked to the reverse transcriptase. In some embodiments, the nickase is linked to the reverse transcriptase by in-frame fusion. In some embodiments, the nickase is linked to the reverse transcriptase by a linker. In some embodiments, the linker is a peptide fused in-frame between the nickase and reverse transcriptase.
In some embodiments, the gene editor polynucleotide (e.g., a gene editor polynucleotide construct) further comprises a polynucleotide sequence encoding at least a first integrase (e.g., any of the integrases described herein, e.g., as described in Table 10 and also in Yarnall et al., Nat. Biotechnol., 2022, doi.org/10.1038/s41587-022-01527-4 and Durrant et al., Nat. Biotechnol., 2022, doi.org/10.1038/s41587-022-01494-w, each of which are herein incorporated by reference in their entireties). In some embodiments, the linked nickase-reverse transcriptase are further linked to the first integrase.
In some embodiments, the gene editor polynucleotide construct further comprises a polynucleotide sequence encoding at least a first recombinase (e.g., any of the recombinases described herein).
In some embodiments, the systems and methods described herein include a vector that is capable of co-delivering a template polynucleotide, one or more attachment site-containing gRNA, one or more integrases, one or more recombinases, a gene editor polynucleotide, one or more integration recognition sites, one or more recombinase recognition sites, or a combination thereof.
Non-limiting examples of vectors that can be used in the methods or systems described herein include the vectors described in
6.9.2.1 AtgRNA and/or ngRNA
In some embodiments, the vector includes a polynucleotide sequence encoding an attachment site-containing guide RNA (atgRNA). In such embodiments, the polynucleotide sequence encoding the attachment site-containing guide RNA (atgRNA) is operably linked to a regulatory element (e.g., a U6 promoter) that is capable of driving expression of the atgRNA. In such embodiments, the atgRNA comprises (i) a domain that is capable of guiding the prime editor system to a target sequence; and (ii) a reverse transcriptase (RT) template that comprises at least a portion of a first integration recognition site. In some embodiments, where the system, and thereby the vector, include a polynucleotide encoding only a first atgRNA, the RT template comprises the entirety of the first integration recognition site. In such embodiments, the vector or the LNP includes a polynucleotide sequence encoding a nicking gRNA.
In some embodiments, the vector includes a polynucleotide sequence encoding a first attachment site-containing guide RNA (atgRNA) and a polynucleotide sequence encoding a second attachment site-containing guide RNA (atgRNA). In such embodiments, the first atgRNA and the second atgRNA are an at least first pair of atgRNAs, wherein the at least first pair of atgRNAs have domains that are capable of guiding the prime editor system to a target sequence, the first atgRNA further includes a first RT template that comprises at least a portion of the a first integration recognition site; the second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site, and the first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site. In such embodiments, the first atgRNA and second atgRNA include at least a 6 bp overlap.
In typical embodiments, the vector includes a template polynucleotide and a sequence that is an integration cognate of an integration recognition site site-specifically incorporated into the genome of a cell. For example, the vector includes a template polynucleotide and a second integration recognition site that is a cognate pair with the first integration recognition site site-specifically incorporated into the genome of the cell. In such embodiments, the sequence that is an integration cognate (e.g., a second integration recognition site) enables integration of the template polynucleotide or portion thereof when contacted with an integrase and the site-specifically incorporated first integration recognition site.
In typical embodiments, the vector comprising a template polynucleotide is a recombinant adenovirus, a helper dependent adenovirus, an AAV, a lentivirus, an HSV, an annelovirus, a retrovirus, a Doggybone™ DNA (dbDNA), a minicircle, a plasmid, a miniDNA, an exosome, a fusosome, or an nanoplasmid. In preferred embodiments, the vector is capable of localizing to the nucleus.
In certain embodiments, the template polynucleotide is delivered to the cytoplasm and localizes to the nucleus. In certain embodiments, the template polynucleotide is delivered to the cytoplasm by LNP. In certain embodiments, the donor template polynucleotide construct comprises a recognition sequence that is recognized by a DNA binding protein (DNA binding domain) or a transcription factor binding domain. In certain embodiments, the donor template polynucleotide construct is delivered to the nucleus by an integrase or recombinase.
In certain embodiments, the template polynucleotide is delivered to the mitochondria. In certain embodiments, the donor template polynucleotide construct comprises a mitochondria targeting sequence.
In certain embodiments, the vector comprising a template polynucleotide is AAV. In some embodiments, the AAV contains a 5′ inverted terminal repeat (ITR). In some embodiments, the AAV contains a 3′ inverted terminal repeat (ITR). In some embodiments, the AAV contains a 5′ and a 3′ ITR. In some embodiments, the 5′ and 3′ ITR are not derived from the same serotype of virus. In some embodiments, the ITRs are derived from adenovirus, AAV2, and/or AAV5.
In certain embodiments, the vector comprising a template polynucleotide is single stranded AAV (ssAAV). In certain embodiments, the vector comprising a donor template polynucleotide construct is self-complementary AAV (scAAV).
In some embodiments, a vector comprises an attachment site-containing guideRNA (atgRNA), a nicking-guideRNA (ngRNA), and template polynucleotide. In typical embodiments, the vector comprising an attachment site-containing guideRNA (atgRNA), a nicking-guideRNA (ngRNA), and template polynucleotide is recombinant adenovirus, helper dependent adenovirus, AAV, lentivirus, HSV, annelovirus, retrovirus, Doggybone™ DNA (dbDNA), minicircle, plasmid, miniDNA, exosome, fusosome, or nanoplasmid. In preferred embodiments, the vector is capable of localizing to the nucleus. In typical embodiments, the attachment site-containing guideRNA (atgRNA) sequence and the nicking-guideRNA (ngRNA) sequence contain a terminal poly dT.
In some embodiments, a vector comprises an attachment site-containing guideRNA (atgRNA), and donor template. In typical embodiments, the vector comprising an attachment site-containing guideRNA (atgRNA) and donor template is recombinant adenovirus, helper dependent adenovirus, AAV, lentivirus, HSV, annelovirus, retrovirus, Doggybone™ DNA (dbDNA), minicircle, plasmid, miniDNA, exosome, fusosome, or nanoplasmid. In preferred embodiments, the vector is capable of localizing to the nucleus. In typical embodiments, the attachment site-containing guideRNA (atgRNA) sequence contain a terminal poly dT.
In typical embodiments, the template polynucleotide is capable of being integrated into a genomic locus that contains an integrase target recognition site or a recombinase target recognition site.
In certain embodiments, the template polynucleotide comprises at least one of the following: a gene, a gene fragment, an expression cassette, a logic gate system, or any combination thereof. In some embodiments, the template polynucleotide comprises at least one intron or exon.
In typical embodiments, the template polynucleotide further comprises at least one integrase target recognition site or a recombinase target integrase site. In certain embodiments, at least one integrase target recognition site or a recombinase target integrase site is placed within the donor template vector inverted terminal repeat.
In some embodiments, the delivery system (e.g., co-delivery system) includes a vector having a sub-sequence that is capable of self-circularizing to form a self-circular nucleic acid. In some embodiments, the vector comprises a physical portion or region of the vector that is capable of self-circularizing to form a circular construct. As used herein, the term “sub-sequence” refers to a portion of the vector that is capable of self-circularizing, where the sub-sequence is flanked by integration recognition sites or recombinase recognition sites positioned to enable self-circularization. As used herein, the term “self-circular nucleic acid” refers to a double-stranded, circular nucleic acid construct produced as a result of recombination of a cognate pair of integrase or recombinase recognition sites present on the vector. Recombination occurs when the vector is contacted with an integrase or a recombinase under conditions that allow for recombination of the cognate pair of integrase or recombinase recognition sites.
In some embodiments, the sub-sequence of the vector includes a first recombinase recognition site and a second recombinase recognition site, wherein the first and second recombinase recognition sites are capable of being recombined by a recombinase. In some embodiments, the sub-sequence of the vector includes a first recombinase recognition site, a second recombinase recognition site, and a second integration recognition site (e.g., the second integration recognition site is a cognate pair of the first integration recognition site), where the first and second recombinase recognition sites flank the integration recognition site. In such cases, the first recombinase recognition site, the second recombinase recognition, and a recombinase enable the self-circularizing and formation of the circular construct.
In some embodiments, the sub-sequence of the vector includes a third integration recognition site and a fourth integration recognition site, wherein the third and fourth integration recognition sites are a cognate pair. In some embodiments, the subsequence of the vector includes the second integration recognition site, the third integration recognition site, the fourth integration recognition site, where the third and fourth integration recognition sites flank the second integration recognition site (where the second integration recognition site is a cognate pair of the first integration recognition site). In such cases, the third integration recognition site, the fourth integration recognition site, and an integrase enable self-circularization and formation of the circular construct. In such cases, the third integration recognition site and/or the fourth integration recognition sites cannot recombine with the first integration recognition site and/or the second integration recognition site due, in part, to having different central dinucleotides than the first and second integration recognition sites.
In some embodiments where the subsequence includes three or more integration recognition sites, each integration recognition site or each pair of integration recognition is capable of being recognized by a different integrase. In some embodiments where the subsequence includes three or more integration recognition sites, each integration recognition site or each pair of integration recognition comprises a different central dinucleotide.
In some embodiments, self-circularizing is mediated at the integration recognition sites or recombinase recognition sites. In some embodiments, the self-circularizing is mediated by an integrase or a recombinase.
In some embodiments, upon introducing the vector into a cell and after self-circularizing to form the self-circular nucleic acid, the self-circular nucleic acid comprising the second integration recognition site is capable of being integrated into the cell's genome at the target sequence that contains the first integration recognition site.
In some embodiments, following self-circularization, the self-circular nucleic acid comprises one or more additional integration recognition sites that enable integration of an additional nucleic acid cargo. In such cases, the additional nucleic acid cargo includes a sequence that is a cognate pair with one or more of the additional integration recognition sites in the self-circular nucleic acid. For example, integration of the self-circular nucleic acid into the genome of a cell results in integration of the one or more additional integration recognition sites into the genome along with the nucleic acid cargo. The integrated one or more additional integration recognition sites serve as an integration recognition site (beacon) for placing the additional nucleic acid cargo. Upon contacting the cell harboring the integrated nucleic acid cargo and the one or more additional integration recognition sites with an integrase and the second additional nucleic acid cargo that includes a sequence that is an integration cognate to the one or more additional integration recognition sites the additional nucleic acid cargo is integrated into the cell's genome.
In typical embodiments, the self-circularized nucleic acid comprises a DNA cargo. embodiments, the DNA cargo is a gene or gene fragment. In some embodiments the DNA cargo is an expression cassette. In some embodiments, the DNA cargo is a logic gate or logic gate system. The logic gate or logic gate system may be DNA based, RNA based, protein based, or a mix of DNA, RNA, and protein. In some embodiments, the nucleic acid cargo is a genetic, protein, or peptide tag and/or barcode.
In some embodiments, the system or methods described herein include a second vector. In some embodiments, where the gene editor polynucleotide encodes a prime editor system comprising a nickase (e.g., any of the Cas proteins or variants thereof (e.g., nickases) and nickases described herein, see Tables 4-8) and a reverse transcriptase (e.g., any of the reverse transcriptase described herein), the second vector comprises a polynucleotide sequence encoding an integrase (e.g., any of the integrases described herein, e.g., as described in Table 10 and also in Yarnall et al., Nat. Biotechnol., 2022, doi.org/10.1038/s41587-022-01527-4 and Durrant et al., Nat. Biotechnol., 2022, doi.org/10.1038/s41587-022-01494-w, each of which are herein incorporated by reference in their entireties).
In some embodiments, where the gene editor polynucleotide encodes a prime editor system comprising a nickase and a reverse transcriptase, the second vector comprises a polynucleotide sequence encoding at least a first recombinase. In some embodiments, where the gene editor polynucleotide encodes a prime editor system comprising a nickase, a reverse transcriptase, and an integrase, the second vector comprises a polynucleotide sequence encoding at least a first recombinase. In some embodiments, where the gene editor polynucleotide encodes a prime editor system comprising a nickase, a reverse transcriptase, and an integrase, the second vector comprises a polynucleotide sequence encoding at least a second integrase.
In some embodiments, the second vector includes a template polynucleotide and a sequence that is an integration cognate of an integration recognition site site-specifically incorporated into the genome of a cell. For example, the second vector includes a template polynucleotide and a second integration recognition site that is a cognate pair with the first integration recognition site site-specifically incorporated into the genome of the cell. In such embodiments, the sequence that is an integration cognate (e.g., a second integration recognition site) enables integration of the template polynucleotide or portion thereof when contacted with an integrase and the site-specifically incorporated first integration recognition site.
In some embodiments, the second vector is a vector selected from: adenovirus, AAV, lentivirus, HSV, annelovirus, retrovirus, Doggybone™ DNA (dbDNA), minicircle, plasmid, miniDNA, exosome, fusosome, or nanoplasmid.
In some embodiments, the polynucleotide sequence encoding the prime editor system is encoded on at least two different vectors. In one embodiment, a first vector comprises a polynucleotide sequence encoding a nickase and a second vector comprises a polynucleotide sequence encoding a reverse transcriptase. In such cases, the first vector and second are delivered concurrently.
In some embodiments, the polynucleotide sequence(s) encoding the prime editor system is encoded on at least two (non-contiguous) polynucleotide sequences. In one embodiment, a first polynucleotide sequence encodes a nickase and a second polynucleotide sequence encodes a reverse transcriptase. In such cases, the first vector and second are delivered concurrently (e.g., in a first LNP).
Also provided herein are methods of co-delivering a system capable of site-specifically integrating at least a first integration recognition site into the genome of a cell, where the method includes delivering to a cell a mixture of a first LNP and a second LNP (“split LNPs”). In one embodiment, the method includes co-delivering to a cell a first gene editor polynucleotide construct and a first attachment site-containing guide RNA (atgRNA) are packaged, and thereby vectorized, within the first LNP, and a second gene editor polynucleotide construct and a second attachment site containing guide RNR (atgRNA) are packaged, and thereby vectorized, within the second LNP, where the first atgRNA and the second atgRNA are an at least first pair of atgRNA. The at least first pair of atgRNAs comprise domains that are capable of guiding the prime editor system to a target sequence. The first atgRNA further includes a first RT template that comprises at least a portion of a first integration recognition site. The second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site. The first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site. In such embodiments, the first atgRNA and second atgRNA include at least a 6 bp overlap.
In some embodiments, where the method includes delivering a first LNP (e.g., a first LNP comprising a first gene editor polynucleotide construct and a first atgRNA) and a second LNP (e.g., a second LNP comprising a second gene editor polynucleotide construct and a second atgRNA), the first LNP and the second LNP are mixed prior to delivering to a cell. In some embodiments, the first LNP and the second LNP are mixed at a ratio of first LNP to second LNP of 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 1:0.75, 0.75:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. In some embodiments, the first LNP and the second LNP are mixed at a ratio of 1:1.
In some embodiments, a first LNP comprising a first gene editor polynucleotide construct and a first attachment site-containing guide RNA (atgRNA1) comprises a ratio of ratio of gene editor polynucleotide construct (e.g., mRNA) to atgRNA1 of 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 1:0.75, 0.75:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. In some embodiments, the first LNP comprises a ratio of mRNA to atgRNA1 of 2:1.
In some embodiments, a second LNP comprising a second gene editor polynucleotide construct and a second attachment site-containing guide RNA (atgRNA2) comprises a ratio of gene editor polynucleotide construct (e.g., mRNA) to atgRNA2 of 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 1:0.75, 0.75:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. In some embodiments, the second LNP comprises a ratio of mRNA to atgRNA2 of 2:1.
In some embodiments, where the method includes delivering a first LNP (e.g., a first LNP comprising a first gene editor polynucleotide construct and a first atgRNA) and a second LNP (e.g., a second LNP comprising a second gene editor polynucleotide construct and a second atgRNA), the first LNP and the second LNP are mixed such that the ratio of gene editor polynucleotide construct (e.g., mRNA) to first atgRNA (atgRNA1) to second atgRNA (atgRNA2) is 1:0.25:0.25, 1:0.5:0.5, 1:0.75:0.75, or 1:1:1.
In some embodiments, the method of co-delivering to a cell a mixture of LNPs includes co-delivering three or more LNPs, four or more LNPs, five or more LNPs, six or more LNPs, seven or more LNPs, eight or more LNPs, nine or more LNPs, or ten or more LNPs.
Also provided herein is a system capable of site-specifically integrating at least a first integration recognition site into the genome of a cell, the system comprising: a first gene editor polynucleotide construct and a first attachment site-containing guide RNA (atgRNA) are packaged, and thereby vectorized, within the first LNP, and a second gene editor polynucleotide construct and a second attachment site containing guide RNR (atgRNA) are packaged, and thereby vectorized, within the second LNP, where the first atgRNA and the second atgRNA are an at least first pair of atgRNA. The at least first pair of atgRNAs comprise domains that are capable of guiding the prime editor system to a target sequence. The first atgRNA further includes a first RT template that comprises at least a portion of a first integration recognition site. The second atgRNA further includes a second RT template that comprises at least a portion of the first integration recognition site. The first atgRNA and the second atgRNAs collectively encode the entirety of the first integration recognition site. In such embodiments, the first atgRNA and second atgRNA include at least a 6 bp overlap.
In some embodiments, the system comprises a first LNP (e.g., any of the first LNPs described herein) and a second LNP (e.g., any of the second LNPs described herein) at a ratio of first LNP to second LNP of 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 1:0.75, 0.75:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. In some embodiments, the system comprise the first LNP and the second LNP at a ratio of 1:1.
In some embodiments, the system comprises a first LNP having a ratio of a first gene editor polynucleotide construct to a first attachment site-containing guide RNA (atgRNA1) of 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 1:0.75, 0.75:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. In some embodiments, the system includes a first LNP having a ratio of mRNA (i.e., mRNA encoding the gene editor protein) to atgRNA1 of 2:1.
In some embodiments, the system comprise a second LNP having a ratio of a second gene editor polynucleotide construct to a second attachment site-containing guide RNA (atgRNA2) of 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 1:0.75, 0.75:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. In some embodiments, the system includes a second LNP having a ratio of mRNA (i.e., mRNA encoding the gene editor protein) to atgRNA2 of 2:1.
In some embodiments, the system comprises a ratio of gene editor polynucleotide construct (e.g., mRNA encoding the gene editor protein) to first atgRNA (atgRNA1) to second atgRNA (atgRNA2) of 1:0.25:0.25, 1:0.5:0.5, 1:0.75:0.75, or 1:1:1.
In some embodiments, the system comprises a mixture of LNPs comprising three or more LNPs, four or more LNPs, five or more LNPs, six or more LNPs, seven or more LNPs, eight or more LNPs, nine or more LNPs, or ten or more LNPs.
In some embodiments, where a split LNP (e.g., a mixture of two LNPs packaged with different cargo) is being used to site-specifically integrate the at least first integration recognition site into the genome, a vector comprising a template polynucleotide and a sequence that is an integration cognate (i.e., cognate to an integration recognition site site-specifically incorporated into the genome of a cell) can be delivered to the cell concurrently with the split LNPs or after delivery of the split LNPs. For example, after delivering the split LNPs to the cell, a vector that includes a template polynucleotide and a second integration recognition site that is a cognate pair with the first integration recognition site is delivered to the cell. In such embodiments, the sequence that is an integration cognate (e.g., a second integration recognition site) enables integration of the template polynucleotide or portion thereof when contacted with an integrase and the site-specifically incorporated first integration recognition site.
In certain aspects the invention involves vectors, e.g. for delivering or introducing in a cell, but also for propagating these components (e.g. in prokaryotic cells). A used herein, a “vector” is a tool that allows or facilitates the transfer of an entity from one environment to another. It is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements. In general, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses (AAVs)). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors.” Vectors for and that result in expression in a eukaryotic cell can be referred to herein as “eukaryotic expression vectors.” Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). With regards to recombination and cloning methods, mention is made of U.S. patent application Ser. No. 10/815,730, published Sep. 2, 2004 as US 2004-0171156 A1, the contents of which are herein incorporated by reference in their entirety.
Vector delivery, e.g., plasmid, viral delivery: The CRISPR enzyme, for instance a Type V protein such as C2c1 or C2c3, and/or any of the present RNAs, for instance a guide RNA, can be delivered using any suitable vector, e.g., plasmid or viral vectors, such as adeno associated virus (AAV), lentivirus, adenovirus or other viral vector types, or combinations thereof. Effector proteins and one or more guide RNAs can be packaged into one or more vectors, e.g., plasmid or viral vectors. In some embodiments, the vector, e.g., plasmid or viral vector is delivered to the tissue of interest by, for example, an intramuscular injection, while other times the delivery is via intravenous, transdermal, intranasal, oral, mucosal, or other delivery methods. Such delivery may be either via a single dose, or multiple doses. One skilled in the art understands that the actual dosage to be delivered herein may vary greatly depending upon a variety of factors, such as the vector choice, the target cell, organism, or tissue, the general condition of the subject to be treated, the degree of transformation/modification sought, the administration route, the administration mode, the type of transformation/modification sought, etc.
Such a dosage may further contain, for example, a carrier (water, saline, ethanol, glycerol, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, etc.), a diluent, a pharmaceutically-acceptable carrier (e.g., phosphate-buffered saline), a pharmaceutically-acceptable excipient, and/or other compounds known in the art. The dosage may further contain one or more pharmaceutically acceptable salts such as, for example, a mineral acid salt such as a hydrochloride, a hydrobromide, a phosphate, a sulfate, etc.; and the salts of organic acids such as acetates, propionates, malonates, benzoates, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, gels or gelling materials, flavorings, colorants, microspheres, polymers, suspension agents, etc. may also be present herein. In addition, one or more other conventional pharmaceutical ingredients, such as preservatives, humectants, suspending agents, surfactants, antioxidants, anticaking agents, fillers, chelating agents, coating agents, chemical stabilizers, etc. may also be present, especially if the dosage form is a reconstitutable form. Suitable exemplary ingredients include microcrystalline cellulose, carboxymethylcellulose sodium, polysorbate 80, phenylethyl alcohol, chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, parachlorophenol, gelatin, albumin and a combination thereof. A thorough discussion of pharmaceutically acceptable excipients is available in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J. 1991) which is incorporated by reference herein.
In an embodiment herein the delivery is via an adenovirus, which may be at a single booster dose containing at least 1×105 particles (also referred to as particle units, pu) of adenoviral vector. In an embodiment herein, the dose preferably is at least about 1×106 particles (for example, about 1×106-1×1011 particles), more preferably at least about 1×107 particles, more preferably at least about 1×108 particles (e.g., about 1×108-1×1011 particles or about 1×109-1×1012 particles), and most preferably at least about 1×1010 particles (e.g., about 1×109-1×1010 particles or about 1×109-1×1012 particles), or even at least about 1×1010 particles (e.g., about 1×1010-1×1012 particles) of the adenoviral vector. Alternatively, the dose comprises no more than about 1×1014 particles, preferably no more than about 1×1013 particles, even more preferably no more than about 1×1012 particles, even more preferably no more than about 1×1011 particles, and most preferably no more than about 1×1010 particles (e.g., no more than about 1×109 particles). Thus, the dose may contain a single dose of adenoviral vector with, for example, about 1×106 particle units (pu), about 2×106 pu, about 4×106 pu, about 1×107 pu, about 2×107 pu, about 4×107 pu, about 1×108 pu, about 2×108 pu, about 4×108 pu, about 1×109 pu, about 2×109 pu, about 4×109 pu, about 1×1010 pu, about 2×1010 pu, about 4×1010 pu, about 1×1011 pu, about 2×1011 pu, about 4×1011 pu, about 1×1012 pu, about 2×1012 pu, or about 4×1012 pu of adenoviral vector. See, for example, the adenoviral vectors in U.S. Pat. No. 8,454,972 B2 to Nabel, et. al., granted on Jun. 4, 2013; incorporated by reference herein, and the dosages at col 29, lines 36-58 thereof. In an embodiment herein, the adenovirus is delivered via multiple doses.
In an embodiment herein, the delivery is via an AAV. A therapeutically effective dosage for in vivo delivery of the AAV to a human is believed to be in the range of from about 20 to about 50 ml of saline solution containing from about 1×1010 to about 1×1050 functional AAV/ml solution. The dosage may be adjusted to balance the therapeutic benefit against any side effects. In an embodiment herein, the AAV dose is generally in the range of concentrations of from about 1×105 to 1×1050 genomes AAV (sometimes referred to herein as “vector genomes” or “vg”), from about 1×108 to 1×1020 genomes AAV, from about 1×1010 to about 1×1016 genomes, or about 1×1011 to about 1×1016 genomes AAV. A human dosage may be about 1×1013 genomes AAV. Such concentrations may be delivered in from about 0.001 ml to about 100 ml, about 0.05 to about 50 ml, or about 10 to about 25 ml of a carrier solution. Other effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves. See, for example, U.S. Pat. No. 8,404,658 B2 to Hajjar, et al., granted on Mar. 26, 2013, at col. 27, lines 45-60.
The promoter used to drive nucleic acid-targeting effector protein coding nucleic acid molecule expression can include: AAV ITR can serve as a promoter: this is advantageous for eliminating the need for an additional promoter element (which can take up space in the vector). The additional space freed up can be used to drive the expression of additional elements (gRNA, etc.). Also, ITR activity is relatively weaker, so can be used to reduce potential toxicity due to over expression of nucleic acid-targeting effector protein. For ubiquitous expression, can use promoters: CMV, CAG, CBh, PGK, SV40, Ferritin heavy or light chains, etc. For brain or other CNS expression, can use promoters: SynapsinI for all neurons, CaMKIIalpha for excitatory neurons, GAD67 or GAD65 or VGAT for GABAergic neurons, etc. For liver expression, can use Albumin promoter. For lung expression, can use SP-B. For endothelial cells, can use ICAM. For hematopoietic cells can use IFNbeta or CD45. For Osteoblasts can use OG-2.
The promoter used to drive guide RNA can include: Pol III promoters such as U6 or H1 Use of Pol II promoter and intronic cassettes to express guide RNA Adeno Associated Virus (AAV).
Nucleic acid-targeting effector protein and one or more guide RNA can be delivered using adeno associated virus (AAV), lentivirus, adenovirus or other plasmid or viral vector types, in particular, using formulations and doses from, for example, U.S. Pat. No. 8,454,972 (formulations, doses for adenovirus), U.S. Pat. No. 8,404,658 (formulations, doses for AAV) and U.S. Pat. No. 5,846,946 (formulations, doses for DNA plasmids) and from clinical trials and publications regarding the clinical trials involving lentivirus, AAV and adenovirus. For examples, for AAV, the route of administration, formulation and dose can be as in U.S. Pat. No. 8,454,972 and as in clinical trials involving AAV. For Adenovirus, the route of administration, formulation and dose can be as in U.S. Pat. No. 8,404,658 and as in clinical trials involving adenovirus. For plasmid delivery, the route of administration, formulation and dose can be as in U.S. Pat. No. 5,846,946 and as in clinical studies involving plasmids. Doses may be based on or extrapolated to an average 70 kg individual (e.g., a male adult human), and can be adjusted for patients, subjects, mammals of different weight and species. Frequency of administration is within the ambit of the medical or veterinary practitioner (e.g., physician, veterinarian), depending on usual factors including the age, sex, general health, other conditions of the patient or subject and the particular condition or symptoms being addressed. The viral vectors can be injected into the tissue of interest. For cell-type specific genome modification, the expression of nucleic acid-targeting effector can be driven by a cell-type specific promoter. For example, liver-specific expression might use the Albumin promoter and neuron-specific expression (e.g., for targeting CNS disorders) might use the Synapsin I promoter.
In terms of in vivo delivery, AAV is advantageous over other viral vectors for a couple of reasons: Low toxicity (this may be due to the purification method not requiring ultra centrifugation of cell particles that can activate the immune response) and Low probability of causing insertional mutagenesis because it doesn't integrate into the host genome.
AAV has a packaging limit of 4.5 or 4.75 Kb. This means that nucleic acid-targeting effector protein (such as a Type V protein such as C2c1 or C2c3) as well as a promoter and transcription terminator have to be all fit into the same viral vector. Therefore embodiments of the invention include utilizing homologs of nucleic acid-targeting effector protein (such as a Type V protein such as C2c1 or C2c3) that are shorter.
As to AAV, the AAV can be AAV1, AAV2, AAV5 or any combination thereof. One can select the AAV of the AAV with regard to the cells to be targeted; e.g., one can select AAV serotypes 1, 2, 5 or a hybrid capsid AAV1, AAV2, AAV5 or any combination thereof for targeting brain or neuronal cells; and one can select AAV4 for targeting cardiac tissue. AAV8 is useful for delivery to the liver. The herein promoters and vectors are preferred individually.
Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and psi2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the polynucleotide(s) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line may also be infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additional methods for the delivery of nucleic acids to cells are known to those skilled in the art. See, for example, US20030087817, incorporated herein by reference.
Millington-Ward et al. (Molecular Therapy, vol. 19 no. 4, 642-649 April 2011) describes adeno-associated virus (AAV) vectors to deliver an RNA interference (RNAi)-based rhodopsin suppressor and a codon-modified rhodopsin replacement gene resistant to suppression due to nucleotide alterations at degenerate positions over the RNAi target site. An injection of either 6.0×108 vp or 1.8×1010 vp AAV were subretinally injected into the eyes by Millington-Ward et al. The AAV vectors of Millington-Ward et al. may be applied to the system of the present invention, contemplating a dose of about 2×1011 to about 6×1011 vp administered to a human.
Dalkara et al. (Sci Transl Med 5, 189ra76 (2013)) also relates to in vivo directed evolution to fashion an AAV vector that delivers wild-type versions of defective genes throughout the retina after noninjurious injection into the eyes' vitreous humor. Dalkara describes a 7 mer peptide display library and an AAV library constructed by DNA shuffling of cap genes from AAV1, 2, 4, 5, 6, 8, and 9. The rcAAV libraries and rAAV vectors expressing GFP under a CAG or Rho promoter were packaged and deoxyribonuclease-resistant genomic titers were obtained through quantitative PCR. The libraries were pooled, and two rounds of evolution were performed, each consisting of initial library diversification followed by three in vivo selection steps. In each such step, P30 rho-GFP mice were intravitreally injected with 2 ml of iodixanol-purified, phosphate-buffered saline (PBS)-dialyzed library with a genomic titer of about 1.times.10.sup.12 vg/ml. The AAV vectors of Dalkara et al. may be applied to the nucleic acid-targeting system of the present invention, contemplating a dose of about 1×1015 to about 1×1016 vg/ml administered to a human.
The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SW), human immuno deficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT/US94/05700). In applications where transient expression is preferred, adenoviral based systems may be used. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus (“AAV”) vectors may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93/24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989).
Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and yr2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the polynucleotide(s) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line may also be infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additional methods for the delivery of nucleic acids to cells are known to those skilled in the art. See, for example, US20030087817, incorporated herein by reference.
In some embodiments, a host cell is transiently or non-transiently transfected with one or more vectors described herein. In some embodiments, a cell is transfected as it naturally occurs in a subject. In some embodiments, a cell that is transfected is taken from a subject. Cells taken from a subject include, but are not limited to, hepatocytes or cells isolated from muscle, the CNS, eye or lung. Immunological cells are also contemplated, such as but not limited to T cells, HSCs, B-cells and NK cells.
Another useful method to deliver proteins, enzymes, and guides comprises transfection of messenger RNA (mRNA). Examples of mRNA delivery methods and compositions that may be utilized in the present disclosure including, for example, PCT/US2014/028330, U.S. Pat. No. 8,822,663B2, NZ700688A, ES2740248T3, EP2755693A4, EP2755986A4, WO2014152940A1, EP3450553B1, BR112016030852A2, and EP3362461A1. Expression of CRISPR systems in particular is described by WO2020014577. Each of these publications are incorporated herein by reference in their entireties. Additional disclosure hereby incorporated by reference can be found in Kowalski et al., “Delivering the Messenger: Advances in Technologies for Therapeutic mRNA Delivery,” Mol Therap., 2019; 27(4): 710-728.
In some embodiments, the cell is derived from cells taken from a subject, such as a cell line. A wide variety of cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, C8161, CCRF-CEM, MOLT, mIMCD-3, NHDF, HeLa-S3, Huh1, Huh4, Huh7, HUVEC, HASMC, HEKn, HEKa, MiaPaCell, Panc1, PC-3, TF1, CTLL-2, CIR, Rat6, CV1, RPTE, A10, T24, J82, A375, ARH-77, Calu1, SW480, SW620, SKOV3, SK-UT, CaCo2, P388D1, SEM-K2, WEHI-231, HB56, TIB55, Jurkat, J45.01, LRMB, Bcl-1, BC-3, IC21, DLD2, Raw264.7, NRK, NRK-52E, MRC5, MEF, Hep G2, HeLa B, HeLa T4, COS, COS-1, COS-6, COS-M6A, BS-C-1 monkey kidney epithelial, BALB/3T3 mouse embryo fibroblast, 3T3 Swiss, 3T3-L1, 132-d5 human fetal fibroblasts; 10.1 mouse fibroblasts, 293-T, 3T3, 721, 9L, A2780, A2780ADR, A2780cis, A172, A20, A253, A431, A-549, ALC, B16, B35, BCP-1 cells, BEAS-2B, bEnd.3, BHK-21, BR293, BxPC3, C3H-10T1/2, C6/36, Cal-27, CHO, CHO-7, CHO-IR, CHO-K1, CHO-K2, CHO-T, CHO Dhfr−/−, COR-L23, COR-L23/CPR, COR-L23/5010, COR-L23/R23, COS-7, COV-434, CML T1, CMT, CT26, D17, DH82, DU145, DuCaP, EL4, EM2, EM3, EMT6/AR1, EMT6/AR10.0, FM3, H1299, H69, HB54, HB55, HCA2, HEK-293, HeLa, Hepa1c1c7, HL-60, HMEC, HT-29, Jurkat, JY cells, K562 cells, Ku812, KCL22, KG1, KYO1, LNCap, Ma-Mel 1-48, MC-38, MCF-7, MCF-10A, MDA-MB-231, MDA-MB-468, MDA-MB-435, MDCK II, MDCK II, MOR/0.2R, MONO-MAC 6, MTD-1A, MyEnd, NCI-H69/CPR, NCI-H69/LX10, NCI-H69/LX20, NCI-H69/LX4, NIH-3T3, NALM-1, NW-145, OPCN/OPCT cell lines, Peer, PNT-1A/PNT 2, RenCa, RIN-5F, RMA/RMAS, Saos-2 cells, Sf-9, SkBr3, T2, T-47D, T84, THP1 cell line, U373, U87, U937, VCaP, Vero cells, WM39, WT-49, X63, YAC-1, YAR, and transgenic varieties thereof. Cell lines are available from a variety of sources known to those with skill in the art (see, e.g., the American Type Culture Collection (ATCC) (Manassas, Va.)). In some embodiments, a cell transfected with one or more vectors described herein is used to establish a new cell line comprising one or more vector-derived sequences.
In some embodiments, one or more vectors described herein are used to produce a non-human transgenic animal or transgenic plant. In some embodiments, the transgenic animal is a mammal, such as a mouse, rat, or rabbit. In certain embodiments, the organism or subject is a plant. In certain embodiments, the organism or subject or plant is algae. Methods for producing transgenic plants and animals are known in the art, and generally begin with a method of cell transfection, such as described herein.
In one aspect, the invention provides for methods of modifying a target polynucleotide in a prokaryotic or eukaryotic cell, which may be in vivo, ex vivo or in vitro. In some embodiments, the method comprises sampling a cell or population of cells from a human or non-human animal or plant (including micro-algae) and modifying the cell or cells. Culturing may occur at any stage ex vivo. The cell or cells may even be re-introduced into the non-human animal or plant (including micro-algae).
In plants, pathogens are often host-specific. For example, Fusariumn oxysporum f. sp. lycopersici causes tomato wilt but attacks only tomato, and F. oxysporum f. dianthii Puccinia graminis f. sp. tritici attacks only wheat. Plants have existing and induced defenses to resist most pathogens. Mutations and recombination events across plant generations lead to genetic variability that gives rise to susceptibility, especially as pathogens reproduce with more frequency than plants. In plants there can be non-host resistance, e.g., the host and pathogen are incompatible. There can also be Horizontal Resistance, e.g., partial resistance against all races of a pathogen, typically controlled by many genes and Vertical Resistance, e.g., complete resistance to some races of a pathogen but not to other races, typically controlled by a few genes. In a Gene-for-Gene level, plants and pathogens evolve together, and the genetic changes in one balance changes in other. Accordingly, using Natural Variability, breeders combine most useful genes for Yield. Quality, Uniformity, Hardiness, Resistance. The sources of resistance genes include native or foreign Varieties, Heirloom Varieties, Wild Plant Relatives, and Induced Mutations, e.g., treating plant material with mutagenic agents. Using the present invention, plant breeders are provided with a new tool to induce mutations. Accordingly, one skilled in the art can analyze the genome of sources of resistance genes, and in Varieties having desired characteristics or traits employ the present invention to induce the rise of resistance genes, with more precision than previous mutagenic agents and hence accelerate and improve plant breeding programs.
Examples of target polynucleotides include a sequence associated with a signaling biochemical pathway, e.g., a signaling biochemical pathway-associated gene or polynucleotide. Examples of target polynucleotides include a disease associated gene or polynucleotide. A “disease-associated” gene or polynucleotide refers to any gene or polynucleotide which is yielding transcription or translation products at an abnormal level or in an abnormal form in cells derived from a disease-affected tissues compared with tissues or cells of a non disease control. It may be a gene that becomes expressed at an abnormally high level; it may be a gene that becomes expressed at an abnormally low level, where the altered expression correlates with the occurrence and/or progression of the disease. A disease-associated gene also refers to a gene possessing mutation(s) or genetic variation that is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of a disease. The transcribed or translated products may be known or unknown, and may be at a normal or abnormal level.
In some embodiments, the delivery system is packaged in one or more LNPs and administered intravenously. In some embodiments, the co-delivery system is packaged in one or more LNPs and administered intrathecally. In some embodiments, the co-delivery system is packaged in one or more LNPs and administered by intracerebral ventricular injection. In some embodiments, the co-delivery system is packaged in one or more LNPs and administered by intracisternal magna administration. In some embodiments, the co-delivery system is packaged in one or more LNPs and administered by intravitreal injection.
The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787). In some embodiments, the LNP formulations are selected from LP01 (Cas No. 1799316-64-5), ALC-0315 (Cas No. 2036272-55-4), and cKK-E12 (Cas No. 1432494-65-9). In some embodiments, the LNP formulation is LP01 (i.e., LNP #F1). In some embodiments, the LNP formulation is ALC-0315 (i.e., LNP #F2). In some embodiment, the LNP formulation is cKK-E12 (i.e., LNP #F3).
In some embodiments, LNP doses range from about 0.1 mg/kg to about 100 mg/kg (or any of the values or subranges therein). In some embodiments, LNP doses is about 0.1 mg/kg, about 0.2 mg/kg, about 0.3 mg/kg, about 0.4 mg/kg, about 0.5 mg/kg, about 0.6 mg/kg, about 0.7 mg/kg, about 0.8 mg/kg, about 0.9 mg/kg, about 1.0 mg/kg, 1.5 mg/kg, about 2 mg/kg, about 2.5 mg/kg, about 3 mg/kg, about 3.5 mg/kg, about 4 mg/kg, about 4.5 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, about 30 mg/kg, about 35 mg/kg, about 40 mg/kg, about 45 mg/kg, or about 50 mg/kg or more.
In another embodiment, LNP doses of about 0.01 to about 1 mg per kg of body weight administered intravenously are contemplated. Medications to reduce the risk of infusion-related reactions are contemplated, such as dexamethasone, acetampinophen, diphenhydramine or cetirizine, and ranitidine are contemplated. Multiple doses of about 0.3 mg per kilogram every 4 weeks for five doses are also contemplated.
The charge of the LNP must be taken into consideration. As cationic lipids combined with negatively charged lipids to induce nonbilayer structures that facilitate intracellular delivery. Because charged LNPs are rapidly cleared from circulation following intravenous injection, ionizable cationic lipids with pKa values below 7 were developed (see, e.g., Rosin et al, Molecular Therapy, vol. 19, no. 12, pages 1286-2200, December 2011). Negatively charged polymers such as RNA may be loaded into LNPs at low pH values (e.g., pH 4) where the ionizable lipids display a positive charge. However, at physiological pH values, the LNPs exhibit a low surface charge compatible with longer circulation times. Four species of ionizable cationic lipids have been focused upon, namely 1,2-dilineoyl-3-dimethylammonium-propane (DLinDAP), 1,2-dilinoleyloxy-3-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-keto-N,N-dimethyl-3-aminopropane (DLinKDMA), and 1,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLinKC2-DMA). It has been shown that LNP siRNA systems containing these lipids exhibit remarkably different gene silencing properties in hepatocytes in vivo, with potencies varying according to the series DLinKC2-DMA>DLinKDMA>DLinDMA>>DLinDAP employing a Factor VII gene silencing model (see, e.g., Rosin et al, Molecular Therapy, vol. 19, no. 12, pages 1286-2200, December 2011). A dosage of 1 μg/ml of LNP in or associated with the LNP may be contemplated, especially for a formulation containing DLinKC2-DMA.
In some embodiments, the LNP composition comprises one or more one or more ionizable lipids. As used herein, the term “ionizable lipid” has its ordinary meaning in the art and may refer to a lipid comprising one or more charged moieties. In some embodiments, an ionizable lipid may be positively charged or negatively charged. In principle, there are no specific limitations concerning the ionizable lipids of the LNP compositions disclosed herein. In some embodiments, the one or more ionizable lipids are selected from the group consisting of 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanami-ne (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octad-eca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)--octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)), and (2S)-2-({8-[(3)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)--octadeca-9,12-dien-1-y loxy]propan-1-amine (Octyl-CLinDMA (2S)). In one embodiment, the ionizable lipid may be selected from, but not limited to, an ionizable lipid described in International Publication Nos. WO2013086354 and WO2013116126.
In some embodiments, the lipid nanoparticle may include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, or 8) cationic and/or ionizable lipids. Such cationic and/or ionizable lipids include, but are not limited to, 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanami-ne (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 2-({8-[(3.beta.)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(3.beta.)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadeca-9,12-dien-1-yl oxy]propan-1-amine (Octyl-CLinDMA (2R)), (2S)-2-({8-[(33cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadeca-9,12-dien-1-yl oxy]propan-1-amine (Octyl-CLinDMA (2S)).N,N-dioleyl-N,N-dimethylammonium chloride (“DODAC”); N-(2,3-dioleyloxy)propyl-N,N--N-triethylammonium chloride (“DOTMA”); N,N-distearyl-N,N-dimethylammonium bromide (“DDAB”); N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (“DOTAP”); 1,2-Dioleyloxy-3-trimethylaminopropane chloride salt (“DOTAP.Cl”); 3-.beta.-(N--(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (“DC-Chol”), N-(1-(2,3-dioleyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N-dimethyl-ammonium trifluoracetate (“DOSPA”), dioctadecylamidoglycyl carboxyspermine (“DOGS”), 1,2-dioleoyl-3-dimethylammonium propane (“DODAP”), N,N-dimethyl-2,3-dioleyloxy)propylamine (“DODMA”), and N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (“DMRIE”). Additionally, a number of commercial preparations of cationic and/or ionizable lipids can be used, such as, e.g., LIPOFECTIN® (including DOTMA and DOPE, available from GIBCO/BRL), and LIPOFECTAMINE® (including DOSPA and DOPE, available from GIBCO/BRL). KL10, KL22, and KL25 are described, for example, in U.S. Pat. No. 8,691,750.
In some embodiments, the LNP composition comprises one or more amino lipids. The terms “amino lipid” and “cationic lipid” are used interchangeably herein to include those lipids and salts thereof having one, two, three, or more fatty acid or fatty alkyl chains and a pH-titratable amino head group (e.g., an alkylamino or dialkylamino head group). In principle, there are no specific limitations concerning the amino lipids of the LNP compositions disclosed herein. The cationic lipid is typically protonated (i.e., positively charged) at a pH below the pKa of the cationic lipid and is substantially neutral at a pH above the pKa. The cationic lipids can also be termed titratable cationic lipids. In some embodiments, the one or more cationic lipids include: a protonatable tertiary amine (e.g., pH-titratable) head group; alkyl chains, wherein each alkyl chain independently has 0 to 3 (e.g., 0, 1, 2, or 3) double bonds; and ether, ester, or ketal linkages between the head group and alkyl chains. Such cationic lipids include, but are not limited to, DSDMA, DODMA, DOTMA, DLinDMA, DLenDMA, .gamma.-DLenDMA, DLin-K-DMA, DLin-K-C2-DMA (also known as DLin-C2K-DMA, XTC2, and C2K), DLin-K-C3-DMA, DLin-K-C4-DMA, DLen-C2K-DMA, y-DLen-C2-DMA, C12-200, cKK-E12, cKK-A12, cKK-012, DLin-MC2-DMA (also known as MC2), and DLin-MC3-DMA (also known as MC3).
Anionic lipids suitable for use in lipid nanoparticles include, but are not limited to, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoyl phosphatidylethanoloamine, N-succinyl phosphatidylethanolamine, N-glutaryl phosphatidylethanolamine, lysylphosphatidylglycerol, and other anionic modifying groups joined to neutral lipids.
Neutral lipids (including both uncharged and zwitterionic lipids) suitable for use in lipid nanoparticles include, but are not limited to, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, sterols (e.g., cholesterol) and cerebrosides. In some embodiments, the lipid nanoparticle comprises cholesterol. Lipids having a variety of acyl chain groups of varying chain length and degree of saturation are available or may be isolated or synthesized by well-known techniques. Additionally, lipids having mixtures of saturated and unsaturated fatty acid chains and cyclic regions can be used. In some embodiments, the neutral lipids used in the disclosure are DOPE, DSPC, DPPC, POPC, or any related phosphatidylcholine. In some embodiments, the neutral lipid may be composed of sphingomyelin, dihydrosphingomyeline, or phospholipids with other head groups, such as serine and inositol.
In some embodiments, amphipathic lipids are included in nanoparticles. Exemplary amphipathic lipids suitable for use in nanoparticles include, but are not limited to, sphingolipids, phospholipids, fatty acids, and amino lipids.
The lipid composition of the pharmaceutical composition may comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. In general, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties.
A phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin.
A fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.
Particular amphipathic lipids can facilitate fusion to a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue.
Non-natural amphipathic lipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions can be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).
Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin.
In some embodiments, the LNP composition comprises one or more phospholipids. In some embodiments, the phospholipid is selected from the group consisting of 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16:0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine1,2-didocosahexaenoyl--sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and any mixtures thereof.
Other phosphorus-lacking compounds, such as sphingolipids, glycosphingolipid families, diacylglycerols, and .beta.-acyloxyacids, may also be used. Additionally, such amphipathic lipids can be readily mixed with other lipids, such as triglycerides and sterols.
In some embodiments, the LNP composition comprises one or more helper lipids. The term “helper lipid” as used herein refers to lipids that enhance transfection (e.g., transfection of an LNP comprising an mRNA that encodes a site-directed endonuclease, such as a SpCas9 polypeptide). In principle, there are no specific limitations concerning the helper lipids of the LNP compositions disclosed herein. Without being bound to any particular theory, it is believed that the mechanism by which the helper lipid enhances transfection includes enhancing particle stability. In some embodiments, the helper lipid enhances membrane fusogenicity. Generally, the helper lipid of the LNP compositions disclosure herein can be any helper lipid known in the art. Non-limiting examples of helper lipids suitable for the compositions and methods include steroids, sterols, and alkyl resorcinols. Particularly helper lipids suitable for use in the present disclosure include, but are not limited to, saturated phosphatidylcholine (PC) such as distearoyl-PC (DSPC) and dipalymitoyl-PC (DPPC), dioleoylphosphatidylethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In some embodiments, the helper lipid of the LNP composition includes cholesterol.
In some embodiments, the LNP composition comprises one or more structural lipids. As used herein, the term “structural lipid” refers to sterols and also to lipids containing sterol moieties. Without being bound to any particular theory, it is believed that the incorporation of structural lipids into the LNPs mitigates aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, “sterols” are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In some embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol.
The lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. In some embodiments, the LNP composition disclosed herein comprise one or more polyethylene glycol (PEG) lipid. The term “PEG-lipid” refers to polyethylene glycol (PEG)-modified lipids. Such lipids are also referred to as PEGylated lipids. Non-limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG-modified 1,2-diacyloxypropan-3-amines For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid. In some embodiments, the PEG-lipid includes, but not limited to 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)](PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA). In some embodiments, the PEG-lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the lipid moiety of the PEG-lipids includes those having lengths of from about C.sub.14 to about C.sub.22, preferably from about C.sub.14 to about C.sub.16. In some embodiments, a PEG moiety, for example a mPEG-NH.sub.2, has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In some embodiment, the PEG-lipid is PEG2k-DMG. In some embodiments, the one or more PEG lipids of the LNP composition comprises PEG-DMPE. In some embodiments, the one or more PEG lipids of the LNP composition comprises PEG-DMG.
In some embodiments, the ratio between the lipid components and the nucleic acid molecules of the LNP composition, e.g., the weight ratio, is sufficient for (i) formation of LNPs with desired characteristics, e.g., size, charge, and (ii) delivery of a sufficient dose of nucleic acid at a dose of the lipid component(s) that is tolerable for in vivo administration as readily ascertained by one of skill in the art.
In certain embodiments, it is desirable to target a nanoparticle, e.g., a lipid nanoparticle, using a targeting moiety that is specific to a cell type and/or tissue type. In some embodiments, a nanoparticle may be targeted to a particular cell, tissue, and/or organ using a targeting moiety. In particular embodiments, a nanoparticle comprises a targeting moiety. Exemplary non-limiting targeting moieties include ligands, cell surface receptors, glycoproteins, vitamins (e.g., riboflavin) and antibodies (e.g., full-length antibodies, antibody fragments (e.g., Fv fragments, single chain Fv (scFv) fragments, Fab′ fragments, or F(ab′)2 fragments), single domain antibodies, camelid antibodies and fragments thereof, human antibodies and fragments thereof, monoclonal antibodies, and multispecific antibodies (e.g., bispecific antibodies)). In some embodiments, the targeting moiety may be a polypeptide. The targeting moiety may include the entire polypeptide (e.g., peptide or protein) or fragments thereof. A targeting moiety is typically positioned on the outer surface of the nanoparticle in such a manner that the targeting moiety is available for interaction with the target, for example, a cell surface receptor. A variety of different targeting moieties and methods are known and available in the art, including those described, e.g., in Sapra et al., Prog. Lipid Res. 42(5):439-62, 2003 and Abra et al., J. Liposome Res. 12:1-3, 2002.
In some embodiments, a lipid nanoparticle (e.g., a liposome) may include a surface coating of hydrophilic polymer chains, such as polyethylene glycol (PEG) chains (see, e.g., Allen et al., Biochimica et Biophysica Acta 1237: 99-108, 1995; DeFrees et al., Journal of the American Chemistry Society 118: 6101-6104, 1996; Blume et al., Biochimica et Biophysica Acta 1149: 180-184,1993; Klibanov et al., Journal of Liposome Research 2: 321-334, 1992; U.S. Pat. No. 5,013,556; Zalipsky, Bioconjugate Chemistry 4: 296-299, 1993; Zalipsky, FEBS Letters 353: 71-74, 1994; Zalipsky, in Stealth Liposomes Chapter 9 (Lasic and Martin, Eds) CRC Press, Boca Raton Fla., 1995). In one approach, a targeting moiety for targeting the lipid nanoparticle is linked to the polar head group of lipids forming the nanoparticle. In another approach, the targeting moiety is attached to the distal ends of the PEG chains forming the hydrophilic polymer coating (see, e.g., Klibanov et al., Journal of Liposome Research 2: 321-334, 1992; Kirpotin et al., FEBS Letters 388: 115-118, 1996).
Standard methods for coupling the targeting moiety or moieties may be used. For example, phosphatidylethanolamine, which can be activated for attachment of targeting moieties, or derivatized lipophilic compounds, such as lipid-derivatized bleomycin, can be used. Antibody-targeted liposomes can be constructed using, for instance, liposomes that incorporate protein A (see, e.g., Renneisen et al., J. Bio. Chem., 265:16337-16342, 1990 and Leonetti et al., Proc. Natl. Acad. Sci. (USA), 87:2448-2451, 1990). Other examples of antibody conjugation are disclosed in U.S. Pat. No. 6,027,726. Examples of targeting moieties can also include other polypeptides that are specific to cellular components, including antigens associated with neoplasms or tumors. Polypeptides used as targeting moieties can be attached to the liposomes via covalent bonds (see, for example Heath, Covalent Attachment of Proteins to Liposomes, 149 Methods in Enzymology 111-119 (Academic Press, Inc. 1987)). Other targeting methods include the biotin-avidin system.
In some embodiments, a lipid nanoparticle includes a targeting moiety that targets the lipid nanoparticle to a cell including, but not limited to, hepatocytes, colon cells, epithelial cells, hematopoietic cells, epithelial cells, endothelial cells, lung cells, bone cells, stem cells, mesenchymal cells, neural cells, cardiac cells, adipocytes, vascular smooth muscle cells, cardiomyocytes, skeletal muscle cells, beta cells, pituitary cells, synovial lining cells, ovarian cells, testicular cells, fibroblasts, B cells, T cells, reticulocytes, leukocytes, granulocytes, and tumor cells (including primary tumor cells and metastatic tumor cells). In particular embodiments, the targeting moiety targets the lipid nanoparticle to a hepatocyte.
The lipid nanoparticles described herein may be lipidoid-based. The synthesis of lipidoids has been extensively described and formulations containing these compounds are particularly suited for delivery of polynucleotides (see Mahon et al., Bioconjug Chem. 2010 21:1448-1454; Schroeder et al., J Intern Med. 2010 267:9-21; Akinc et al., Nat. Biotechnol. 2008 26:561-569; Love et al., Proc Natl Acad Sci USA. 2010 107:1864-1869; Siegwart et al., Proc Natl Acad Sci USA. 2011 108:12996-3001).
The characteristics of optimized lipidoid formulations for intramuscular or subcutaneous routes may vary significantly depending on the target cell type and the ability of formulations to diffuse through the extracellular matrix into the blood stream. While a particle size of less than 150 nm may be desired for effective hepatocyte delivery due to the size of the endothelial fenestrae (see e.g., Akinc et al., Mol Ther. 2009 17:872-879), use of lipidoid oligonucleotides to deliver the formulation to other cells types including, but not limited to, endothelial cells, myeloid cells, and muscle cells may not be similarly size-limited.
In one aspect, effective delivery to myeloid cells, such as monocytes, lipidoid formulations may have a similar component molar ratio. Different ratios of lipidoids and other components including, but not limited to, a neutral lipid (e.g., diacylphosphatidylcholine), cholesterol, a PEGylated lipid (e.g., PEG-DMPE), and a fatty acid (e.g., an omega-3 fatty acid) may be used to optimize the formulation of the mRNA or system for delivery to different cell types including, but not limited to, hepatocytes, myeloid cells, muscle cells, etc. Exemplary lipidoids include, but are not limited to, DLin-DMA, DLin-K-DMA, DLin-KC2-DMA, 98N12-5, C12-200 (including variants and derivatives), DLin-MC3-DMA and analogs thereof. The use of lipidoid formulations for the localized delivery of nucleic acids to cells (such as, but not limited to, adipose cells and muscle cells) via either subcutaneous or intramuscular delivery, may also not require all of the formulation components which may be required for systemic delivery, and as such may comprise the lipidoid and the mRNA or system.
According to the present disclosure, a system described herein may be formulated by mixing the mRNA or system, or individual components of the system, with the lipidoid at a set ratio prior to addition to cells. In vivo formulations may require the addition of extra ingredients to facilitate circulation throughout the body. After formation of the particle, a system or individual components of a system is added and allowed to integrate with the complex. The encapsulation efficiency is determined using a standard dye exclusion assays.
In vivo delivery of systems may be affected by many parameters, including, but not limited to, the formulation composition, nature of particle PEGylation, degree of loading, oligonucleotide to lipid ratio, and biophysical parameters such as particle size (Akinc et al., Mol Ther. 2009 17:872-879; herein incorporated by reference in its entirety). As an example, small changes in the anchor chain length of poly(ethylene glycol) (PEG) lipids may result in significant effects on in vivo efficacy. Formulations with the different lipidoids, including, but not limited to penta[3-(1-laurylaminopropionyl)]-triethylenetetramine hydrochloride (TETA-5LAP; aka 98N12-5, see Murugaiah et al., Analytical Biochemistry, 401:61 (2010)), C12-200 (including derivatives and variants), MD1, DLin-DMA, DLin-K-DMA, DLin-KC2-DMA and DLin-MC3-DMA can be tested for in vivo activity. The lipidoid referred to herein as “98N12-5” is disclosed by Akinc et al., Mol Ther. 2009 17:872-879). The lipidoid referred to herein as “C12-200” is disclosed by Love et al., Proc Natl Acad Sci USA. 2010 107:1864-1869 and Liu and Huang, Molecular Therapy. 2010 669-670.
The LNPs of the present disclosure, in which a nucleic acid is entrapped within the lipid portion of the particle and is protected from degradation, can be formed by any method known in the art including, but not limited to, a continuous mixing method, a direct dilution process, and an in-line dilution process. Additional techniques and methods suitable for the preparation of the LNPs described herein include coacervation, microemulsions, supercritical fluid technologies, phase-inversion temperature (PIT) techniques.
In some embodiments, the LNPs used herein are produced via a continuous mixing method, e.g., a process that includes providing an aqueous solution a nucleic acid described herein in a first reservoir, providing an organic lipid solution in a second reservoir (wherein the lipids present in the organic lipid solution are solubilized in an organic solvent, e.g., a lower alkanol such as ethanol), and mixing the aqueous solution with the organic lipid solution such that the organic lipid solution mixes with the aqueous solution so as to substantially instantaneously produce a lipid vesicle (e.g., liposome) encapsulating the nucleic acid molecule within the lipid vesicle. This process and the apparatus for carrying out this process are known in the art. More information in this regard can be found in, for example, U.S. Patent Publication No. 20040142025. The action of continuously introducing lipid and buffer solutions into a mixing environment, such as in a mixing chamber, causes a continuous dilution of the lipid solution with the buffer solution, thereby producing a lipid vesicle substantially instantaneously upon mixing. By mixing the aqueous solution comprising a nucleic acid molecule with the organic lipid solution, the organic lipid solution undergoes a continuous stepwise dilution in the presence of the buffer solution (e.g., aqueous solution) to produce a nucleic acid-lipid particle.
In some embodiments, the LNPs used herein are produced via a direct dilution process that includes forming a lipid vesicle (e.g., liposome) solution and immediately and directly introducing the lipid vesicle solution into a collection vessel containing a controlled amount of dilution buffer. In some embodiments, the collection vessel includes one or more elements configured to stir the contents of the collection vessel to facilitate dilution. In some embodiments, the amount of dilution buffer present in the collection vessel is substantially equal to the volume of lipid vesicle solution introduced thereto.
In some embodiments, the LNPs are produced via an in-line dilution process in which a third reservoir containing dilution buffer is fluidly coupled to a second mixing region. In these embodiments, the lipid vesicle (e.g., liposome) solution formed in a first mixing region is immediately and directly mixed with dilution buffer in the second mixing region. These processes and the apparatuses for carrying out direct dilution and in-line dilution processes are known in the art. More information in this regard can be found in, for example, U.S. Patent Publication No. 20070042031.
This disclosure provides compositions and co-delivery methods for correcting or replacing genes or gene fragments (including introns or exons) or inserting genes in new locations. In certain embodiments, such a method comprises recombination or integration into a safe harbor site (SHS). A frequently used human SHS is the AAVS1 site on chromosome 19q, initially identified as a site for recurrent adeno-associated virus insertion. Another locus comprises the human homolog of the murine Rosa26 locus. Yet another SHS comprises the human H11 locus on chromosome 22. In some cases, a complete gene may be prohibitively large and replacement of an entire gene impractical. In certain embodiments, a method of the invention comprises recombining corrective gene fragments into a defective locus.
The methods and compositions can be used to target, without limitation, stem cells for example induced pluripotent stem cells (iPSCs), HSCs, HSPCs, mesenchymal stem cells, or neuronal stem cells and cells at various stages of differentiation. In certain embodiments, methods and compositions of the invention are adapted to target organoids, including patient derived organoids.
In certain embodiments, methods and compositions of the invention are adapted to treat muscle cells, not limited to cardiomyocytes for Duchene Muscular Dystrophy (DMD). The dystrophin gene is the largest gene in the human genome, spanning ˜2.3 Mb of DNA. DMD is composed of 79 exons resulting in a 14-kb full-length mRNA. Common mutations include mutations that disrupt the reading frame of generate a premature stop codon. An aspect of DMD that lends it to gene editing as a therapeutic approach is the modular structure of the dystrophin protein. Redundancy in the central rod domain permits the deletion of internal segments of the gene that may harbor loss-of-function mutations, thereby restoring the open reading frame (ORFs). In some embodiments, the methods and systems described herein are used to treat DMD by site-specifically integrating in the genome a polynucleotide template that repairs or replaces all or a portion of the defective DMD gene.
The following are non limiting diseases that may be treated utilizing the methods and compositions of the present disclosure:
Over 2500 mutations have been identified associated with various diseases and defects.
The most common cystic fibrosis (CF) mutation F508del removes a single amino acid. In some embodiments, recombining human CFTR into an SHS of a cell that expresses CFTR F508del is a corrective treatment path. In some embodiments, the methods and systems described herein are used to CF by site-specifically integrating in the genome a polynucleotide template that corrects the mutation causing CF. Proposed validation is detection of persistent CFTR mRNA and protein expression in transduced cells.
Sickle cell disease (SCD) is caused by mutation of a specific amino acid—valine to glutamic acid at amino acid position 6. In some embodiments, SCD is corrected by recombination of the HBB gene into a safe harbor site (SHS) and by demonstrating correction in a proportion of target cells that is high enough to produce a substantial benefit. In some embodiments, the methods and systems described herein are used to sickle cell disease by site-specifically integrating in the genome a polynucleotide template that corrects the mutation causing the disease. In some embodiments, validation is detection of persistent HBB mRNA and protein expression in transduced cells.
The dystrophin gene is the largest gene in the human genome, spanning ˜2.3 Mb of DNA. DMD is composed of 79 exons resulting in a 14-kb full-length mRNA. Common mutations include mutations that disrupt the reading frame of generate a premature stop codon. An aspect of DMD that lends it to gene editing as a therapeutic approach is the modular structure of the dystrophin protein. Redundancy in the central rod domain permits the deletion of internal segments of the gene that may harbor loss-of-function mutations, thereby restoring the open reading frame (ORFs).
In some embodiments, recombination will be into safe harbor sites (SHS). A frequently used human SHS is the AAVS1 site on chromosome 19q, initially identified as a site for recurrent adeno-associated virus insertion. In some embodiments, the site is the human homolog of the e murine Rosa26 locus (pubmed.ncbi.nlm.nih.gov/18037879). In some embodiments, the site is the human H11 locus on chromosome 22. Proposed target cells for recombination include stem cells for example induced pluripotent stem cells (iPSCs) and cells at various stages of differentiation. In some cases, a complete gene may be prohibitively large and replacement of an entire gene impractical. In such instances, rescuing mutants by recombining in corrected gene fragments with the methods and systems described herein is a corrective option.
In some embodiments, correcting mutations in exon 44 (or 51) by recombining in a corrective coding sequence downstream of exon 43 (or 50), using the methods and systems described herein is a corrective option. Proposed validation is detection of persistent DMD mRNA and protein expression in transduced cells.
A large proportion of severe hemophilia A patients harbor one of two types of chromosomal inversions in the FVIII gene. The recombinase technology and methods described herein are well suited to correcting such inversions (and other mutations) by recombining of the FVIII gene into a SHS.
In some embodiments, correcting factor VIII deficiency by recombining the FVIII gene into an SHS is a corrective path. In some embodiments, the methods and systems described herein are used to correct factor VIII deficiency by site-specifically integrating in the genome a polynucleotide template that corrects the mutation causing the FIX deficiency. Proposed validation is detection of persistent FVIII mRNA and protein expression in transduced cells.
Hemophilia B, also called factor IX (FIX) deficiency is a genetic disorder caused by missing or defective factor IX, a clotting protein.
In some embodiments, the methods and systems described herein are used to correct factor IX deficiency by site-specifically integrating in the genome a polynucleotide template that corrects the mutation causing the FIX deficiency. Proposed validation is detection of persistent FiX mRNA and protein expression in transduced cells.
In another aspect, methods of treatment are presented. The method comprises administering an effective amount of the pharmaceutical composition comprising the nucleic acid construct or vectorized nucleic acid construct described above to a patient in need thereof. In some embodiments, the system (e.g., any of the systems described herein) are delivered to a cell ex vivo and the cell is then administered to the subject. In some embodiments, the systems (e.g., any of the systems described herein) are delivered to a patient, thereby delivering to a cell in vivo.
DNA or RNA viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to patients (ex vivo). Conventional viral based systems to be used herein could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
In some embodiments, the co-delivery system described herein (e.g., a gene editor construct packaged in a LNP and a donor template packaged in a vector) is administered intravenously. In some embodiments, the co-delivery system described herein (e.g., a gene editor construct packaged in a LNP and a donor template packaged in a vector) is administered intrathecally. In some embodiments, the co-delivery system described herein (e.g., a gene editor construct packaged in a LNP and a donor template packaged in a vector) is administered by intracerebral ventricular injection. In some embodiments, the co-delivery system described herein (e.g., a gene editor construct packaged in a LNP and a donor template packaged in a vector) is administered by intracisternal magna administration. In some embodiments, the co-delivery system described herein (e.g., a gene editor construct packaged in a LNP and a donor template packaged in a vector) is administered by intravitreal injection.
Methods of non-viral delivery of the donor DNA template described herein include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).
6.11.1.1 mRNA Delivery
Another useful method to deliver proteins, enzymes, and guides comprises transfection of messenger RNA (mRNA). Examples of mRNA delivery methods and compositions that may be utilized in the present disclosure including, for example, PCT/US2014/028330, U.S. Pat. No. 8,822,663B2, NZ700688A, ES2740248T3, EP2755693A4, EP2755986A4, WO2014152940A1, EP3450553B1, BR112016030852A2, and EP3362461A1. Expression of CRISPR systems in particular is described by WO2020014577. Each of these publications are incorporated herein by reference in their entireties. Additional disclosure hereby incorporated by reference can be found in Kowalski et al., “Delivering the Messenger: Advances in Technologies for Therapeutic mRNA Delivery,” Mol Therap., 2019; 27(4): 710-728.
Embodiment 1. A method of co-delivering to a cell a gene editor polynucleotide construct and a template polynucleotide construct, the method comprising co-delivering:
Embodiment 2. The method of embodiment 1, wherein the gene editor polynucleotide construct is capable of localizing to a cell cytoplasm.
Embodiment 3. The method of embodiment 1, wherein the donor template polynucleotide construct is capable of localizing to a cell nucleus.
Embodiment 4. The method of embodiment 1 or embodiment 2, wherein the gene editor polynucleotide construct comprises:
Embodiment 5. The method of embodiment 4, wherein the integrase that is encoded by a polynucleotide sequence in the gene editor polynucleotide construct is fused to the prime editor fusion protein or the Gene Writer™ protein encoded by a gene editor polynucleotide construct, and wherein the fusion is optionally by a linker.
Embodiment 6. The method of any of embodiment 4 or embodiment 5, wherein the one or more atgRNA encodes an integrase target recognition side or a recombinase recognition site.
Embodiment 7. The method of any of the previous embodiments, wherein the vector comprising a donor template polynucleotide construct, the vector is recombinant adenovirus, helper dependent adenovirus, AAV, lentivirus, HSV, annelovirus, retrovirus, Doggybone™ DNA (dbDNA), minicircle, plasmid, miniDNA, exosome, fusosome, or nanoplasmid.
Embodiment 8. The method of any of the previous embodiments, wherein the donor template is capable of being integrated into a genomic locus that contains an integrase target recognition site or a recombinase target integrase site.
Embodiment 9. The method of any of the previous embodiments, wherein the donor template comprises at least one of the following: a gene, a gene fragment, an expression cassette, a logic gate system, or any combination thereof.
Embodiment 10. The method of any of the previous embodiments, wherein the donor template further comprises at least one integrase target recognition site or a recombinase target integrase site.
Embodiment 11. The method of any of the previous embodiments, wherein the donor template is capable of self-circularization to form a circularized nucleic acid.
Embodiment 12. The circularized nucleic acid of embodiment 11, wherein the self-circularizing is mediated by an integrase or recombinase.
Embodiment 13. A pharmaceutical co-delivery composition comprising:
Embodiment 14. A pharmaceutical co-delivery composition of embodiment 13, wherein the gene editor polynucleotide construct comprises:
Embodiment 15. A method comprising administering an effective amount of the pharmaceutical composition of embodiment 13 or embodiment 14, to a patient in need thereof.
A gene editor polynucleotide construct is packaged into a LNP (
A donor template polynucleotide construct is packaged in an AAV vector (
Co-administration of the gene editor construct packaged LNP and the donor template packaged AAV co-delivers the gene editor construct to a cell cytoplasm and the donor template to a cell nucleus. By use of programmable genome editing to place integrase landing site at a desired location in the genome, the direct activity of the associated integrase to the specific genomic site is guided. Gene editor construct expression, with template co-delivery, results in integration of template “cargo” at a precisely defined target location.
A gene editor polynucleotide construct is packaged into a LNP (
A donor template polynucleotide construct is packaged in an AAV vector (
Co-administration of the gene editor construct packaged LNP and the donor template packaged AAV co-delivers the gene editor construct to a cell cytoplasm and the donor template to a cell nucleus. Integrase-mediated self-circularization of donor template occurs at integration target recognition sites within the AAV genome (
A gene editor polynucleotide construct is packaged into a LNP (
A polynucleotide sequence encoding an attachment site-containing guide RNA (atgRNA), a polynucleotide sequence encoding a nicking guide RNA (ngRNA), and donor template are packaged in an AAV vector (
Co-administration of the gene editor construct packaged LNP and the atgRNA, ngRNA, donor template packaged AAV co-delivers the gene editor construct to a cell. Integrase-mediated self-circularization of donor template occurs at integration target recognition sites within the AAV genome (
A gene editor polynucleotide construct and a nicking guide RNA (ngRNA) are packaged into a LNP (
A polynucleotide sequence encoding an attachment site-containing guide RNA (atgRNA) and donor template are packaged in an AAV vector (
Co-administration of the gene editor construct and ngRNA packaged LNP and the atgRNA, donor template packaged AAV co-delivers the gene editor construct to a cell. Integrase-mediated self-circularization of donor template occurs at integration target recognition sites within the AAV genome (
Three self-complementary AAV (scAAV) genomes were designed and generated to verify recombinase/integrase-mediated intramolecular circularization of a DNA cargo from within a linear AAV genome (
Intracellular circularization of either plasmid or packaged AAV genomes were screened in HEK293 cells (35K cells per well) (
As shown in
This example assessed the efficiency of in vitro beacon placement in primary human hepatocytes using mRNA delivering of a polynucleotide encoding a gene editor polynucleotide construct and AAV to deliver the first and second atgRNA. See
In the mouse experiments, the mRNA and AAV were delivered into the primary mouse hepatocytes (PNM) using (i) concurrent delivery (“co-dose”), (ii) AAV delivery followed by a “1-day delay” before delivery of the mRNA, or (iii) AAV delivery followed by a “2-day delay” before delivery of the mRNA. Beacon placement was then assessed using next-generation sequencing of DNA isolated from cells subjected to the delivery conditions mentioned above. The mRNA encoding the gene editor polynucleotide construct was delivered in various amounts per well: 2000 ng, 1000 ng, 500 ng, 250 ng, 125 ng, 62.5 ng, and 31.25 ng. AAV encoding the first and second atgRNA (see Table 12). The primary mouse hepatocyte data is shown in
AAV-
mNolc1-F
(AAVG023)
AAV-
mNolc1-R
AAV-hF9-F
(AAVG048)
AAV-hF9-R
(AAVG048)
As shown in
As shown in
Taken together, this data showed robust ex vivo beacon placement in primary mouse and primary human hepatocytes.
In vivo beacon placement in mice was assessed using AAV to deliver the first and second atgRNAs and mRNA to delivery the gene editing polynucleotide construct.
In these experiments, mice were administered AAV containing the first atgRNA (SEQ ID NO: 543; Table 12) and the second atgRNA (SEQ ID NO: 544) targeting the Nolc1 locus at 3E11 to 1E12 vector genomes (vg) per animal two 2 weeks prior to administration of the mRNA containing the gene editing polynucleotide construct (see
Taken together, this data provided proof-of-concept for successful in vivo beacon placement using AAV to deliver the first and second atgRNA and LNPs to deliver the mRNA encoding the gene editor polynucleotide construct.
In vivo integration efficiency in AttP mice was assessed using adenovirus to deliver an integrase (e.g., Bxb1) and an AAV to deliver the template polynucleotide.
For these experiments, the adenovirus (i.e., adenovirus containing polynucleotide encoding the integrase) and the AAV (i.e., AAV containing the template polynucleotide and an attB site) were administered to mice containing dual AttP sites integrated in to the Rosa26 locus (B6.RosaBxb-GT/GA; female, Strain #036152). The Rosa26 locus included a first AttP site comprising a GT dinucleotide and a second AttP site comprising a GA dinucleotide. The AAV was a scAAV8 containing a vector having a template polynucleotide and a 38 bp GT AttB site. The Adenovirus was an adenovirus-type 5 (Ad5) containing a polynucleotide encoding Bxb1 (“Bxb1 AdV”) (SEQ TD NO: 563; Table 14). Mice were administered the adenovirus and AAV according to the experimental details in Table 13.
Ten days after administration of the AdV and AAV viruses, liver punches were collected and genomic DNA was isolated. ddPCR of the genomic DNA was used to assess integration efficiency.
As shown in
Overall, this data establishes proof-of-concept for in vivo integration using an adenovirus to deliver and drive expression of Bxb1 and an AAV to deliver the template polynucleotide to be integrated into a mammalian genome, in this case, the mouse genome.
In vivo beacon placement was assessed in neonatal mice following administration of a single dose of a mixture of two LNPs. The first LNP contained mRNA encoding a prime editing system and a first synthetic atgRNA (atgRNA1). The mRNA and atgRNA1 were included at 1:1 ratio in the first LNP. The second LNP contained mRNA encoding a prime editing system and a second synthetic atgRNA (atgRNA2). The mRNA and atgRNA2 were included at a 1:1 ratio in the second LNP. Each of the first and second atgRNAs targeted the mouse Nolc1 locus and each encoded a portion of an integration recognition site (a “beacon”). AtgRNA1 and atgRNA2 together included a 6 bp overlap. The first and second LNPs were combined 1:1 as mixture prior to administration. The first atgRNA and second atgRNA are provide in Table 15, where the atgRNA include one or more 2′O-methyl modifications and one or more phosphorothioate linkages.
The LNP mixture was administered to the neonatal mice (2-5 day old CD-1 mice) according to the experimental details in Table 16.
Eight days after administration of the LNP mixture in vivo beacon placement was assessed. In particular, at day 8 post administration, liver samples (either whole liver for groups 1-3 or liver punches from each lobe for groups 4-6 (see Table 13)) were collected and genomic DNA was isolated. Beacon placement was detected using ddPCR and NGS.
As shown in
Neonates were also assessed at six weeks after administration of the LNP mixture. Beacon placement was detected using ddPCR and NGS. As shown in
Overall, this data demonstrated successful in vivo site-specific integration of an integration recognition site. In particular, this data showed that a split LNP approach can be used for site-specifically integrating an integration recognition site in vivo in a mammalian genome, in this case neonatal mice.
In vivo beacon placement was assessed in adult mice using a single dose mixture of two LNPs. The first LNP contained mRNA encoding a prime editing system and a first synthetic atgRNA (atgRNA1). The mRNA and atgRNA1 were included at different ratios (e.g., 1:0.5, 1:1, and 1:2) ratio in the first LNP. The second LNP contained mRNA encoding a prime editing system and a second synthetic atgRNA (atgRNA2). The mRNA and atgRNA2 were included at different ratios (e.g., 1:0.5, 1:1, and 1:2) ratio in the second LNP. Here, the first and second atgRNAs targeted mouse Factor IX (“mF9”) locus and each encoded a portion of an integration recognition site (“beacon”). Similar to Example 9, atgRNA1 and atgRNA2 together included a 6 bp overlap and were combined 1:1 as mixture prior to administration. The first atgRNA and second atgRNA are provide in Table 17, where the atgRNA include one or more 2′O-methyl modifications and one or more phosphorothioate linkages.
In particular, the LNP mixture was administered to female CD-1 mice 6-8 weeks old according to the experimental details in Table 18.
Eight days after administration of the LNP mixture in vivo beacon placement was assessed. In particular, at day 8 post administration, liver samples (i.e., liver punches of each lobe (see Table 14)) were collected and genomic DNA was isolated. Beacon placement was detected using ddPCR and NGS.
As shown in
Overall, this data showed successful in vivo site-specific integration of an integration recognition site in adult mice. In particular, this data showed that the ratio of mRNA to atgRNA is an important consideration in determining efficacy of in vivo site-specific integration of an integration recognition site.
All references cited herein are incorporated by reference to the same extent as if each individual publication, database entry (e.g. Genbank sequences or GeneID entries), patent application, or patent, was specifically and individually indicated incorporated by reference in its entirety, for all purposes. This statement of incorporation by reference is intended by Applicants, pursuant to 37 C.F.R. § 1.57(b)(1), to relate to each and every individual publication, database entry (e.g. Genbank sequences or GeneID entries), patent application, or patent, each of which is clearly identified in compliance with 37 C.F.R. § 1.57(b)(2), even if such citation is not immediately adjacent to a dedicated statement of incorporation by reference. The inclusion of dedicated statements of incorporation by reference, if any, within the specification does not in any way weaken this general statement of incorporation by reference. Citation of the references herein is not intended as an admission that the reference is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents.
It is an object of the invention not to encompass within the invention any previously known product, process of making the product, or method of using the product such that Applicant reserves the right and hereby disclose a disclaimer of any previously known product, process, or method. It is further noted that the invention does not intend to encompass within the scope of the invention any product, process, or making of the product or method of using the product, which does not meet the written description and enablement requirements of the USPTO (35 U.S.C. 112(a)) or the EPO (Article 83 of the EPC), such that Applicant reserves the right and hereby disclose a disclaimer of any previously described product, process of making the product, or method of using the product. It may be advantageous in the practice of the invention to be in compliance with Art. 53(c) EPC and Rule 28(b) and (c) EPC. Nothing herein is to be construed as a promise. It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. Patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of” and “consists essentially of” have the meaning ascribed to them in U.S. Patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.
While the invention has been particularly shown and described with reference to a preferred embodiment and various alternate embodiments, it is understood by persons skilled in the relevant art that various changes in form and details can be made therein without departing from the spirit and scope of the invention.
This application claims the benefit of U.S. Provisional Application No. 63/292,698, filed Dec. 22, 2021; U.S. Provisional Application No. 63/318,343, filed Mar. 9, 2022; and U.S. Provisional Application No. 63/355,235, filed on Jun. 24, 2022, each of which is hereby incorporated in its entirety by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2022/082297 | 12/22/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63292698 | Dec 2021 | US | |
| 63318343 | Mar 2022 | US | |
| 63355235 | Jun 2022 | US |
