Patent Application
20210147870
The contents of the text file named “NIGH-010/001WO_SeqList.txt,” which was created on Apr. 3, 2019 and is 279 KB in size, are hereby incorporated by reference in their entirety.
The present disclosure relates to adeno-associated viral (AAV) vector systems and AAV vectors for expressing human ABCA4 protein in a target cell. The AAV vector systems and AAV vectors of the disclosure may be used in preventing or treating diseases associated with degradation of retinal cells such as Stargardt disease.
Stargardt disease is an inherited disease of the retina that can lead to blindness through the destruction of light-sensing photoreceptor cells in the eye. The disease commonly presents in childhood leading to blindness in young people.
The most common form of Stargardt disease is a recessive disorder linked to mutations in the gene encoding the protein ATP Binding Cassette, sub-family A, member 4 (ABCA4). In Stargardt disease, mutations in the ABCA4 gene lead to a lack of functional ABCA4 protein in retinal cells. This in turn leads to the formation and accumulation of bisretinoid by-products, producing toxic granules of lipofuscin in Retinal Pigment Epithelial (RPE) cells. This causes degradation and eventual destruction of the RPE cells, which leads to loss of photoreceptor cells causing progressive loss of vision and eventual blindness.
There has been a long-felt and unmet need for an effective treatment for Stargardt disease that addresses the underlying cause of the disease.
The disclosure provides an AAV vector system for expressing a human ABCA4 protein in a target cell, the AAV vector system comprising a first AAV vector comprising a first nucleic acid sequence and a second AAV vector comprising a second nucleic acid sequence; wherein the first nucleic acid sequence comprises a 5′ end portion of an ABCA4 coding sequence (CDS) and the second nucleic acid sequence comprises a 3′ end portion of an ABCA4 CDS, and the 5′ end portion and the 3′ end portion together encompass the entire ABCA4 CDS; wherein the first nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3597 of SEQ ID NO: 1; wherein the second nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 3806 to 6926 of SEQ ID NO: 1; wherein the first nucleic acid sequence and the second nucleic acid sequence each comprise a region of sequence overlap with the other; and wherein the region of sequence overlap comprises at least about 20 contiguous nucleotides of a nucleic acid sequence corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1.
The region of sequence overlap may be between 20 and 550 nucleotides in length; preferably between 50 and 250 nucleotides in length; more preferably between 175 and 225 nucleotides in length; and most preferably between 195 and 215 nucleotides in length.
The region of sequence overlap may also comprise at least about 50 contiguous nucleotides of a nucleic acid sequence corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1; preferably at least about 75 contiguous nucleotides; more preferably at least about 100 contiguous nucleotides; even more preferably at least about 150 contiguous nucleotides; and most preferably at least about 200 contiguous nucleotides.
In some embodiments, the first nucleic acid sequence comprises a sequence of contiguous nucleotides consisting of nucleotides 105 to 3597 of SEQ ID NO: 1. In some embodiments, the second nucleic acid sequence comprises a sequence of contiguous nucleotides consisting of nucleotides 3806 to 6926 of SEQ ID NO: 1.
In some embodiments, the first nucleic acid sequence comprises a sequence of contiguous nucleotides consisting of nucleotides 105 to 3597 of SEQ ID NO: 2. In some embodiments, the second nucleic acid sequence comprises a sequence of contiguous nucleotides consisting of nucleotides 3806 to 6926 of SEQ ID NO: 2.
In some embodiments, the region of sequence overlap comprises at least about 20 contiguous nucleotides of a nucleic acid sequence consisting of nucleotides 3598 to 3805 of SEQ ID NO: 1. In some embodiments, the region of sequence overlap comprises at least about 20 contiguous nucleotides of a nucleic acid sequence consisting of nucleotides 3598 to 3805 of SEQ ID NO: 2.
In some embodiments, the region of sequence overlap comprises at least about 50 contiguous nucleotides of a nucleic acid sequence consisting of nucleotides 3598 to 3805 of SEQ ID NO: 1; preferably at least about 75 contiguous nucleotides; more preferably at least about 100 contiguous nucleotides; even more preferably at least about 150 contiguous nucleotides; and most preferably at least about 200 contiguous nucleotides. In some embodiments, the region of sequence overlap comprises at least about 50 contiguous nucleotides of a nucleic acid sequence consisting of nucleotides 3598 to 3805 of SEQ ID NO: 2; preferably at least about 75 contiguous nucleotides; more preferably at least about 100 contiguous nucleotides; even more preferably at least about 150 contiguous nucleotides; and most preferably at least about 200 contiguous nucleotides.
In some embodiments, the first nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3805 of SEQ ID NO: 1; and the second nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 3598 to 6926 of SEQ ID NO: 1.
In some embodiments, the first nucleic acid sequence comprises a sequence of contiguous nucleotides consisting of nucleotides 105 to 3805 of SEQ ID NO: 1; and the second nucleic acid sequence comprises a sequence of contiguous nucleotides consisting of nucleotides 3598 to 6926 of SEQ ID NO: 1.
In some embodiments, the first nucleic acid sequence comprises a sequence of contiguous nucleotides consisting of nucleotides 105 to 3805 of SEQ ID NO: 2; and the second nucleic acid sequence comprises a sequence of contiguous nucleotides consisting of nucleotides 3598 to 6926 of SEQ ID NO: 2.
The first AAV vector may comprise a GRK1 promoter operably linked to the 5′ end portion of an ABCA4 coding sequence (CDS).
The first nucleic acid sequence may comprise an untranslated region (UTR) located upstream of the 5′ end portion of an ABCA4 coding sequence (CDS).
The second nucleic acid sequence may comprise a post-transcriptional response element (PRE); preferably a Woodchuck hepatitis virus post-transcriptional response element (WPRE).
The second nucleic acid sequence may comprise a bovine Growth Hormone (bGH) poly-adenylation sequence.
The disclosure provides a method for expressing a human ABCA4 protein in a target cell, the method comprising the steps of: transducing the target cell with the first AAV vector and the second AAV vector as defined above, such that a functional ABCA4 protein is expressed in the target cell.
The disclosure provides an AAV vector comprising a nucleic acid sequence comprising a 5′ end portion of an ABCA4 CDS, wherein the 5′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3805 of SEQ ID NO: 1. In some embodiments, this AAV vector comprises the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the 5′ end portion of an ABCA4 CDS consists of nucleotides 105 to 3805 of SEQ ID NO: 1. In some embodiments, the 5′ end portion of an ABCA4 CDS consists of nucleotides 105 to 3805 of SEQ ID NO: 2.
The disclosure provides an AAV vector comprising a nucleic acid sequence comprising a 3′ end portion of an ABCA4 CDS, wherein the 3′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 3598 to 6926 of SEQ ID NO: 1. In one embodiment, this AAV vector comprises the nucleic acid sequence of SEQ ID NO: 10. In one embodiment, the 3′ end portion of an ABCA4 CDS consists of nucleotides 3598 to 6926 of SEQ ID NO: 1. In one embodiment, the 3′ end portion of an ABCA4 CDS consists of nucleotides 3598 to 6926 of SEQ ID NO:2.
The disclosure provides a nucleic acid comprising the first nucleic acid sequence as defined above.
The disclosure provides a nucleic acid comprising the second nucleic acid sequence as defined above.
The disclosure provides a nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 9, and a nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 10.
The disclosure provides a kit comprising the AAV vector system as described above, or the upstream AAV vector and the downstream AAV vector as described above.
The disclosure provides a kit comprising a nucleic acid comprising the first nucleic acid sequence and a nucleic acid comprising the second nucleic acid sequence, as described above, or a nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 9 and a nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 10, as described above.
The disclosure provides a pharmaceutical composition comprising the AAV vector system as described above and a pharmaceutically acceptable excipient.
The disclosure provides an AAV vector system as described above, a kit as described above, or a pharmaceutical composition as described above, for use in preventing or treating disease characterized by degradation of retinal cells; preferably for use in preventing or treating Stargardt disease.
The disclosure provides a method for preventing or treating a disease characterized by degradation of retinal cells, such as Stargardt disease, comprising administering to a subject in need thereof an effective amount of an AAV vector system as described above, a kit as described above, or a pharmaceutical composition as described above.
The disclosure provides an AAV vector system for expressing a human ABCA4 protein in a target cell, the AAV vector system comprising a first AAV vector comprising a first nucleic acid sequence and a second AAV vector comprising a second nucleic acid sequence; wherein the first nucleic acid sequence comprises a 5′ end portion of an ABCA4 coding sequence (CDS) and the second nucleic acid sequence comprises a 3′ end portion of an ABCA4 CDS, and the 5′ end portion and the 3′ end portion together encompass the entire ABCA4 CDS; wherein the first nucleic acid sequence comprises a sequence having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100%) sequence identity to nucleotides 105 to 3597 of SEQ ID NO: 1; wherein the second nucleic acid sequence comprises a sequence having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100%) sequence identity to nucleotides 3806 to 6926 of SEQ ID NO: 1; wherein the first nucleic acid sequence and the second nucleic acid sequence each comprise a region of sequence overlap with the other; and wherein the region of sequence overlap comprises at least about 20 contiguous nucleotides of a nucleic acid sequence having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100%) sequence identity to nucleotides 3598 to 3805 of SEQ ID NO: 1.
The disclosure provides an AAV vector system for expressing a human ABCA4 protein in a target cell, the AAV vector system comprising a first AAV vector comprising a first nucleic acid sequence and a second AAV vector comprising a second nucleic acid sequence, wherein the first nucleic acid sequence comprises a 5′ end portion of an ABCA4 coding sequence (CDS) and the second nucleic acid sequence comprises a 3′ end portion of an ABCA4 CDS, and the 5′ end portion and the 3′ end portion together encompass the entire ABCA4 CDS; wherein the 5′ end portion of an ABCA4 CDS consists of a sequence having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100%) sequence identity to nucleotides 105 to 3805 of SEQ ID NO: 1, and wherein the 3′ end portion of an ABCA4 CDS consists of a sequence having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100%) sequence identity to nucleotides 3598 to 6926 of SEQ ID NO: 1.
The disclosure provides an AAV vector comprising a nucleic acid sequence comprising a 5′ end portion of an ABCA4 CDS, wherein the 5′ end portion of an ABCA4 CDS consists of a sequence having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100%) sequence identity to nucleotides 105 to 3805 of SEQ ID NO: 1.
The disclosure provides an AAV vector comprising a nucleic acid sequence comprising a 3′ end portion of an ABCA4 CDS, wherein the 3′ end portion of an ABCA4 CDS consists of a sequence having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or 100%) sequence identity to nucleotides 3598 to 6926 of SEQ ID NO: 1.
The disclosure provides an AAV vector system for expressing a human ABCA4 protein in a target cell, the AAV vector system comprising a first AAV vector comprising a first nucleic acid sequence and a second AAV vector comprising a second nucleic acid sequence; wherein the first nucleic acid sequence comprises a 5′ end portion of an ABCA4 coding sequence (CDS) and the second nucleic acid sequence comprises a 3′ end portion of an ABCA4 CDS, and the 5′ end portion and the 3′ end portion together encompass the entire ABCA4 CDS; wherein the first nucleic acid sequence comprises a sequence having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to nucleotides 105 to 3597 of SEQ ID NO: 2; wherein the second nucleic acid sequence comprises a sequence having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to nucleotides 3806 to 6926 of SEQ ID NO: 2; wherein the first nucleic acid sequence and the second nucleic acid sequence each comprise a region of sequence overlap with the other; and wherein the region of sequence overlap comprises at least about 20 contiguous nucleotides of a nucleic acid sequence having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to nucleotides 3598 to 3805 of SEQ ID NO: 2.
The disclosure provides an AAV vector system for expressing a human ABCA4 protein in a target cell, the AAV vector system comprising a first AAV vector comprising a first nucleic acid sequence and a second AAV vector comprising a second nucleic acid sequence, wherein the first nucleic acid sequence comprises a 5′ end portion of an ABCA4 coding sequence (CDS) and the second nucleic acid sequence comprises a 3′ end portion of an ABCA4 CDS, and the 5′ end portion and the 3′ end portion together encompass the entire ABCA4 CDS; wherein the 5′ end portion of an ABCA4 CDS consists of a sequence having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to nucleotides 105 to 3805 of SEQ ID NO: 2, and wherein the 3′ end portion of an ABCA4 CDS consists of a sequence having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to nucleotides 3598 to 6926 of SEQ ID NO: 2.
The disclosure provides an AAV vector comprising a nucleic acid sequence comprising a 5′ end portion of an ABCA4 CDS, wherein the 5′ end portion of an ABCA4 CDS consists of a sequence having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to nucleotides 105 to 3805 of SEQ ID NO: 2.
The disclosure provides an AAV vector comprising a nucleic acid sequence comprising a 3′ end portion of an ABCA4 CDS, wherein the 3′ end portion of an ABCA4 CDS consists of a sequence having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to nucleotides 3598 to 6926 of SEQ ID NO: 2.
The disclosure provides a nucleic acid comprising a nucleic acid sequence having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to SEQ ID NO: 9, and a nucleic acid comprising a nucleic acid sequence having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%) sequence identity to SEQ ID NO: 10.
The disclosure provides an adeno-associated viral (AAV) vector system for expressing a human ABCA4 protein in a target cell, the AAV vector system comprising a first AAV vector comprising a first nucleic acid sequence and a second AAV vector comprising a second nucleic acid sequence; wherein the first nucleic acid sequence comprises a 5′ end portion of an ABCA4 coding sequence (CDS) and the second nucleic acid sequence comprises a 3′ end portion of an ABCA4 CDS, and the 5′ end portion and the 3′ end portion together encompass the entire ABCA4 CDS; wherein the first nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3597 of SEQ ID NO: 1; wherein the second nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 3806 to 6926 of SEQ ID NO: 1; wherein the first nucleic acid sequence and the second nucleic acid sequence each comprise a region of sequence overlap with the other; and wherein the region of sequence overlap comprises at least about 20 contiguous nucleotides of a nucleic acid sequence corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1. In some embodiments of the AAV vector system, the region of sequence overlap is between 20 and 550 nucleotides in length; preferably between 50 and 250 nucleotides in length; preferably between 175 and 225 nucleotides in length; or preferably between 195 and 215 nucleotides in length. In some embodiments of the AAV vector system, the region of sequence overlap comprises at least about 50 contiguous nucleotides of a nucleic acid sequence corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1; preferably at least about 75 contiguous nucleotides; preferably at least about 100 contiguous nucleotides; preferably at least about 150 contiguous nucleotides; preferably at least about 200 contiguous nucleotides; or preferably all 208 contiguous nucleotides.
In some embodiments of AAV vector systems of the disclosure, the first nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3805 of SEQ ID NO: 1; and wherein the second nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 3598 to 6926 of SEQ ID NO: 1.
In some embodiments of AAV vector systems of the disclosure, the first nucleic acid sequence comprises a CBA promoter operably linked to the 5′ end portion of an ABCA4 coding sequence (CDS). In some embodiments, the first nucleic acid sequence further comprises a sequence encoding an intron. In some embodiments, the first nucleic acid sequence further comprises a sequence encoding an exon. In some embodiments, the first nucleic acid sequence further comprises a sequence encoding an Intron and an Exon (IntEx).
In some embodiments of AAV vector systems of the disclosure, the first nucleic acid sequence comprises an untranslated region (UTR) located upstream of the 5′ end portion of an ABCA4 coding sequence (CDS). In some embodiments, the UTR comprises a sequence encoding an enhancer. In some embodiments, the sequence encoding the enhancer comprises a sequence isolated or derived from a cytomegalovirus (CMV) (a CMV enhancer). In some embodiments, the sequence encoding the enhancer does not comprise a sequence isolated or derived from a cytomegalovirus (CMV) (a CMV enhancer).
In some embodiments, the first nucleic acid sequence further comprises a sequence encoding an Intron and an Exon (IntEx) and a UTR, wherein the UTR does not comprise a sequence isolated or derived from a cytomegalovirus (CMV) (a CMV enhancer).
In some embodiments of AAV vector systems of the disclosure, the second nucleic acid sequence comprises a post-transcriptional response element (PRE); preferably a Woodchuck hepatitis virus post-transcriptional response element (WPRE).
In some embodiments of AAV vector systems of the disclosure, the second nucleic acid sequence comprises a bovine Growth Hormone (bGH) poly-adenylation sequence.
In some embodiments of AAV vector systems of the disclosure, the first nucleic acid sequence or the second nucleic acid sequence further comprises a sequence encoding a 5′ inverted terminal repeat (ITR) and a sequence encoding a 3′ ITR. In some embodiments, the sequence encoding a 5′ ITR comprises a wild type sequence isolated or derived of a serotype 2 AAV (AAV2). In some embodiments, the sequence encoding the 5′ ITR comprises the sequence of SEQ ID NO: 27 or a deletion variant thereof. In some embodiments, the sequence encoding a 3′ ITR comprises a wild type sequence isolated or derived of an AAV2. In some embodiments, the sequence encoding the 3′ ITR comprises the sequence of SEQ ID NO: 30 or a deletion variant thereof. In some embodiments, the deletion variant comprises or consists of 10, 20, 30, 40, 50, 70, 80, 90, 100, 110, 120, 130, 140, 144 nucleotides or any number in between of nucleotides. In some embodiments, the deletion variant comprises one or more deletions. In some embodiments, the deletion variant comprises at least two deletions. In some embodiments, the at least two deletions are not contiguous. In some embodiments, the one or more deletions comprises a truncation of the ITR at either the 5′ or the 3′ end. In some embodiments, the deletion variant comprises a deletion of any one of the nucleotides of SEQ ID NO: 27. In some embodiments, the deletion variant comprises a deletion of any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or any number of nucleotides in between of SEQ ID NO: 27. In some embodiments, the deletion variant comprises a deletion of any one of the nucleotides of SEQ ID NO: 30. In some embodiments, the deletion variant comprises a deletion of any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or any number of nucleotides in between of SEQ ID NO: 30.
In some embodiments of AAV vector systems of the disclosure, the first nucleic acid sequence or the second nucleic acid sequence further comprises a sequence encoding a 5′ inverted terminal repeat (ITR) and a sequence encoding a 3′ ITR. In some embodiments, the sequence encoding a 5′ ITR comprises a wild type sequence isolated or derived of a serotype 2 AAV (AAV2). In some embodiments, the sequence encoding the 5′ ITR comprises the sequence of
In some embodiments, the sequence encoding a 3′ ITR comprises a wild type sequence isolated or derived of an AAV2. In some embodiments, the sequence encoding the 3′ ITR comprises the sequence of
In some embodiments of AAV vector systems of the disclosure, the first nucleic acid sequence or the second nucleic acid sequence further comprises a sequence encoding a 5′ inverted terminal repeat (ITR) and a sequence encoding a 3′ ITR. In some embodiments, the sequence encoding a 5′ ITR comprises a wild type sequence isolated or derived of a serotype 2 AAV (AAV2). In some embodiments, the sequence encoding the 5′ ITR comprises the sequence of
In some embodiments, the sequence encoding a 3′ ITR comprises a wild type sequence isolated or derived of an AAV2. In some embodiments, the sequence encoding the 3′ ITR comprises the sequence of
The disclosure provides a cell comprising an AAV vector of the disclosure.
The disclosure provides a cell comprising a nucleotide encoding an AAV vector of the disclosure.
The disclosure provides a cell comprising a composition of the disclosure.
In some embodiments of the cells of the disclosure, the cell is a retinal cell. In some embodiments, the cell is a neuronal cell. In some embodiments, the cell is a photoreceptor cell. In some embodiments, the cell is a hexagonal cell of the retinal pigment epithelium (RPE).
The disclosure provides a method for expressing a human ABCA4 protein in a target cell, the method comprising the steps of: transducing the target cell with a first AAV vector and a second AAV vector of the disclosure, such that a functional ABCA4 protein is expressed in the target cell.
The disclosure provides a nucleic acid sequence comprising a 5′ end portion of an ABCA4 CDS, wherein the 5′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3805 of SEQ ID NO: 1.
The disclosure provides an AAV vector comprising a nucleic acid sequence comprising a 3′ end portion of an ABCA4 CDS, wherein the 3′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 3598 to 6926 of SEQ ID NO: 1.
The disclosure provides a pharmaceutical composition comprising an AAV vector or an AAV vector system of the disclosure and a pharmaceutically acceptable excipient.
The disclosure provides a nucleic acid, a vector, an AAV vector, a composition, an AAV vector system, or a pharmaceutical composition of the disclosure for use in gene therapy.
The disclosure provides a nucleic acid, a vector, an AAV vector, a composition, an AAV vector system, or a pharmaceutical composition of the disclosure for use in preventing or treating disease characterized by degradation of retinal cells.
The disclosure provides a nucleic acid, a vector, an AAV vector, a composition, an AAV vector system, or a pharmaceutical composition of the disclosure for use in preventing or treating Stargardt disease.
The disclosure provides a method for preventing or treating a disease characterized by degradation of retinal cells comprising administering to a subject in need thereof an effective amount of a nucleic acid, a vector, an AAV vector, a composition, an AAV vector system, or a pharmaceutical composition of the disclosure.
The disclosure provides a method for preventing or treating Stargardt Disease comprising administering to a subject in need thereof an effective amount of a nucleic acid, a vector, an AAV vector, a composition, an AAV vector system, or a pharmaceutical composition of the disclosure.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
SEQ ID NO: 59 pAAV.stbITR.CMV.CBA.5′ABCA4.kan comprising a sequence encoding a 5′ IR (AAV2 derived ITR, nucleotides 16-130, SEQ ID NO: 60), a sequence encoding a CMV enhancer (nucleotides 322-556, SEQ ID NO: 61), a sequence encoding a CBA promotor (nucleotides 571-849, SEQ ID NO: 62), a sequence encoding a 5′ABCA4 (nucleotides 856-4557, SEQ ID NO: 63), and a sequence encoding a 3′ IR (nucleotides 4595-4715, SEQ ID NO: 64).
Stargardt disease is an inherited disease of the retina that can lead to blindness through the destruction of light-sensing photoreceptor cells in the eye. The disease commonly presents in childhood leading to blindness in young people. The development of Stargardt disease during childhood and adolescence can lead to severe vision loss in patients in their early twenties. Stargardt disease is the most common form of inherited juvenile macular dystrophy. Stargardt disease is an orphan disease that affects approximately 1 in 10,000 people. There are 65,000 Stargardt patients in the United States, France, Germany, Italy, Spain and United Kingdom.
The most common form of Stargardt disease is a recessive disorder linked to mutations in the gene encoding the protein ATP Binding Cassette, sub-family A, member 4 (ABCA4). ABCA4 is a large, transmembrane protein that plays a role in the recycling of light-sensitive pigments in retinal cells. The ABCA4 transmembrane protein plays a key role in clearing away toxic byproducts from the visual cycle. In Stargardt disease, mutations in the ABCA4 gene lead to a lack of functional ABCA4 protein in retinal cells. This in turn leads to the formation and accumulation of bisretinoid by-products, producing toxic granules of lipofuscin in Retinal Pigment Epithelial (RPE) cells. This causes degradation and eventual destruction of the RPE cells, which leads to loss of photoreceptor cells causing progressive loss of vision and eventual blindness. The absence of functional ABCA4 leads to degeneration of photoreceptors. Progressive photoreceptor degeneration leads to blindness.
Prior to the development of the compositions and methods of the disclosure, there were no treatment options. Prior to the development of the compositions and methods of the disclosure, there was a long-felt but unmet need for an effective treatment for Stargardt disease that addresses the underlying cause of the disease.
Gene therapy is a promising treatment for Stargardt disease. The aim of gene therapy is to correct the deficiency underlying the disease by using a vector to introduce a functional ABCA4 gene into the affected photoreceptor cells, thus restoring ABCA4 function.
The disclosure provides vectors derived from adeno-associated virus (AAV) for retinal gene therapy. AAV is a small virus that presents very low immunogenicity and is not associated with any known human disease. The lack of an associated inflammatory response means that AAV does not cause retinal damage when injected into the eye.
The size of the AAV capsid may imposes a limit on the amount of DNA that can be packaged within it. The AAV genome is approximately 4.7 kilobases (kb) in size, and, for some AAV vectors and serotypes, the corresponding upper size limit for DNA packaging in AAV may be approximately 5 kb. Thus, a limiting factor includes the size restriction of the encodable AAV transgene at under 5 kb. Stargardt disease is the most prevalent form of recessively inherited blindness and is caused by mutations in ABCA4.
The coding sequence of the ABCA4 gene is approximately 6.8 kb in size (with further genetic elements for gene expression). Thus, the size of coding sequence of the ABCA4 gene with further genetic elements appear to be larger than the standard AAV vector upper size limit.
A number of approaches to overcome this upper size limit and express large genes such as ABCA4 from AAV vectors are described herein. These approaches include “oversize” vector approaches and “dual” vector approaches.
A number of attempts have been made to force genes considerably larger than the native 4.7 kb genome into AAV vectors, with some success in transducing target cells. By way of example, Allocca et al. (J. Clin. Invest. vol. 118, No. 5, May 2008) prepared oversize AAV vectors packaging the murine ABCA4 and human MYO7A genes and demonstrated protein expression following transduction of mouse retinal cells. However, while it was proposed by Allocca et al. that certain AAV capsids could accommodate up to 8.9 kb, subsequent studies have found that the “oversize” approach does not in fact overcome the packaging upper size limit, but rather leads to truncation of the transgene in a random manner, providing a heterogeneous population of AAV vectors each comprising a fragment of the transgene (Dong et al., Molecular Therapy, vol. 18, No. 1, January 2010). It is believed that a proportion of oversize vectors in a given population package large enough fragments of the oversized transgene such that regions of overlap between the fragments exist, allowing re-assembly into a full length gene following transduction of a target cell. However, this method is unpredictable and inefficient, with the lack of packaging control and subsequent failure of recombination providing a significant barrier to consistent, detectable success.
A more successful approach is to prepare dual vector systems, in which a transgene larger than the approximately 5 kb limit is split approximately in half into two separate vectors of defined sequence: an “upstream” vector containing the 5′ portion of the transgene, and a “downstream” vector containing the 3′ portion of the transgene. Transduction of a target cell by both upstream and downstream vectors allows a full-length transgene to be re-assembled from the two fragments using a variety of intracellular mechanisms.
In a so-called “trans-splicing” dual vector approach, a splice-donor signal is placed at the 3′ end of the upstream transgene fragment and a splice-acceptor signal placed at the 5′ end of the downstream transgene fragment. Upon transduction of a target cell by the dual vectors, inverted terminal repeat (ITR) sequences present in the AAV genome mediate head-to-tail concatermerization of the transgene fragments and trans-splicing of the transcripts results in the production of a full-length mRNA sequence, allowing full-length protein expression.
An alternative dual vector system uses an “overlapping” approach. In an overlapping dual vector system, part of the coding sequence at the 3′ end of the upstream coding sequence portion overlaps with a homologous sequence at the 5′ of the downstream coding sequence portion. AAVs package linear single stranded DNAs (ssDNAs). In an overlapping dual vector approach, a double-stranded transgene is split into a 5′ portion (sense, upstream)) and a 3′ portion (antisense, downstream), which overlap at the 3′ end of the 5′ portion and the 5′ end of the 3′ portion. The 5′ portion and 3′ portion are each encoded by an AAV vector (upstream and downstream vectors), which are each encapsidated in AAV viral particles as ssDNAs. Upon transduction of a cell by the upstream AAV particle and the downstream AAV particle, the infected cell or a nucleus thereof comprises an upstream AAV vector and a downstream AAV vector. When the same infected cell comprises a complementary upstream AAV vector and downstream AAV vector, each having a single-stranded sequence to which the other can hybridize, the complementary ssDNAs encoding the 5′ portion and the 3′ portion can generate the full length transgene.
Without wishing to be bound by any particular theory, a full length transgene (e.g. ABCA4) may be generated from an overlapping dual vector system by second strand synthesis, followed by homologous recombination. Upon transduction of cell by an upstream AAV particle and a downstream particle, a corresponding ssDNA upstream AAV vector and a downstream AAV vector is released into the cell or a nucleus thereof, and a dsDNA comprising the 5′ (upstream) portion of the transgene and the 3′ (downstream) portion of the transgene are generated from each of the ssDNAs by second strand synthesis. The dsDNA then undergoes homologous recombination at the region of overlap between the upstream and downstream portions of coding sequence, which allows for the recreation of a full-length transgene, from which a corresponding mRNA can be transcribed and full-length protein expressed. For example, WO 2014/170480 describes a dual AAV vector system encoding a human ABCA4 protein (the contents of which are incorporated herein in their entirety).
In some embodiments of the compositions and methods of the disclosure, a first AAV vector comprises a 5′ portion of an ABCA4 coding sequence. In some embodiments, a second AAV vector comprises a 3′ portion of an ABCA4 coding sequence. In some embodiments, the 5′ end portion and the 3′ end portion overlap by at least about 20 nucleotides. In some embodiments, the first AAV vector and the second AAV vector each comprise a single stranded DNA (ssDNA). In some embodiments, the first AAV vector comprises a sequence of the ABCA4 coding sequences and/or a sequence complementary to the ABCA4 coding sequence. In some embodiments, the second AAV vector comprises a sequence of the ABCA4 coding sequences and/or a sequence complementary to the ABCA4 coding sequence. In some embodiments, the first AAV vector comprises a sequence of the 5′ ABCA4 coding sequences and a sequence complementary to a portion of the 3′ ABCA4 coding sequence. In some embodiments, the second AAV vector comprises a sequence of the 3′ ABCA4 coding sequence and a sequence complementary to a portion of the 5′ ABCA4 coding sequence. In some embodiments, the first AAV vector and the second AAV vector undergo second strand synthesis to generate a first dsDNA AAV vector and a second dsDNA AAV vector. In some embodiments, the first dsDNA AAV vector and the second dsDNA AAV vector generate a full length ABCA4 transgene through homologous recombination.
Without wishing to be bound by any particular theory, a full length transgene may also be generated from an overlapping dual vector system through single-strand annealing and second strand synthesis. Upon transduction of a cell by an upstream AAV vector and a downstream AAV vector, wherein each of the upstream AAV vector and the downstream AAV vector comprises a ssDNA, and wherein the upstream AAV vector comprises a sequence encoding a 5′ portion of the transgene and the downstream AAV vector comprises a sequence encoding a 3′ portion of the transgene, the complementary upstream and downstream vectors are released into the cell or a nucleus thereof. In some embodiments, the upstream AAV vector comprises a sequence encoding a 5′ portion of the transgene and a sequence complementary to a 3′ portion of the transgene. In some embodiments, the upstream AAV vector comprises a sense sequence encoding a 5′ portion of the transgene and a sequence complementary to a 3′ portion of the transgene. In some embodiments, the upstream AAV vector comprises an antisense sequence encoding a 5′ portion of the transgene and a sequence complementary to a 3′ portion of the transgene. In some embodiments, the downstream AAV vector comprises a sequence encoding a 3′ portion of the transgene and a sequence complementary to a 5′ portion of the transgene. In some embodiments, the downstream AAV vector comprises an antisense sequence encoding a 3′ portion of the transgene and a sequence complementary to a 5′ portion of the transgene. In some embodiments, the downstream AAV vector comprises a sense sequence encoding a 3′ portion of the transgene and a sequence complementary to a 5′ portion of the transgene. In some embodiments, the upstream and downstream vectors hybridize at the region of complementarity (overlap). Following hybridization, a full length transgene is generated by second strand synthesis.
In some embodiments of the compositions and methods of the disclosure, a first AAV vector comprises a 5′ portion of an ABCA4 coding sequence, a second AAV vector comprises a 3′ portion of an ABCA4 coding sequence, and the 5′ portion and the 3′ portion overlap by at least 20 contiguous nucleotides. In some embodiments, the first AAV vector and the second AAV vector each comprise a single stranded DNA (ssDNA). In some embodiments, the first AAV vector comprises a sequence of the ABCA4 coding sequence and the second AAV vector comprises a sequence complementary to the ABCA4 coding sequence. In some embodiments, the second AAV vector comprises a sequence of the ABCA4 coding sequence and the first AAV vector comprises a sequence complementary to the ABCA4 coding sequence. In some embodiments, the first AAV vector and the second AAV vector anneal at a complementary overlapping region to generate a full length dsDNA ABCA4 transgene by subsequent second strand synthesis. In some embodiments, the full length dsDNA ABCA4 transgene is generated in vitro or in vivo (in a cell or in a subject).
The disclosure addresses the above prior art problems by providing adeno-associated viral (AAV) vector systems as described in the claims.
Dual vector approaches increase the capacity of AAV gene therapy, but may also substantially reduce levels of target protein which may be insufficient to achieve a therapeutic effect. In some embodiments of dual vector systems, the efficacy of recombination of dual vectors depends on the length of DNA overlap between the plus and minus strands (sense and antisense strands).The size of the ABCA4 coding sequence allows for the exploration of various lengths of overlap between the plus and minus strands to identify zones for optimal dual vector strategies for the treatment of disorders caused by mutations in large genes. These strategies can lead to production of enough target protein to provide therapeutic effect. In the Stargardt mouse model, therapeutic effect can be readily assessed as the target protein, ABCA4, is required in abundance in the photoreceptor cells of the retina and its absence induces the accumulation of bisretinoid compounds, which in turn leads to an increase in 790 nm autofluorescence. The therapeutic potential of the overlapping dual vector system can be validated in vivo by observing a reduction in this bisretinoid accumulation and subsequent 790 nm autofluorescence levels following treatment.
Advantageously, the AAV vector system of the disclosure provides surprisingly high levels of expression of full-length ABCA4 protein in transduced cells, with limited production of unwanted truncated fragments of ABCA4. With an optimized recombination, the full length ABCA4 protein is expressed in the photoreceptor outer segments in Abca4−/− mice and at levels sufficient to reduce bisretinoid formation and correct the autofluorescent phenotype on retinal imaging. These observations support a dual vector approach for AAV gene therapy to treat Stargardt disease.
Stargardt disease resulting from mutations in the ABCA4 gene is the most common inherited macular dystrophy, affecting 1 in 8,000-10,000 people and resulting from mutations in the ABCA4 gene. ABCA4 mutations which responsible for Stargardt disease and other cone and cone-rod dystrophies. Stargardt disease resulting from mutations in the ABCA4 gene is the most common cause of blindness in children in the developed world. The disease often presents in childhood and becomes progressively worse over the course of a patient's lifetime therefore therapeutic intervention at any point could prevent or slow further sight loss. This disease is progressive, and often becomes symptomatic in childhood but after the period of visual development, which provides ample opportunity for therapeutic intervention to prevent or slow further sight loss.
ABCA4 clears toxic metabolites from the photoreceptor outer segments discs. The absence of functional ABCA4 leads to photoreceptor degeneration. Photoreceptor outer segment discs comprise the light sensing protein rhodopsin and the transmembrane protein ABCA4. ABCA4 controls the export of certain toxic visual cycle byproducts. Visual pigments comprise an opsin and a chromophore, for example a retinoid such as 11-cis-retinal. In the visual cycle, sometimes termed the retinoid cycle, retinoids are bleached and recycled between the photoreceptors and the retinal pigment epithelium (RPE). Upon activation of rhodopsin during phototransduction, 11-cis-retinal is isomerized to all-trans-retinal, which dissociates from the opsin. All-trans-retinal is transported to the RPE, and either stored or converted back to 11-cis-retinal and transported back to photoreceptors to complete the visual cycle.
Mutations in ABCA4 prevent the transport of retinoids from photoreceptor cell disc outer membranes to the retinal pigment epithelium (RPE), which leads to a build-up of undesired retinoid derivatives in the photoreceptor outer segments. Due to constant generation of photoreceptor outer segments, as older discs become more terminal they are consumed by the RPE. In photoreceptor cells carrying mutant, non-functional ABCA4, bisretinoids retained in the disc membranes build up in the RPE cells with further biochemical processes taking place that lead to formation of the toxicity compound A2E, a key element of lipofuscin. ABCA4 mutations are associated with the build-up of toxins in the photoreceptors and the RPE. Exemplary toxins include, but are not limited to, all-trans-retinal, bisretinoids and lipofuscin.
Lack of functional ABCA4 prevents the transport of free retinaldehyde from the luminal to the cytoplasmic side of the photoreceptor cell disc outer membranes, resulting in increased formation, or amplifying, the formation of retinoid dimers (bisretinoids). Upon daily phagocytosis of the distal outer segments of photoreceptor cells by the retinal pigment epithelium (RPE), the retinoid derivatives are processed further, leading to accumulation of bisretinoids. The retinoid derivatives are processed but are insoluble and accumulate. The outcome of this accumulation leads to dysfunction and eventual death of the RPE cells with subsequent secondary loss of the overlying photoreceptors through degeneration and subsequent death. The inventors have characterized the fundus changes in the pigmented Abca4−/− mouse model and documented the positive effects of deuterised vitamin A on fundus fluorescence and bisretinoid accumulation. In this disclosure, the inventors show that delivery of ABCA4 to the photoreceptors of the Abca4−/− mouse model using an overlapping AAV dual vector system reduces the buildup of toxic bisretinoids, such an effect in a patient with Stargardt disease could prevent death of the RPE cells and the degeneration and death of the photoreceptor cells they support.
In some embodiments of the compositions and methods of the disclosure, the AAV dual vector system of the disclosure generates as a full length ABCA4 transgene in one or more cells of an eye of subject. In some embodiments, the subject has Stargardt disease. In some embodiments, the one or more cells comprise photoreceptor cells. In some embodiments, the one or more cells comprise RPE cells. In some embodiments, the one or more cells comprise RPE cells, photoreceptor cells, or a combination thereof.
In some embodiments of the compositions and methods of the disclosure, expression of the ABCA4 transgene in the one or more cells of the eye of the subject slows the degeneration of photoreceptor cells. In some embodiments, the one or more cells comprise RPE cells, photoreceptor cells, or a combination thereof. In some embodiments, expression of the ABCA4 transgene in the one or more cells of the eye of the subject prevents the death of photoreceptor cells. In some embodiments, expression of the ABCA4 transgene in the one or more cells of the eye of the subject prevents the degeneration of photoreceptor cells. In some embodiments, expression of the ABCA4 transgene in the one or more cells of the eye of the subject restores the photoreceptor cells to healthy or viable photoreceptor cells.
In some embodiments, expression of the ABCA4 transgene in the one or more cells of the eye of the subject prevents the death of RPE cells. In some embodiments, expression of the ABCA4 transgene in the one or more cells of the eye of the subject prevents the death of RPE cells and the degeneration of photoreceptor cells.
Viral vectors are derived from wild type viruses which are modified using recombinant nucleic acid technologies to incorporate a non-native nucleic acid sequence (or transgene) into the viral genome. The ability of viruses to target and infect specific cells is used to deliver the transgene into a target cell, leading to the expression of the gene and the production of the encoded gene product.
The disclosure relates to vectors derived from adeno-associated virus (AAV).
A potentially limiting factor of adeno-associated viral (AAV) vectors is the size restriction of the encodable DNA transgene at under 5 kb.
Stargardt disease is the most prevalent form of recessively inherited blindness and is caused by mutations in ABCA4, which has a coding sequence length of 6.8 kb. Dual vector approaches increase the capacity of AAV gene therapy but questions have been raised regarding whether the levels of target protein generated would be sufficient to achieve a therapeutic effect. Additionally, dual vectors commonly produce unwanted truncated proteins. Here, we describe a systematic approach for optimizing an overlapping AAV dual vector system for delivery of the 6.8 kb coding sequence of human ABCA4, mutations in which cause Stargardt disease, the most common form of recessively inherited blindness in young people. The data of the disclosure demonstrate an optimized overlapping dual vector strategy to deliver full length ABCA4 to the photoreceptor outer segments of Abca4−/− mice at levels that enabled a therapeutic effect whilst reducing to undetectable levels truncated protein forms.
In vitro and in vivo assessments generated full-length ABCA4 protein following transduction with overlapping dual vectors and improvements were achieved by identifying an optimal region of overlap and including a 5′ untranslated region in the upstream transgene and a Woodchuck hepatitis virus post-transcriptional regulatory element in the downstream transgene. Truncated ABCA4 was reduced through specific sequence selections in the downstream transgene. The optimized overlapping dual vector system generated functional ABCA4 protein in the photoreceptor outer segments of Abca4−/− mice, leading to a therapeutic effect. This was quantified by a reduction in bisretinoid and A2E levels in treated eyes 3 months post-injection and in lipofuscin and melanin-related autofluorescence at 6 months post-injection. These observations support a dual vector approach in future clinical trials using AAV gene therapy to treat Stargardt disease.
The disclosure provides an adeno-associated viral (AAV) vector system for expressing a human ABCA4 protein in a target cell, the AAV vector system comprising a first AAV vector comprising a first nucleic acid sequence and a second AAV vector comprising a second nucleic acid sequence; wherein the first nucleic acid sequence comprises a 5′ end portion of an ABCA4 coding sequence (CDS) and the second nucleic acid sequence comprises a 3′ end portion of an ABCA4 CDS, and the 5′ end portion and the 3′ end portion together encompass the entire ABCA4 CDS; wherein the first nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3597 of SEQ ID NO: 1; wherein the second nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 3806 to 6926 of SEQ ID NO: 1; wherein the first nucleic acid sequence and the second nucleic acid sequence each comprise a region of sequence overlap with the other; and wherein the region of sequence overlap comprises at least about 20 contiguous nucleotides of a nucleic acid sequence corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1.
AAV vectors in general are well known in the art and a skilled person is familiar with general techniques suitable for their preparation from his common general knowledge in the field. The skilled person's knowledge includes techniques suitable for incorporating a nucleic acid sequence of interest into the genome of an AAV vector.
The term “AAV vector system” is used to embrace the fact that the first and second AAV vectors are intended to work together in a complementary fashion.
The first and second AAV vectors of the AAV vector system of the disclosure together encode an entire ABCA4 transgene. Thus, expression of the encoded ABCA4 transgene in a target cell requires transduction of the target cell with both first (upstream) and second (downstream) vectors.
The AAV vectors of the AAV vector system of the disclosure can be in the form of AAV particles (also referred to as virions). An AAV particle comprises a protein coat (the capsid) surrounding a core of nucleic acid, which is the AAV genome. The present disclosure also encompasses nucleic acid sequences encoding AAV vector genomes of the AAV vector system described herein.
SEQ ID NO: 1 is the human ABCA4 nucleic acid sequence corresponding to NCBI Reference Sequence NM_000350.2. SEQ ID NO: 1 is identical to NCBI Reference Sequence NM_000350.2. The ABCA4 coding sequence spans nucleotides 105 to 6926 of SEQ ID NO: 1.
The first AAV vector comprises a first nucleic acid sequence comprising a 5′ end portion of an ABCA4 CDS. A 5′ end portion of an ABCA4 CDS is a portion of the ABCA4 CDS that includes its 5′ end. Because it is only a portion of a CDS, the 5′ end portion of an ABCA4 CDS is not a full-length (i.e. is not an entire) ABCA4 CDS. Thus, the first nucleic acid sequence (and thus the first AAV vector) does not comprise a full-length ABCA4 CDS.
The second AAV vector comprises a second nucleic acid sequence comprising a 3′ end portion of an ABCA4 CDS. A 3′ end portion of an ABCA4 CDS is a portion of the ABCA4 CDS that includes its 3′ end. Because it is only a portion of a CDS, the 3′ end portion of an ABCA4 CDS is not a full-length (i.e. is not an entire) ABCA4 CDS. Thus, the second nucleic acid sequence (and thus the second AAV vector) does not comprise a full-length ABCA4 CDS.
The 5′ end portion and 3′ end portion together encompass the entire ABCA4 CDS (with a region of sequence overlap, as discussed below). Thus, a full-length ABCA4 CDS is contained in the AAV vector system of the disclosure, split across the first and second AAV vectors, and can be reassembled in a target cell following transduction of the target cell with the first and second AAV vectors.
The first nucleic acid sequence as described above comprises a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3597 of SEQ ID NO: 1. The ABCA4 CDS begins at nucleotide 105 of SEQ ID NO: 1.
The second nucleic acid sequence as described above comprises a sequence of contiguous nucleotides corresponding to nucleotides 3806 to 6926 of SEQ ID NO: 1.
In order to encompass the entire ABCA4 CDS, the first and second nucleic acid sequences each further comprise at least a portion of the ABCA4 CDS corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1, such that when the first and second nucleic acid sequences are aligned the entirety of ABCA4 CDS corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1 is encompassed. Thus, when aligned, the first and second nucleic acid sequences together encompass the entire ABCA4 CDS.
Furthermore, the first and second nucleic acid sequences comprise a region of sequence overlap allowing reconstruction of the entire ABCA4 CDS as part of a full-length transgene inside a target cell transduced with the first and second AAV vectors of the disclosure.
When the first and second nucleic acid sequences are aligned with each other, a region at the 3′ end of the first nucleic acid sequence overlaps with a corresponding region at the 5′ end of the second nucleic acid sequence. Thus, both the first and second nucleic acid sequences comprise a portion of the ABCA4 CDS that forms the region of sequence overlap.
In some embodiments, the region of overlap between the first and second nucleic acid sequences comprises at least about 20 contiguous nucleotides of the portion of the ABCA4 CDS corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1.
In some embodiments, the region of overlap may extend upstream and/or downstream of said 20 contiguous nucleotides. Thus, the region of overlap may be more than 20 nucleotides in length.
The region of overlap may comprise nucleotides upstream of the position corresponding to nucleotide 3598 of SEQ ID NO: 1. Alternatively, or in addition, the region of overlap may comprise nucleotides downstream of the position corresponding to nucleotide 3805 of SEQ ID NO: 1.
Alternatively, the region of nucleic acid sequence overlap may be contained within the portion of the ABCA4 CDS corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1.
Thus, in one embodiment, the region of nucleic acid sequence overlap is between 20 and 550 nucleotides in length; preferably between 50 and 250 nucleotides in length; preferably between 175 and 225 nucleotides in length; preferably between 195 and 215 nucleotides in length.
In one embodiment, the region of nucleic acid sequence overlap comprises at least about 50 contiguous nucleotides of a nucleic acid sequence corresponding to nucleotides 3598 to 3805 of SEQ ID NO: 1; preferably at least about 75 contiguous nucleotides; preferably at least about 100 contiguous nucleotides; preferably at least about 150 contiguous nucleotides; preferably at least about 200 contiguous nucleotides; preferably all 208 contiguous nucleotides.
In certain preferred embodiments, the region of nucleic acid sequence overlap commences at the nucleotide corresponding to nucleotide 3598 of SEQ ID NO: 1. The term “commences” means that the region of nucleic acid sequence overlap runs in the direction 5′ to 3′ starting from the nucleotide corresponding to nucleotide 3598 of SEQ ID NO: 1. Thus, in a preferred embodiment, the most 5′ nucleotide of the region of nucleic acid sequence overlap corresponds to nucleotide 3598 of SEQ ID NO: 1.
In certain preferred embodiments, the region of nucleic acid sequence overlap between the first nucleic acid sequence and the second nucleic acid sequence vector corresponds to nucleotides 3598 to 3805 of SEQ ID NO: 1.
A construction of dual AAV vectors comprising a region of nucleic acid sequence overlap as described above can reduce the level of translation of unwanted truncated ABCA4 peptides.
The problem of translation of truncated ABCA4 peptides may arise in dual AAV vector systems when translation is initiated from mRNA transcripts derived from the downstream vector only. In this regard, AAV ITRs such as the AAV2 5′ ITR may have promoter activity; this together with the presence in a downstream vector of WPRE and bGH poly-adenylation sequences (as discussed below) may lead to the generation of stable mRNA transcripts from unrecombined downstream vectors. The wild-type ABCA4 CDS carries multiple in-frame AUG codons in its downstream portion that cannot be substituted for other codons without altering the amino acid sequence. This creates the possibility of translation occurring from the stable transcripts, leading to the presence of truncated ABCA4 peptides.
In certain preferred embodiments of the disclosure wherein the region of nucleic acid sequence overlap commences at the nucleotide corresponding to nucleotide 3598 of SEQ ID NO: 1, the starting sequence of the overlap zone includes an out-of-frame AUG (start) codon in good context (regarding the potential Kozak consensus sequence) prior to an in-frame AUG codon in weaker context in order to encourage the translational machinery to initiate translation of unrecombined downstream-only transcripts from an out-of-frame site. In certain particularly preferred embodiments of the disclosure, there are in total four out-of-frame AUG codons in various contexts prior to the in-frame AUG. All of these translate to a STOP codon within 10 amino acids, thus preventing the translation of unwanted truncated ABCA4 peptides.
In certain preferred embodiments, the first nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3805 of SEQ ID NO: 1, and the second nucleic acid sequence comprises a sequence of contiguous nucleotides corresponding to nucleotides 3598 to 6926 of SEQ ID NO: 1, so encompassing the region of nucleic acid sequence overlap as described above.
Thus, in certain preferred embodiments, the 5′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3805 of SEQ ID NO: 1, and the 3′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 3598 to 6926 of SEQ ID NO: 1.
In certain preferred embodiments, the 5′ end portion of an ABCA4 CDS consists of nucleotides 105 to 3805 of SEQ ID NO: 1, and the 3′ end portion of an ABCA4 CDS consists of nucleotides 3598 to 6926 of SEQ ID NO: 1.
Thus, in certain preferred embodiments, the disclosure provides an AAV vector system for expressing a human ABCA4 protein in a target cell, the AAV vector system comprising a first AAV vector comprising a first nucleic acid sequence and a second AAV vector comprising a second nucleic acid sequence, wherein the first nucleic acid sequence comprises a 5′ end portion of an ABCA4 coding sequence (CDS) and the second nucleic acid sequence comprises a 3′ end portion of an ABCA4 CDS, and the 5′ end portion and the 3′ end portion together encompass the entire ABCA4 CDS; wherein the 5′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3805 of SEQ ID NO: 1, and wherein the 3′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 3598 to 6926 of SEQ ID NO: 1.
In certain preferred embodiments, the disclosure provides an AAV vector system for expressing a human ABCA4 protein in a target cell, the AAV vector system comprising a first AAV vector comprising a first nucleic acid sequence and a second AAV vector comprising a second nucleic acid sequence, wherein the first nucleic acid sequence comprises a 5′ end portion of an ABCA4 coding sequence (CDS) and the second nucleic acid sequence comprises a 3′ end portion of an ABCA4 CDS, and the 5′ end portion and the 3′ end portion together encompass the entire ABCA4 CDS; wherein the 5′ end portion of an ABCA4 CDS consists of nucleotides 105 to 3805 of SEQ ID NO: 1, and wherein the 3′ end portion of an ABCA4 CDS consists of nucleotides 3598 to 6926 of SEQ ID NO: 1.
In accordance with the term “consists of”, in embodiments wherein the 5′ end portion of an ABCA4 CDS and the 3′ end portion of an ABCA4 CDS consist of specific sequences of contiguous nucleotides as described above, then the first nucleic acid sequence and the second nucleic acid sequence each do not comprise any additional ABCA4 CDS.
In certain embodiments, each of the first AAV vector and the second AAV vector comprises 5′ and 3′ Inverted Terminal Repeats (ITRs).
In certain embodiments, the AAV genome of a naturally derived serotype, isolate or clade of AAV comprises at least one inverted terminal repeat sequence (ITR). An ITR sequence acts in cis to provide a functional origin of replication and allows for integration and excision of the vector from the genome of a cell. AAV ITRs are believed to aid concatemer formation in the nucleus of an AAV-infected cell, for example following the conversion of single-stranded vector DNA into double-stranded DNA by the action of host cell DNA polymerases. The formation of such episomal concatemers may serve to protect the vector construct during the life of the host cell, thereby allowing for prolonged expression of the transgene in vivo.
Thus, in some embodiments, the ITRs are AAV ITRs (i.e. ITR sequences derived from ITR sequences found in an AAV genome).
The first and second AAV vectors of the AAV vector system of the disclosure together comprise all of the components necessary for a fully functional ABCA4 transgene to be re-assembled in a target cell following transduction by both vectors. A skilled person is aware of additional genetic elements commonly used to ensure transgene expression in a viral vector-transduced cell. These may be referred to as expression control sequences. Thus, the AAV vectors of the AAV viral vector system of the disclosure may comprise expression control sequences (e.g. comprising a promoter sequence) operably linked to the nucleotide sequences encoding the ABCA4 transgene.
5′ expression control sequences components can be located in the first (“upstream”) AAV vector of the viral vector system, while 3′ expression control sequences can be located in the second (“downstream”) AAV vector of the viral vector system.
Thus, in some embodiments, the first AAV vector may comprise a promoter operably linked to the 5′ end portion of an ABCA4 CDS. The promoter may be required by its nature to be located 5′ to the ABCA4 CDS, hence its location in the first AAV vector.
Any suitable promoter may be used, the selection of which may be readily made by the skilled person. The promoter sequence may be constitutively active (i.e. operational in any host cell background), or alternatively may be active only in a specific host cell environment, thus allowing for targeted expression of the transgene in a particular cell type (e.g. a tissue-specific promoter). The promoter may show inducible expression in response to presence of another factor, for example a factor present in a host cell. In those embodiments where the vector is administered for therapy, the promoter should be functional in the target cell background.
In some embodiments, the promoter shows retinal-cell specific expression in order to allow for the transgene to only be expressed in retinal cell populations. Thus, expression from the promoter may be retinal-cell specific, for example confined only to cells of the neurosensory retina and retinal pigment epithelium.
An exemplary promoter suitable for use in the present disclosure is the chicken beta-actin (CBA) promoter, optionally in combination with a cytomegalovirus (CMV) enhancer element. Another exemplary promoter for use in the disclosure is a hybrid CBA/CAG promoter, for example the promoter used in the rAVE expression cassette (GeneDetect.com).
Examples of promoters based on human sequences that induce retina-specific gene expression include rhodopsin kinase for rods and cones, PR2.1 for cones only, and RPE65 for the retinal pigment epithelium.
Gene expression may be achieved using a GRK1 promoter. Thus, in certain embodiments, the promoter is a human rhodopsin kinase (GRK1) promoter.
In some embodiments, the GRK1 promoter sequence of the disclosure comprises or consists of 199 nucleotides in length and comprises or consists of nucleotides−112 to +87 of the GRK1 gene. In certain preferred embodiments, the promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 5 or a variant thereof having at least 90% (e.g. at least 90%, 95%, 96%,97%, 98%,99%, 99.1%,99.2%,99.3% 99.4%, 99.5% 99.6%,99.7% 99.8% or 99.9%) sequence identity to SEQ ID NO: 5.
Elements may be included in both the upstream and downstream vectors of the disclosure to increase expression of ABCA4 protein. For example, the inclusion of an intron in a vector, such as the upstream vector of the disclosure, can increase the expression of an RNA or protein of interest from that vector. An intron is a nucleotide sequence within a gene that is removed by RNA splicing during RNA maturation. Introns can vary in length from tens of base pairs to multiple megabases. However, spliceosomal introns (i.e. introns that are spliced by the eukaryotic spliceosome) may comprise a splice donor (SD) site at the 5′ end of the intron, a branch site in the intron near the 3′ end, and a splice acceptor (SA) site at the 3′ end. These intron elements facilitate proper intron splicing. SD sites may comprise a consensus GU at the 5′ end of the intron and the SA site at the 3′ end of the intron may terminate with “AG.” Upstream of the SA site, introns often contain a region high in pyrimidines, which is between the branch point adenine nucleotide and the SA. Without wishing to be bound by any particular theory, the presence of an intron can affect the rate of RNA transcription, nuclear export or RNA transcript stability. Further, the presence of an intron may also increase the efficiency of mRNA translation, yielding more of a protein of interest (e.g. ABCA4).
In some embodiments of the vectors of the disclosure, the intron, the IntEx or the SA/SD (including a RBD SA/SD) may be one of several elements that function to increase protein expression from the vector. For example, the promoter and, optionally, an enhancer, can affect not just cell or tissue specificity of gene expression, but also the levels of mRNA that are transcribed from the vector. Promoters are regions of DNA that initiate RNA transcription. Depending on the specific sequence elements of the promoter, promoters may vary in strength and tissue specificity. Enhancers are DNA sequences that regulate transcription from promoters by affecting the ability of the promoter to recruit RNA polymerase and initiate transcription. Therefore, the choice of promoter, and optionally, the inclusion of an enhancer and/or the choice of the enhancer itself, in a vector can significantly affect the expression of a gene encoded by the vector. Exemplary promoters, such as the rhodopsin kinase promoter or chicken beta actin promoter, optionally combined with a CMV enhancer, are shown in
Elements in the non-coding sequences of the mRNA transcript itself can also affect protein levels of a sequence encoded in a vector. Without wishing to be limited by any particular theory, sequence elements in the mRNA untranslated regions (UTRs) can effect mRNA stability, which, in turn, affects levels of protein translation. An exemplary sequence element is a Posttranscriptional Regulatory Element (PRE) (e.g. a Woodchuck Hepatitis PRE (WPRE)), which increases mRNA stability. Exemplary promoters, enhancers, PREs, and the arrangement of these elements in vectors of the disclosure, are shown in
In some embodiments of the first AAV vector of the disclosure, the promoter may be operably linked with an intron and an exon sequence. In some embodiments of the first AAV vector of the disclosure, a nucleic acid sequence may comprise the promoter, an intron and an exon sequence. The intron and the exon sequence may be downstream of the promoter sequence. The intron and the exon sequence may be positioned between the promoter sequence and the upstream ABCA4 nucleic acid sequence (US-ABCA4). The presence of an intron and an exon may increase levels of protein expression. In some embodiments, the intron is positioned between the promoter and the exon. In some embodiments, including those embodiments wherein the intron is positioned between the promoter and the exon, the exon is positioned 5′ of the US-ABCA4 sequence. In some embodiments, the promoter comprises a promoter isolated or derived from a vertebrate gene. In some embodiments, the promoter is GRK1 promoter or a chicken beta actin (CBA) promoter.
The exon may comprise a coding sequence, a non-coding sequence, or a combination of both. In some embodiments, the exon comprises a non-coding sequence. In some embodiments, the exon is isolated or derived from a mammalian gene. In embodiments, the mammal is a rabbit (Oryctolagus cuniculus). In some embodiments, the mammalian gene comprises a rabbit beta globin gene or a portion thereof. In some embodiments, the exon comprises or consists of a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the nucleic acid sequence of:
In some embodiments, the exon comprises or consists of a nucleic acid sequence having 100% identity to the nucleic acid sequence of:
Introns may comprise a splice donor site, a splice acceptor site or a branch point. Introns may comprise a splice donor site, a splice acceptor site and a branch point. Exemplary splice acceptor sites comprise nucleotides “GT” (“GU” in the pre-mRNA) at the 5′ end of the intron. Exemplary splice acceptor sites comprise an “AG” at the 3′ end of the intron. In some embodiments, the branch point comprises an adenosine (A) between 20 and 40 nucleotides, inclusive of the endpoints, upstream of the 3′ end of the intron. The intron may comprise an artificial or non-naturally occurring sequence. Alternatively, the intron may be isolated or derived from a vertebrate gene. The intron may comprise a sequence encoding a fusion of two sequences, each of which may be isolated or derived from a vertebrate gene. In some embodiments, a vertebrate gene from which the intron nucleic acid sequence or a portion thereof is derived comprises a chicken (Gallus gallus) gene. In some embodiments, the chicken gene comprises a chicken beta actin gene. In some embodiments, a vertebrate gene from which the intron nucleic acid sequence or a portion thereof is derived comprises a rabbit (Oryctolagus cuniculus) gene. In some embodiments, the rabbit gene comprises a rabbit beta globin gene or a portion thereof. In some embodiments, the intron comprises or consists of a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the nucleic acid sequence of:
In some embodiments, the intron comprises or consists of a nucleic acid sequence having 100% identity to the nucleic acid sequence of:
In some embodiments of the first (or upstream) AAV vector, the promoter comprises a hybrid promoter (a Cytomegalovirus (CMV) enhancer with a chicken beta actin (CBA) promoter). In some embodiments, the CMV enhancer sequence comprises or consists of a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least any percentage identity in between to the nucleic acid sequence of:
In some embodiments, the sequence encoding the first (or upstream) AAV vector comprises a sequence encoding a CBA promoter (without a CMV enhancer element), a sequence encoding an intron and a sequence encoding an exon. In some embodiments, the CBA promoter sequence comprises or consists of a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least any percentage identity in between to the nucleic acid sequence of:
In some embodiments, the CBA promoter sequence comprises or consists of a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least any percentage identity in between to the nucleic acid sequence of:
In some embodiments, the sequence encoding the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the sequence encoding the exon comprises or consists of the nucleic acid sequence of SEQ ID NO: 14.
The first AAV vector may comprise an untranslated region (UTR) located between the promoter and the upstream ABCA4 nucleic acid sequence (i.e. a 5′ UTR).
Any suitable UTR sequence may be used, the selection of which may be readily made by the skilled person.
The UTR may comprise or consist of one or more of the following elements: a Gallus 3-actin (CBA) intron 1 or a portion thereof, an Oryctolagus cuniculus β-globin (RBG) intron 2 or a portion thereof, and an Oryctolagus cuniculus β-globin exon 3 or a portion thereof.
The UTR may comprise a Kozak consensus sequence. Any suitable Kozak consensus sequence may be used.
In certain preferred embodiments, the UTR comprises the nucleic acid sequence specified in SEQ ID NO: 6,a variant or a portion thereof having at least 90% (e.g. at least 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9%) sequence identity.
The UTR of SEQ ID NO: 6 is 186 nucleotides in length and includes a Gallus β-actin (CBA) intron 1 fragment (with predicted splice donor site), Oryctolagus cuniculus β-globin (RBG) intron 2 fragment (including predicted branch point and splice acceptor site) and Oryctolagus cuniculus β-globin exon 3 fragment immediately prior to a Kozak consensus sequence.
The presence of a UTR as described above, in particular a UTR sequence as specified in SEQ ID NO: 6 or a variant thereof having at least 90% sequence identity, may increase translational yield from the ABCA4 transgene.
The second (“downstream”) AAV vector of the AAV vector system of the disclosure may comprise a post-transcriptional response element (also known as post-transcriptional regulatory element) or PRE. Any suitable PRE may be used, the selection of which may be readily made by the skilled person. In certain embodiments, the presence of a suitable PRE may enhance expression of the ABCA4 transgene.
In certain preferred embodiments, the PRE is a Woodchuck Hepatitis Virus PRE (WPRE). In certain particularly preferred embodiments, the WPRE has a sequence as specified in SEQ ID NO: 7 or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
The second AAV vector may comprise a poly-adenylation sequence located 3′ to the downstream ABCA4 nucleic acid sequence. Any suitable poly-adenylation sequence may be used, the selection of which may be readily made by the skilled person.
In certain preferred embodiments, the poly-adenylation sequence is a bovine Growth Hormone (bGH) poly-adenylation sequence. In a particularly preferred embodiment, the bGH poly-adenylation sequence has a sequence as specified in SEQ ID NO: 8 or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity. In certain embodiments, the sequence encoding the polyadenylation sequence comprises or consists of a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least any percentage identity in between to the nucleic acid sequence of:
In certain preferred embodiments of the AAV vector system of the disclosure, the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 9, and the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 10.
In certain preferred embodiments of the AAV vector system of the disclosure, the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 3, and the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 4.
The AAV vector system of the disclosure may be suitable for expressing a human ABCA4 protein in a target cell.
The disclosure provides a method for expressing a human ABCA4 protein in a target cell, the method comprising the steps of: transducing the target cell with the first AAV vector and the second AAV vector as described above, such that a functional ABCA4 protein is expressed in the target cell.
Expression of human ABCA4 protein requires that the target cell be transduced with both the first AAV vector and the second AAV vector. In certain embodiments, the target cell may be transduced with the first AAV vector and the second AAV vector in any order (first AAV vector followed by second AAV vector, or second AAV vector followed by first AAV vector) or simultaneously.
Methods for transducing target cells with AAV vectors are known in the art and will be familiar to a skilled person.
The target cell is may be a cell of the eye, preferably a retinal cell (e.g. a neuronal photoreceptor cell, a rod cell, a cone cell, or a retinal pigment epithelium cell).
The disclosure also provides the first AAV vector, as defined above. There is also provided the second AAV vector, as defined above.
The disclosure provides an AAV vector, comprising a nucleic acid sequence comprising a 5′ end portion of an ABCA4 CDS, wherein the 5′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 105 to 3805 of SEQ ID NO: 1. In certain embodiments, this AAV vector does not comprise any additional ABCA4 CDS beyond said sequence of contiguous nucleotides.
The first AAV vector may comprise 5′ and 3′ ITRs, preferably AAV ITRs; a promoter, for example a GRK1 promoter; and/or a UTR; said elements being as described above in relation to the AAV vector system of the disclosure.
In some embodiments, the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 9.
In some embodiments, the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 9 or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
In some embodiments, the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 9 with the proviso that the nucleotide at the position corresponding to nucleotide 1640 of SEQ ID NO: 1 is G, or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
In some embodiments, the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 3.
In some embodiments, the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 3 or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
In some embodiments, the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 3 with the proviso that the nucleotide at the position corresponding to nucleotide 1640 of SEQ ID NO: 1 is G, or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
The disclosure provides an AAV vector, comprising a nucleic acid sequence comprising a 3′ end portion of an ABCA4 CDS, wherein the 3′ end portion of an ABCA4 CDS consists of a sequence of contiguous nucleotides corresponding to nucleotides 3598 to 6926 of SEQ ID NO: 1. In some embodiments, this AAV vector does not comprise any additional ABCA4 CDS beyond said sequence of contiguous nucleotides.
The second vector may comprise 5′ and 3′ ITRs, preferably AAV ITRs; a PRE, preferably a WPRE; and/or a poly-adenylation sequence, preferably a bGH poly-adenylation sequence; said elements being as described above in relation to the AAV vector system of the disclosure.
In some embodiments, the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 10.
In some embodiments, the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 10 or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
In some embodiments, the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 10 with the proviso that the nucleotide at the position corresponding to nucleotide 5279 of SEQ ID NO: 1 is G and the nucleotide at the position corresponding to nucleotide 6173 of SEQ ID NO: 1 is T, or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
In some embodiments, the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 4.
In some embodiments, the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 4 or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
In some embodiments, the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 4 with the proviso that the nucleotide at the position corresponding to nucleotide 5279 of SEQ ID NO: 1 is G and the nucleotide at the position corresponding to nucleotide 6173 of SEQ ID NO: 1 is T, or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
The disclosure also provides nucleic acids comprising the nucleic acid sequences described above. The disclosure also provides an AAV vector genome derivable from an AAV vector as described above.
Also provided is a kit comprising the first AAV vector and the second AAV vector as described above. The AAV vectors may be provided in the kits in the form of AAV particles.
Further provided is a kit comprising a nucleic acid comprising the first nucleic acid sequence and a nucleic acid comprising the second nucleic acid sequence, as described above.
The disclosure also provides a pharmaceutical composition comprising the AAV vector system as described above and a pharmaceutically acceptable excipient.
The AAV vector system of the disclosure, the kit of the disclosure, and the pharmaceutical composition of the disclosure, may be used in gene therapy. For example, AAV vector system of the disclosure, the kit of the disclosure, and the pharmaceutical composition of the disclosure, may be used in preventing or treating disease.
In some embodiments, use of the compositions and methods of the disclosure to prevent or treat disease comprises administration of the first AAV vector and second AAV vector to a target cell, to provide expression of ABCA4 protein.
In some embodiments, the disease to be prevented or treated is characterized by degradation of retinal cells. An example of such a disease is Stargardt disease. In some embodiments, the first and second AAV vectors of the disclosure may be administered to an eye of a patient, for example to retinal tissue of the eye, such that functional ABCA4 protein is expressed to compensate for the mutation(s) present in the disease.
The AAV vectors of the disclosure may be formulated as pharmaceutical compositions or medicaments.
An example AAV vector system of the disclosure comprises a first AAV vector and a second AAV vector; wherein the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 9; and the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 10.
A further exemplary AAV vector system of the disclosure comprises a first AAV vector and a second AAV vector; wherein the first AAV vector comprises the nucleic acid sequence of SEQ ID NO: 9 or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity; and the second AAV vector comprises the nucleic acid sequence of SEQ ID NO: 10 or a variant thereof having at least 90% (e.g. at least 90, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8 or 99.9%) sequence identity.
In some embodiments, the methods and uses of the disclosure may also be performed where SEQ ID NO: 2 is used as a reference sequence in place of SEQ ID NO: 1.
In this regard, SEQ ID NO: 2 is identical to SEQ ID NO: 1 with the exception of the following mutations: nucleotide 1640 G>T, nucleotide 5279 G>A, nucleotide 6173 T>C. These mutations do not alter the encoded amino acid sequence, and thus the ABCA4 protein encoded by SEQ ID NO: 2 is identical to the ABCA4 protein encoded by SEQ ID NO:1.
Thus, in alternative embodiments of the disclosure, references above to SEQ ID NO: 1 may be replaced with references to SEQ ID NO:2.
As used herein, the term “corresponding to” when used with regard to the nucleotides in a given nucleic acid sequence defines nucleotide positions by reference to a particular SEQ ID NO. However, when such references are made, it will be understood that the disclosure is not to be limited to the exact sequence as set out in the particular SEQ ID NO referred to but includes variant sequences thereof. The nucleotides corresponding to the nucleotide positions in SEQ ID NO: 1 can be readily determined by sequence alignment, such as by using sequence alignment programs, the use of which is well known in the art. In this regard, a skilled person would readily appreciate that the degenerate nature of the genetic code means that variations in a nucleic acid sequence encoding a given polypeptide may be present without changing the amino acid sequence of the encoded polypeptide. Thus, identification of nucleotide locations in other ABCA4 coding sequences is contemplated (i.e. nucleotides at positions which the skilled person would consider correspond to the positions identified in, for example, SEQ ID NO: 1).
By way of example, SEQ ID NO: 2 is identical to SEQ ID NO: 1 with the exception of three specific mutations, as described above (these three mutations do not alter the amino acid sequence of the encoded ABCA4 polypeptide). In this case, a skilled person would therefore consider that a given nucleotide position in SEQ ID NO: 2 corresponded to the equivalent numbered nucleotide position in SEQ ID NO: 1.
The viral vectors of the disclosure comprise adeno-associated viral (AAV) vectors. An AAV vector of the disclosure may be in the form of a mature AAV particle or virion, i.e. nucleic acid surrounded by an AAV protein capsid.
The AAV vector may comprise an AAV genome or a derivative thereof.
An AAV genome is a polynucleotide sequence, which may, in some embodiments, encode functions for the production of an AAV particle. These functions include, for example, those operating in the replication and packaging cycle of AAV in a host cell, including encapsidation of the AAV genome into an AAV particle. Naturally occurring AAVs are replication-deficient and rely on the provision of helper functions in trans for completion of a replication and packaging cycle. Accordingly, an AAV genome of a vector of the disclosure may be replication-deficient.
The AAV genome may be in single-stranded form, either positive or negative-sense, or alternatively in double-stranded form. In some embodiments, the use of a double-stranded form allows bypass of the DNA replication step in the target cell and so can accelerate transgene expression.
In some embodiments, the AAV genome of a vector of the disclosure may be in single-stranded form.
The AAV genome may be from any naturally derived serotype, isolate or clade of AAV. Thus, the AAV genome may be the full genome of a naturally occurring AAV. As is known to the skilled person, AAVs occurring in nature may be classified according to various biological systems.
AAVs are referred to in terms of their serotype. A serotype corresponds to a variant subspecies of AAV which, owing to its profile of expression of capsid surface antigens, has a distinctive reactivity which can be used to distinguish it from other variant subspecies. A virus having a particular AAV serotype does not efficiently cross-react with neutralizing antibodies specific for any other AAV serotype.
AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 and AAV11, and also recombinant serotypes, such as Rec2 and Rec3, recently identified from primate brain. Any of these AAV serotypes may be used in the disclosure. Thus, in one embodiment of the disclosure, an AAV vector of the disclosure may be derived from an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, Rec2 or Rec3 AAV.
Reviews of AAV serotypes may be found in Choi et al. (2005) Curr. Gene Ther. 5: 299-310 and Wu et al. (2006) Molecular Therapy 14: 316-27. The sequences of AAV genomes or of elements of AAV genomes including ITR sequences, rep or cap genes may be derived from the following accession numbers for AAV whole genome sequences: Adeno-associated virus 1 NC_002077, AF063497; Adeno-associated virus 2 NC_001401; Adeno-associated virus 3 NC_001729; Adeno-associated virus 3B NC_001863; Adeno-associated virus 4 NC_001829; Adeno-associated virus 5 Y18065, AF085716; Adeno-associated virus 6 NC 001862; Avian AAV ATCC VR-865 AY186198, AY629583, NC_004828; Avian AAV strain DA-1 NC_006263, AY629583; Bovine AAV NC_005889, AY388617.
AAV may also be referred to in terms of clades or clones. This refers, for example, to the phylogenetic relationship of naturally derived AAVs, or to a phylogenetic group of AAVs which can be traced back to a common ancestor, and includes all descendants thereof. Additionally, AAVs may be referred to in terms of a specific isolate, i.e. a genetic isolate of a specific AAV found in nature. The term genetic isolate describes a population of AAVs which has undergone limited genetic mixing with other naturally occurring AAVs, thereby defining a recognizably distinct population at a genetic level.
The skilled person can select an appropriate serotype, clade, clone or isolate of AAV for use in the disclosure on the basis of their common general knowledge. For instance, the AAV5 capsid has been shown to transduce primate cone photoreceptors efficiently as evidenced by the successful correction of an inherited color vision defect (Mancuso et al. (2009) Nature 461: 784-7).
The AAV serotype can determine the tissue specificity of infection (or tropism) of an AAV virus. Accordingly, in some preferred embodiments the AAV serotypes for use in AAVs administered to patients of the disclosure are those which have natural tropism for or a high efficiency of infection of target cells within the eye. In one embodiment, AAV serotypes for use in the disclosure are those which infect cells of the neurosensory retina, retinal pigment epithelium and/or choroid.
In some embodiments, the AAV genome of a naturally derived serotype, isolate or clade of AAV comprises at least one inverted terminal repeat sequence (ITR). An ITR sequence may act in cis to provide a functional origin of replication and allows for integration and excision of the vector from the genome of a cell. The AAV genome may also comprise packaging genes, such as rep and/or cap genes which encode packaging functions for an AAV particle. The rep gene encodes one or more of the proteins Rep78, Rep68, Rep52 and Rep40 or variants thereof. The cap gene encodes one or more capsid proteins such as VP1, VP2 and VP3 or variants thereof. These proteins m ay make up the capsid of an AAV particle. Capsid variants are discussed below.
In some embodiments, a promoter can be operably linked to each of the packaging genes. Specific examples of such promoters include the p5, p19 and p40 promoters (Laughlin et al. (1979) Proc. Natl. Acad. Sci. USA 76: 5567-5571). For example, the p5 and p19 promoters may be used to express the rep gene, while the p40 promoter may be used to express the cap gene.
In some embodiments, the AAV genome used in a vector of the disclosure may therefore be the full genome of a naturally occurring AAV. For example, a vector comprising a full AAV genome may be used to prepare an AAV vector in vitro. In some embodiments, such a vector may in principle be administered to patients. In some preferred embodiments, the AAV genome will be derivative for the purpose of administration to patients. Such derivatization is known in the art and the disclosure encompasses the use of any known derivative of an AAV genome, and derivatives which could be generated by applying techniques known in the art. Derivatization of the AAV genome and of the AAV capsid are reviewed in Coura and Nardi (2007) Virology Journal 4: 99, and in Choi et al. and Wu et al., referenced above.
Derivatives of an AAV genome include any truncated or modified forms of an AAV genome which allow for expression of a transgene from a vector of the disclosure in vivo. In some embodiments, it is possible to truncate the AAV genome to include minimal viral sequence yet retain the above function. This may contribute to the safety of the AAV genome, by example reducing the risk of recombination of the vector with wild-type virus, and also avoiding triggering a cellular immune response by the presence of viral gene proteins in the target cell.
A derivative of an AAV genome may include at least one inverted terminal repeat sequence (ITR). In some embodiments, a derivative of an AAV genome may include more than one ITR, such as two ITRs or more. One or more of the ITRs may be derived from AAV genomes having different serotypes, or may be a chimeric or mutant ITR. An exemplary mutant ITR is one having a deletion of a trs (terminal resolution site). This deletion allows for continued replication of the genome to generate a single-stranded genome which contains both coding and complementary sequences, i.e. a self-complementary AAV genome. This allows for bypass of DNA replication in the target cell, and so enables accelerated transgene expression.
The inclusion of one or more ITRs may aid concatamer formation of a vector of the disclosure in the nucleus of a host cell, for example following the conversion of single-stranded vector DNA into double-stranded DNA by the action of host cell DNA polymerases. The formation of such episomal concatamers protects the vector construct during the life of the host cell, thereby allowing for prolonged expression of the transgene in vivo.
In some preferred embodiments, ITR elements will be the only sequences retained from the native AAV genome in the derivative. Thus, a derivative may not include the rep and/or cap genes of the native genome and any other sequences of the native genome. This may also reduce the possibility of integration of the vector into the host cell genome. Additionally, reducing the size of the AAV genome allows for increased flexibility in incorporating other sequence elements (such as regulatory elements) within the vector in addition to the transgene.
The following portions may be removed in a derivative of the disclosure: one inverted terminal repeat (ITR) sequence, the replication (rep) and capsid (cap) genes. However, in some embodiments, derivatives may additionally include one or more rep and/or cap genes or other viral sequences of an AAV genome. Naturally occurring AAV integrates with a high frequency at a specific site on human chromosome 19, and shows a negligible frequency of random integration, such that retention of an integrative capacity in the vector may be tolerated in a therapeutic setting.
Where a derivative comprises capsid proteins i.e. VP1, VP2 and/or VP3, the derivative may be a chimeric, shuffled or capsid-modified derivative of one or more naturally occurring AAVs. The disclosure encompasses the provision of capsid protein sequences from different serotypes, clades, clones, or isolates of AAV within the same vector (i.e. a pseudotyped vector).
Chimeric, shuffled or capsid-modified derivatives may be selected to provide one or more functionalities for the viral vector. For example, these derivatives may display increased efficiency of gene delivery, decreased immunogenicity (humoral or cellular), an altered tropism range and/or improved targeting of a particular cell type compared to an AAV vector comprising a naturally occurring AAV genome, such as that of AAV2. Increased efficiency of gene delivery may be effected by improved receptor or co-receptor binding at the cell surface, improved internalization, improved trafficking within the cell and into the nucleus, improved uncoating of the viral particle and improved conversion of a single-stranded genome to double-stranded form. Increased efficiency may also relate to an altered tropism range or targeting of a specific cell population, such that the vector dose is not diluted by administration to tissues where it is not needed.
Chimeric capsid proteins include those generated by recombination between two or more capsid coding sequences of naturally occurring AAV serotypes. This may be performed, for example, by a marker rescue approach in which non-infectious capsid sequences of one serotype are co-transfected with capsid sequences of a different serotype, and directed selection is used to select for capsid sequences having desired properties. The capsid sequences of the different serotypes can be altered by homologous recombination within the cell to produce novel chimeric capsid proteins.
Chimeric capsid proteins of the disclosure also include those generated by engineering of capsid protein sequences to transfer specific capsid protein domains, surface loops or specific amino acid residues between two or more capsid proteins, for example between two or more capsid proteins of different serotypes.
Shuffled or chimeric capsid proteins may also be generated by DNA shuffling or by error-prone PCR. Hybrid AAV capsid genes can be created by randomly fragmenting the sequences of related AAV genes e.g. those encoding capsid proteins of multiple different serotypes and then subsequently reassembling the fragments in a self-priming polymerase reaction, which may also cause crossovers in regions of sequence homology. A library of hybrid AAV genes created in this way by shuffling the capsid genes of several serotypes can be screened to identify viral clones having a desired functionality. Similarly, error prone PCR may be used to randomly mutate AAV capsid genes to create a diverse library of variants which may then be selected for a desired property.
The sequences of the capsid genes may also be genetically modified to introduce specific deletions, substitutions or insertions with respect to the native wild-type sequence. For example, capsid genes may be modified by the insertion of a sequence of an unrelated protein or peptide within an open reading frame of a capsid coding sequence, or at the N- and/or C-terminus of a capsid coding sequence.
The unrelated protein or peptide may be one which acts as a ligand for a particular cell type, thereby conferring improved binding to a target cell or improving the specificity of targeting of the vector to a particular cell population. The unrelated protein may also be one which assists purification of the viral particle as part of the production process, i.e. an epitope or affinity tag. The site of insertion may be selected so as not to interfere with other functions of the viral particle e.g. internalization, trafficking of the viral particle. The skilled person can identify suitable sites for insertion based on their common general knowledge. Particular sites are disclosed in Choi et al., referenced above.
The disclosure additionally encompasses the provision of sequences of an AAV genome in a different order and configuration to that of a native AAV genome. The disclosure also encompasses the replacement of one or more AAV sequences or genes with sequences from another virus or with chimeric genes composed of sequences from more than one virus. Such chimeric genes may be composed of sequences from two or more related viral proteins of different viral species.
AAV vectors of the disclosure include transcapsidated forms wherein an AAV genome or derivative having an ITR of one serotype is packaged in the capsid of a different serotype. AAV vectors of the disclosure also include mosaic forms wherein a mixture of unmodified capsid proteins from two or more different serotypes makes up the viral capsid. An AAV vector may also include chemically modified forms bearing ligands adsorbed to the capsid surface. For example, such ligands may include antibodies for targeting a particular cell surface receptor.
Thus, for example, AAV vectors of the disclosure may include those with an AAV2 genome and AAV2 capsid proteins (AAV2/2), those with an AAV2 genome and AAV5 capsid proteins (AAV2/5) and those with an AAV2 genome and AAV8 capsid proteins (AAV2/8).
An AAV vector of the disclosure may comprise a mutant AAV capsid protein. In one embodiment, an AAV vector of the disclosure comprises a mutant AAV8 capsid protein. In some embodiments, the mutant AAV8 capsid protein is an AAV8 Y733F capsid protein. In some embodiments, the AAV8 Y733F mutant capsid protein comprises an amino acid sequence with at least 95% identity to SEQ ID NO: 12 with a substitution of phenylalanine for tyrosine at position 733 of SEQ ID NO: 12. In some embodiments, the AAV8 Y733F mutant capsid protein comprises an amino acid sequence of SEQ ID NO: 12 with a substitution of phenylalanine for tyrosine at position 733 of SEQ ID NO: 12.
The viral vectors of the disclosure may be administered to the eye of a subject by subretinal, direct retinal, suprachoroidal or intravitreal injection.
A skilled person will be familiar with and well able to carry out individual subretinal, direct retinal, suprachoroidal or intravitreal injections.
Subretinal injections are injections into the subretinal space, i.e. underneath the neurosensory retina. During a subretinal injection, the injected material is directed into, and creates a space between, the photoreceptor cell and retinal pigment epithelial (RPE) layers.
When the injection is carried out through a small retinotomy, a retinal detachment may be created. The detached, raised layer of the retina that is generated by the injected material is referred to as a “bleb”.
The hole created by the subretinal injection may be sufficiently small that the injected solution does not significantly reflux back into the vitreous cavity after administration. Such reflux would be problematic when a medicament is injected, because the effects of the medicament would be directed away from the target zone. Preferably, the injection creates a self-sealing entry point in the neurosensory retina, i.e. once the injection needle is removed, the hole created by the needle reseals such that very little or substantially no injected material is released through the hole.
To facilitate this process, specialist subretinal injection needles are commercially available (e.g. DORC 41G Teflon subretinal injection needle, Dutch Ophthalmic Research Center International BV, Zuidland, The Netherlands). These are needles designed to carry out subretinal injections.
In some embodiments, subretinal injection comprises a scleral tunnel approach through the posterior pole to the superior retina with a Hamilton syringe and 34-gauge needle (ESS labs, UK). Alternatively, or in addition, subretinal injections can comprise performing an anterior chamber paracentesis with a 33G needle prior to the sub-retinal injection using a WPI syringe and a bevelled 35G-needle system (World Precision Instruments, UK).
Animal subjects, can be anaesthetized, for example, by intraperitoneal injection containing ketamine (80 mg/kg) and xylazine (10 mg/kg) and pupils fully dilated with tropicamide eye drops (Mydriaticum 1%, Bausch & Lomb, UK) and phenylephrine eye drops (phenylephrine hydrochloride 2.5%, Bausch & Lomb, UK). Proxymetacaine eye drops (proxymetacaine hydrochloride 0.5%, Bausch & Lomb, UK) can also be applied prior to sub-retinal injection. Post-injection, chloramphenicol eye drops can be applied (chloramphenicol 0.5%, Bausch & Lomb, UK), anaesthesia reversed with atipamezole (2 mg/kg), and carbomer gel applied (Viscotears, Novartis, UK) to prevent cataract formation.
Unless damage to the retina occurs during the injection, and as long as a sufficiently small needle is used, injected material remains localized between the detached neurosensory retina and the RPE at the site of the localized retinal detachment (i.e. does not reflux into the vitreous cavity). Indeed, the persistence of the bleb over a short time frame indicates that there may be little escape of the injected material into the vitreous. The bleb may dissipate over a longer time frame as the injected material is absorbed.
Visualizations of the eye, for example the retina, for example using optical coherence tomography, may be made pre-operatively.
In some embodiments, the AAV vectors of the disclosure may be delivered with accuracy and safety by using a two-step method in which a localized retinal detachment is created by the subretinal injection of a first solution. The first solution does not comprise the vector. A second subretinal injection is then used to deliver the medicament comprising the vector into the subretinal fluid of the bleb created by the first subretinal injection. Because the injection delivering the medicament is not being used to detach the retina, a specific volume of solution may be injected in this second step.
An AAV vector of the disclosure may be delivered by:
(a) administering a solution to the subject by subretinal injection in an amount effective to at least partially detach the retina to form a subretinal bleb, wherein the solution does not comprise the vector; and
(b) administering a medicament composition by subretinal injection into the bleb formed by step (a), wherein the medicament comprises the vector.
The volume of solution injected in step (a) to at least partially detach the retina may be, for example, about 10-1000 μL, for example about 50-1000, 100-1000, 250-1000, 500-1000, 10-500, 50-500, 100-500, 250-500 μL. The volume may be, for example, about 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 μL.
The volume of the medicament composition injected in step (b) may be, for example, about 10-500 μL, for example about 50-500, 100-500, 200-500, 300-500, 400-500, 50-250, 100-250, 200-250 or 50-150 μL. The volume may be, for example, about 10, 50, 100, 150, 200, 250, 300, 350, 400, 450 or 500 μL. In some preferred embodiments, y, the volume of the medicament composition injected in step (b) is 100 μL. Larger volumes may increase the risk of stretching the retina, while smaller volumes may be difficult to see.
The solution that does not comprise the medicament (i.e. the “first solution” of step (a)) may be similarly formulated to the solution that does comprise the medicament, as described below. An exemplary solution that does not comprise the medicament is balanced saline solution (BSS), TMN 200 or a similar buffer solution matched to the pH and osmolality of the subretinal space.
In some embodiments, for example during end-stage retinal degenerations, identifying the retina is difficult because it is thin, transparent and difficult to see against the disrupted and heavily pigmented epithelium on which it sits. The use of a blue vital dye (e.g. Brilliant Peel©, Geuder; MembraneBlue-Dual©, Dorc) may facilitate the identification of the retinal hole made for the retinal detachment procedure (i.e. step (a) in the two-step subretinal injection method of the disclosure) so that the medicament can be administered through the same hole without the risk of reflux back into the vitreous cavity.
The use of the blue vital dye may also identify any regions of the retina where there is a thickened internal limiting membrane or epiretinal membrane, as injection through either of these structures may hinder clean access into the subretinal space. Furthermore, contraction of either of these structures in the immediate post-operative period may lead to stretching of the retinal entry hole, which may lead to reflux of the medicament into the vitreous cavity.
Vectors or compositions of the disclosure may be administered via suprachoroidal injection. Any means of suprachoroidal injection is envisaged as a potential delivery system for a vector or a composition of the disclosure. Suprachoroidal injections are injections into the suprachoroidal space, which is the space between the choroid and the sclera. Injection into the suprachoroidal space is thus a potential route of administration for the delivery of compositions to proximate eye structures such as the retina, retinal pigment epithelium (RPE) or macula. In some embodiments, injection into the suprachoroidal space is done in an anterior portion of the eye using a microneedle, microcannula, or microcatheter. An anterior portion of the eye may comprise or consist of an area anterior to the equator of the eye. The vector composition or AAV viral particles may diffuse posteriorly from an injection site via a suprachoroidal route. In some embodiments, the suprachoroidal space in the posterior eye is injected directly using a catheter system. In this embodiment, the suprachoroidal space may be catheterized via an incision in the pars plana. In some embodiments, an injection or an infusion via a suprachoroidal route traverses the choroid, Bruch's membrane and/or RPE layer to deliver a vector or a composition of the disclosure to a subretinal space. In some embodiments, including those in which a vector or a composition of the disclosure is delivered to a subretinal space via a suprachoroidal route, one or more injections is made into at least one of the sclera, the pars plana, the choroid, the Bruch's membrane, and the RPE layer. In some embodiments, including those in which a vector or a composition of the disclosure is delivered to a subretinal space via a suprachoroidal route, a two-step procedure is used to create a bleb in a suprachoroidal or a subretinal space prior to delivery of a vector or a composition of the disclosure.
The AAV vectors and AAV vector system of the disclosure may be formulated into pharmaceutical compositions. These compositions may comprise, in addition to the medicament, a pharmaceutically acceptable carrier, diluent, excipient, buffer, stabilizer or other materials well known in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may be determined by the skilled person according to the route of administration, e.g. subretinal, direct retinal, suprachoroidal or intravitreal injection.
The pharmaceutical composition may be in liquid form. Liquid pharmaceutical compositions include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, magnesium chloride, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
For injection at the site of affliction, the active ingredient may be in the form of an aqueous solution which is pyrogen-free, and has suitable pH, isotonicity and stability. The skilled person is well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection or Lactated Ringer's Injection or TMN 200. Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included as required.
Buffers may have an effect on the stability and biocompatibity of the viral vectors and vector particles of the disclosure following storage and passage through injection devices for AAV gene therapy. In some embodiments, the viral vectors and vector particles of the disclosure may be diluted in TMN 200 buffer to maintain biocompatibility and stability. TMN 200 buffer comprises 20 mM Tris (pH adjusted to 8.0), 1 mM MgCl2 and 200 mM NaCl at pH 8.
The determination of the physical viral genome titer comprises part of the characterization of the viral vector or viral particle. In some embodiments, determination of the physical viral genome titre comprises a step in ensuring the potency and safety of viral vectors and viral particles during gene therapy. In some embodiments, a method to determine the AAV titer comprises quantitative PCR (qPCR). There are different variables that can influence the results, such as the conformation of the DNA used as standard or the enzymatic digestion during the sample preparation. The viral vector or particle preparation whose titer is to be measured may be compared against a standard dilution curve generated using a plasmid. In some embodiments, the plasmid DNA used in the standard curve is in the supercoiled conformation. In some embodiments, the plasmid DNA used in the standard curve is in the linear conformation. Linearized plasmid can be prepared, for example by digestion with HindIII restriction enzyme, visualized by agarose gel electrophoresis and purified using the QIAquick Gel Extraction Kit (Qiagen) following manufacturer's instructions. Other restriction enzymes that cut within the plasmid used to generate the standard curve may also be appropriate. In some embodiments, the use of supercoiled plasmid as the standard increased the titre of the AAV vector compared to the use of linearized plasmid.
To extract the DNA from purified AAV vectors for quantification of AAV genome titer, two enzymatic methods can be used. In some embodiments, the AAV vector may be singly digested with DNase I. In some embodiments, the AAV vector may be and double digested with DNase I and an additional proteinase K treatment. QPCR can then performed with the CFX Connect Real-Time PCR Detection System (BioRad) using primers and Taqman probe specific to the transgene sequence.
For delayed release, the medicament may be included in a pharmaceutical composition which is formulated for slow release, such as in microcapsules formed from biocompatible polymers or in liposomal carrier systems according to methods known in the art.
It is to be appreciated that all references herein to treatment include curative, palliative and prophylactic treatment; although in the context of the disclosure references to preventing are associated with prophylactic treatment. Treatment may also include arresting progression in the severity of a disease.
The treatment of all mammals, including humans, is envisaged. However, both human and veterinary treatments are within the scope of the disclosure.
In addition to the specific proteins and nucleotides mentioned herein, the disclosure also encompasses the use of variants, derivatives, analogues, homologues and fragments thereof. In the context of the disclosure, a variant of any given sequence is a sequence in which the specific sequence of residues (whether amino acid or nucleic acid residues) has been modified in such a manner that the polypeptide or polynucleotide in question substantially retains its function. A variant sequence can be obtained, for example, by addition, deletion, substitution, modification, replacement and/or variation of at least one residue present in the naturally-occurring protein.
The term “derivative” as used herein, in relation to proteins or polypeptides of the disclosure includes any substitution of, variation of, modification of, replacement of, deletion of and/or addition of one (or more) amino acid residues from or to the sequence providing that the resultant protein or polypeptide substantially retains at least one of its endogenous functions.
The term “analogue” as used herein, in relation to polypeptides or polynucleotides includes any mimetic, that is, a chemical compound that possesses at least one of the endogenous functions of the polypeptides or polynucleotides which it mimics.
Amino acid substitutions may be made, for example from 1, 2 or 3 to 10, 20 or more substitutions provided that the modified sequence substantially retains the required activity or ability. Amino acid substitutions may include the use of non-naturally occurring analogues. Proteins used in the disclosure may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent protein.
Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues as long as the endogenous function is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include asparagine, glutamine, serine, threonine and tyrosine.
Conservative substitutions may be made, for example according to the table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:
The term “homologue” as used herein means an entity having a certain homology with the wild type amino acid sequence and the wild type nucleotide sequence. The term “homology” can be equated with “identity”.
A homologous sequence may include an amino acid sequence which may be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical to the subject sequence. For example, the homologues will comprise the same active sites etc. as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the disclosure homology can also be expressed in terms of sequence identity.
A homologous sequence may include a nucleotide sequence which may be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical to the subject sequence. Although homology can also be considered in terms of similarity, in the context of the disclosure homology can also be expressed in terms of sequence identity.
Reference to a sequence which has a percent identity to any one of the SEQ ID NOs detailed herein refers to a sequence which has the stated percent identity over the entire length of the SEQ ID NO referred to.
Homology comparisons can be conducted by eye or with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate percentage homology or identity between two or more sequences.
Percentage homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an “ungapped” alignment. Such ungapped alignments may be performed only over a relatively short number of residues.
Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion in the nucleotide sequence may cause the following codons to be put out of alignment, thus potentially resulting in a large reduction in percent homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalizing unduly the overall homology score. This is achieved by inserting “gaps” in the sequence alignment to try to maximize local homology.
However, these more complex methods assign “gap penalties” to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. “Affine gap costs” may be used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimized alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is −12 for a gap and −4 for each extension.
Calculation of maximum percentage homology therefore firstly comprises the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al. (1984) Nucleic Acids Res. 12: 387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al. (1999) ibid-Ch. 18), FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al. (1999) ibid, pages 7-58 to 7-60). However, for some applications, the GCG Bestfit program can be used. Another tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequences (see FEMS Microbiol. Lett. (1999) 174: 247-50; FEMS Microbiol. Lett. (1999) 177: 187-8). Although the final percent homology can be measured in terms of identity, the alignment process itself may not be based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix may be used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix is the BLOSUM62 matrix—the default matrix for the BLAST suite of programs. GCG Wisconsin programs may use either the public default values or a custom symbol comparison table if supplied (see the user manual for further details). Some applications, use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.
Once the software has produced an optimal alignment, it is possible to calculate percent homology, preferably percent sequence identity. The software may do this as part of the sequence comparison and generates a numerical result.
“Fragments” are also variants and the term may refer to a selected region of the polypeptide or polynucleotide that is of interest either functionally or, for example, in an assay. “Fragment” thus refers to an amino acid or nucleic acid sequence that is a portion of a full-length polypeptide or polynucleotide.
Such variants may be prepared using standard recombinant DNA techniques such as site-directed mutagenesis. Where insertions are to be made, synthetic DNA encoding the insertion together with 5′ and 3′ flanking regions corresponding to the naturally-occurring sequence either side of the insertion site may be made. The flanking regions will contain convenient restriction sites corresponding to sites in the naturally-occurring sequence so that the sequence may be cut with the appropriate enzyme(s) and the synthetic DNA ligated into the cut. The DNA is then expressed in accordance with the disclosure to make the encoded protein. These methods are only illustrative of the numerous standard techniques known in the art for manipulation of DNA sequences and other known techniques may also be used.
The present disclosure encompasses codon optimized variants of the nucleic acid sequences described herein.
Codon optimization takes advantage of redundancies in the genetic code to enable a nucleotide sequence to be altered while maintaining the same amino acid sequence of the encoded protein.
Codon optimization may be carried out to facilitate an increase or decrease in the expression of an encoded protein. This may be effected by tailoring codon usage in a nucleotide sequence to that of a specific cell type, thus taking advantage of cellular codon bias corresponding to a bias in the relative abundance of particular tRNAs in the cell type. By altering the codons in the nucleotide sequence so that they are tailored to match the relative abundance of corresponding tRNAs, it is possible to increase expression. Conversely, it is possible to decrease expression by selecting codons for which the corresponding tRNAs are known to be rare in the particular cell type. Methods for codon optimization of nucleic acid sequences are known in the art and will be familiar to a skilled person.
The baseline or improved visual acuity of a subject of the disclosure may be measured by having the subject navigate through an enclosure characterized by low light or dark conditions and including one or more obstacles for the subject to avoid. The subject may be in need of a composition of the disclosure, optionally, provided by a method of treating of the disclosure. The subject may have received a composition of the disclosure, optionally, provided by a method of treating of the disclosure in one or both eyes and in one or more doses and/or procedures/injections. The enclosure may be indoors or outdoors. The enclosure is characterized by a controlled light level ranging from a level that recapitulates daylight to a level that simulates complete darkness. Within this range, the controlled light level of the enclosure may be preferably set to recapitulate natural dusk or evening light levels at which a subject of the disclosure prior to receiving a composition of the disclosure may have decreased visual acuity. Following administration of a composition of the disclosure, the subject may have improved visual acuity at all light levels, but the improvement is preferably measured at lower light levels, including those that recapitulate natural dusk or evening light levels (indoors or outdoors).
In some embodiments of the enclosure, the one or more obstacles are aligned with one or more designated paths and/or courses within the enclosure. A successful passage through the enclosure by a subject may include traversing a designated path and avoiding traversal of a non-designated path. A successful passage through the enclosure by a subject may include traversing any path, including a designated path, while avoiding contact with one or more obstacles positioned either within a path or in proximity to a path. A successful or improved passage through the enclosure by a subject may include traversing any path, including a designated path, while avoiding contact with one or more obstacles positioned either within a path or in proximity to a path with a decreased time required to traverse the path from a designated start position to a designated end position (e.g. when compared to a healthy individual with normal visual acuity or when compared to a prior traversal by the subject). In some embodiments, an enclosure may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 paths or designated paths. A designated path may differ from a non-designated path by the identification of the designated path by the experimenter as containing an intended start position and an intended end position.
In some embodiments of the enclosure, the one or more obstacles are not fixed to a surface of the disclosure. In some embodiments, the one or more obstacles are fixed to a surface of the disclosure. In some embodiments, the one or more obstacles are fixed to an internal surface of the enclosure, including, but not limited to, a floor, a wall and a ceiling of the enclosure. In some embodiments, the one or more obstacles comprise a solid object. In some embodiments, the one or more obstacles comprise a liquid object (e.g. a “water hazard”). In some embodiments, the one or more obstacles comprise in any combination or sequence along at least one path or in close proximity to a path, an object to be circumvented by a subject; an object to be stepped over by a subject; an object to be balanced upon by walking or standing; an object having an incline, a decline or a combination thereof; an object to be touched (for example, to determine a subject's ability to see and/or judge depth perception); and an object to be traversed by walking or standing beneath it (e.g., including bending one or more directions to avoid the object). In some embodiments of the enclosure, the one or more obstacles must be encountered by the subject in a designated order.
In certain embodiments, baseline or improved visual acuity of a subject may be measured by having the subject navigate through a course or enclosure characterized by low light or dark conditions and including one or more obstacles for the subject to avoid, wherein the course or enclosure is present in an installation. In particular embodiments, the installation includes a modular lighting system and a series of different mobility course floor layouts. In certain embodiments, one room houses all mobility courses with one set of lighting rigs. For example, a single course may be set up at a time during mobility testing, and the same room/lighting rigs may be used for mobility testing independent of the course (floor layout) in use. In particular embodiments, the different mobility courses provided for testing are designed to vary in difficulty, with harder courses featuring low contrast pathways and hard to see obstacles, and easier courses featuring high contrast pathways and easy to see obstacles.
In some embodiments of the enclosure, the subject may be tested prior to administration of a composition of the disclosure to establish, for example, a baseline measurement of accuracy and/or speed or to diagnose a subject as having a retinal disease or at risk of developing a retinal disease. In some embodiments, the subject may be tested following administration of a composition of the disclosure to determine a change from a baseline measurement or a comparison to a score from a healthy individual (e.g. for monitoring/testing the efficacy of the composition to improve visual acuity).
The baseline or improved measurement of retinal cell viability of a subject of the disclosure may be measured by one or more AOSLO techniques. Scanning Laser Ophthalmoscopy (SLO) may be used to view a distinct layer of a retina of an eye of a subject. Preferably, adaptive optics (AO) are incorporated in SLO (AOSLO), to correct for artifacts in images from SLO alone typically caused by structure of the anterior eye, including, but not limited to the cornea and the lens of the eye. Artifacts produced by using SLO alone decrease resolution of the resultant image. Adaptive optics allow for the resolution of a single cell of a layer of the retina and detect directionally backscattered light (waveguided light) from normal or intact retinal cells (e.g. normal or intact photoreceptor cells).
In some embodiments of the disclosure, using an AOSLO technique, an intact cell produce a waveguided and/or detectable signal. In some embodiments a non-intact cell does not produce a waveguided and/or detectable signal.
AOSLO may be used to image and, preferably, evaluate the retina or a portion thereof in a subject. In some embodiments, the subject has one or both retinas imaged using an AOSLO technique. In some embodiments, the subject has one or both retinas imaged using an AOSLO technique prior to administration of a composition of the disclosure (e.g. to determine a baseline measurement for subsequent comparison following treatment and/or to determine the presence and/or the severity of retinal disease). In some embodiments, the subject has one or both retinas imaged using an AOSLO technique following an administration of a composition of the disclosure (e.g. to determine an efficacy of the composition and/or to monitor the subject following administration for improvement resulting from treatment).
In some embodiments of the disclosure, the retina is imaged by either confocal or non-confocal (split-detector) AOSLO to evaluate a density of one or more retinal cells. In some embodiments, the one or more retinal cells include, but are not limited to a photoreceptor cell. In some embodiments, the one or more retinal cells include, but are not limited to a cone photoreceptor cell. In some embodiments, the one or more retinal cells include, but are not limited to a rod photoreceptor cell. In some embodiments, the density is measured as number of cells per millimeter. In some embodiments, the density is measured as number of live or viable cells per millimeter. In some embodiments, the density is measured as number of intact cells per millimeter (cells comprising an AAV particle or a transgene sequence of the disclosure). In some embodiments, the density is measured as number of responsive cells per millimeter. In some embodiments, a responsive cell is a functional cell.
In some embodiments, AOSLO may be used to capture an image of a mosaic of photoreceptor cells within a retina of the subject. In some embodiments, the mosaic includes intact cells, non-intact cells or a combination thereof. In some embodiments, a mosaic comprises a composite or montage of images representing an entire retina, an inner segment, an outer segment, or a portion thereof. In some embodiments, the image of a mosaic comprises a portion of a retina comprising or contacting a composition of the disclosure. In some embodiments, the image of a mosaic comprises a portion of a retina juxtaposed to a portion of the retina comprising or contacting a composition of the disclosure. In some embodiments, the image of a mosaic comprises a treated area and an untreated area, wherein the treated area comprises or contacts a composition of the disclosure and the untreated area does not comprise or contact a composition of the disclosure.
In some embodiments, AOSLO may be used alone or in combination with optical coherence tomography (OCT) to visualize directly a retinal, a portion of a retinal or a retinal cell of a subject. In some embodiments, adaptive optics may be used in combination with OCT (AO-OCT) to visualize directly a retinal, a portion of a retinal or a retinal cell of a subject.
In some embodiments of the disclosure, the outer or inner segment is imaged by either confocal or non-confocal (split-detector) AOSLO to evaluate a density of cells therein or a level of integrity of the outer segment, the inner segment or a combination thereof. In some embodiments, AOSLO may be used to detect a diameter of an inner segment, an outer segment or a combination thereof.
An exemplary AOSLO system is shown in
Additional description of AOSLO and various techniques may be described at least in Georgiou et al. Br J Opthalmol 2017; 0:1-8; Scoles et al. Invest Opthalmol Vis Sci. 2014; 55:4244-4251; and Tanna et al. Invest Opthalmol Vis Sci. 2017; 58:3608-3615.
ACGGCTGCCT TCGGGGGGGA CGGGGCAGGG CGGGGTTCGG CTTCTGGCGT GTGACCGGCG
GCTCTAGAGC CTCTGCTAAC CATGTTCATG CCTTCTTCTT TTTCCTACAG CTCCTGGGCA
The generation of a given AAV vector comprised three plasmids: pTransgene, pRepCap and pHelper. pTransgene contains either the upstream or downstream ABCA4 transgene as detailed below (ITR integrity confirmed). pRepCap contains the rep and cap genes of the AAV genome. The rep genes are from the AAV2 genome whereas the cap genes varies depending on serotype requirement. pHelper contains the required adenoviral genes necessary for successful AAV generation. The plasmids are complexed with polyethylenimine (PEI) for a triple transfection mix that is applied to HEK293T cells, and HEK293T cells were transfected using a typical PEI protocol to deliver the required plasmids: pRepCap, pHelper (pDeltaAdF6) and pTransgene. HEK293T cells were grown in HYPERFlasks (SLS, UK) and transfected using a typical PEI protocol to deliver a total of 500 pg of the required plasmids: pRepCap, pHelper (pDeltaAdF6) and pTransgene. Cells were harvested three days post-transfection, lysed and the AAV population isolated by ultracentrifugation with an iodixanol gradient followed by purification in Amicon Ultra-15 100K filter units (MerckMillipore, UK). Three days post-transfection, the cells were collected and lysed. The lysate was treated with Benzonase and clarified before applying to an iodixanol gradient comprised of 15%, 25%, 40% and 60% phases. The gradients were spun at 59,000 rpm for 1 hour 30 minutes and the 40% fraction was then withdrawn. This AAV phase was then purified and concentrated using an Amicon Ultra-15 100K filter unit. Following this step, 100-200 μl of purified AAV is obtained in PBS. The final preparations were collected in PBS. SDS-PAGE analysis was used to confirm good purification of each preparation and qPCR titres were determined using primers targeting either the upstream (FW 5′GCACCTTGGCCGTATTTGGACAG, REV 5′TGAGTCAGACAGGCCGATGT) or downstream (FW 5′TGGCGCAGATCGTGCT, REV 5′ACAGAAGGAGTCTTCCA) portion of ABCA4 coding sequence. Primer sets were confirmed to have 95-105% efficiency.
Adeno-associated virus (AAV) is the current vector of choice for retinal gene therapy due to its ability to diffuse through the various cell layers within the retinal structure, low immunogenicity, excellent tropism for photoreceptor cells and extensive proof of concept in a variety of pre-clinical models. Human clinical trials have shown safety and efficacy with AAV vectors in the retina and gene therapy trials for multiple conditions have been reported in the past decade with more currently ongoing. For some disorders such as Stargardt disease, the therapeutic genes are too large to fit within a transgene that can be packaged into a single AAV capsid. Gene therapy replacement for these disorders is therefore an intriguing challenge. Given the restricted packaging capacity of AAV, its potential to treat “large gene” diseases initially seemed limited, yet more recent studies have indicated that AAV gene therapy delivery of genes over 3.5 kb in size using two or more AAV particles is a distinct possibility.
Different AAV dual vector systems exist: 1. fragmented AAV (fAAV); 2. trans-splicing dual vectors; 3. overlapping dual vectors; and 4. hybrid dual vectors. However, the unpredictability of both the fAAV and trans-splicing methods is likely to raise regulatory concerns. The original dual vector approaches using fragmented transgenes have fallen out of favor due to concerns relating to random truncation and recombination. The alternative hybrid and overlapping dual vector systems rely on a region of homologous overlap between two transgenes. The overlapping approach is the least explored of these strategies yet it is the simplest dual vector design. Dual vector strategies that rely on a region of homologous overlap between two transgenes can be precisely predicted and replicated.
Both the hybrid and overlapping dual vector systems rely on a region of homologous overlap between two transgenes. The region of overlap has been shown to influence the success of transgene reformation. Previous studies have suggested that the success of the overlapping approach relies on homologous recombination (HR), of which there are different forms involved in DNA repair mechanisms, and through one of these sub-pathways the two overlapping dual vector transgenes (on plus and minus strands) may be recombined. The effectiveness of these molecular mechanisms may be tissue-dependent. In the case of Stargardt disease, the target cells are terminally differentiated photoreceptors and both non-homologous end-joining (NHEJ) and homologous recombination (HR) mechanisms are active in mouse rod photoreceptor cells. If consistently correct reformation of the larger transgene occurs then it is an indicator of a Homologous Recombination (HR) pathway being involved. Through systematic vector design variations assessing different overlap regions, codon-optimization of the coding sequence and inclusion of untranslated genetic elements (
In a normal recombinant AAV scenario, double-stranded transgenes are formed either by recruitment of the corresponding plus and minus single-stranded DNA (ssDNA) transgene forms by single-strand annealing (SSA) or by second-strand synthesis. Mechanisms of recombination between two overlapping transgenes could therefore also occur by SSA of complementary regions from opposing transgenes (
The disclosure provides compositions and methods for increasing the levels of ABCA4 protein by, for example, exploring different lengths of the overlap region when delivered by dual overlapping vectors. Additionally, the disclosure aims to increase expression from successfully recombined transgenes through the use of codon-optimized coding sequence and inclusion of untranslated regions (UTRs). Codon-optimization can increase the rate of translation of a given coding sequence and recent pre-clinical studies have indicated potential benefits of such in gene therapy transgenes. 5′UTR structures, in particular spliceable introns between the promoter and coding sequence, can enhance expression from transgenes. Spliced mRNAs may have enhanced translational efficiency compared to identical mRNAs not generated through splicing, and addition of intron 2 of the rabbit β-globin (RBG) gene in the 5′UTR of a transgene previously led to a 500-fold increase in protein expression. The outcome of including a 5′UTR containing spliceable intron/exon elements in combination with the 3′UTR Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) was assessed. The WPRE has previously been shown to increase transcript stability and enhance transgene expression in pre-clinical studies.
There are various elements that can enhance the success of an overlapping dual vector system for the treatment of Stargardt disease. Mutations in ATP-binding cassette transporter protein family member 4 (ABCA4) prevent the transport of retinoids from photoreceptor cell disc outer membranes to the retinal pigment epithelium (RPE), which leads to a build-up of undesired retinoid derivatives in the photoreceptor outer segments. Due to constant generation of photoreceptor outer segments, as older discs become more terminal they are consumed by the RPE. In photoreceptor cells carrying mutant, non-functional ABCA4, bisretinoids retained in the disc membranes build up in the RPE cells with further biochemical processes taking place that lead to formation of the toxicity compound A2E, a key element of lipofuscin. The outcome of this accumulation may be death of the RPE cells with subsequent degeneration and death of the photoreceptor cells, which rely on the RPE cells for survival. There are previously characterized the fundal changes in the pigmented Abca4−/− mouse model, and deuterised vitamin A has a positive effect on fundus fluorescence and bisretinoid accumulation. Hence this mouse is an appropriate model in which to assess therapeutic effects that are relevant to the human condition. Delivering functional ABCA4 to the photoreceptor outer segments of Abca4−/− mice to a level of efficacy that would reduce accumulation of bisretinoids/A2E/lipofuscin, may, in a patient with Stargardt disease, prevent death of the RPE cells and the degeneration of the photoreceptor cells they support.
Described below are embodiments of an overlapping dual AAV vector system that utilizes the endogenous DNA repair pathways of the targeted cell to reconstitute a functional, large ABCA4 transgene for gene therapy.
The ABCA4 coding sequence NM_000350 was used as the WT form with the exception of the following nucleotide changes that did not influence the amino acid sequence: 1,536 G>T; 5,175 G>A; 6,069 T>C (numbered herein according to the ABCA4 coding sequence, SEQ ID NO: 11). Codon-optimization of this ABCA4 coding sequence was performed and generated by GenScript (Piscataway, N.J., US). WT and CO ABCA4 full length coding sequence (6,822 nucleotides) were inserted into plasmids containing AAV2 ITRs to generate CAG.ABCA4.pA and CAG.coABCA4.pA. Upstream transgenes for dual vector in vitro comparisons contained a shortened version of CAG using only the CMV. CBA enhancer/promoter elements prior to the ABCA4 coding sequence fragment. These constructs were generated by amplifying the CMV. CBA elements of CAG and attaching them to the desired ABCA4 coding sequence fragment (see Table 2) by PCR before cloning the entire fragment in between the AAV2 ITRs using SwaI restriction sites. Upstream transgenes for in vivo experiments were prepared in the same way except the GRK1 promoter was amplified and attached to the desired ABCA4 coding sequence fragment by PCR before being ligated (inserted) into the AAV plasmid. For the optimized upstream transgene, 176 nucleotides of the CAG intron/exon region were amplified and attached to the end of the GRK1 promoter by PCR technique. This amplicon was then attached using PCR to the desired ABCA4 coding sequence and inserted between the ITRs using SwaI. Downstream transgenes were identical for in vitro and in vivo use, the desired fragments of ABCA4 coding sequence (see Table 2) were amplified and attached to WPRE and bovine growth hormone polyA signal by PCR before being inserted into ITR containing plasmids using SwaI restriction sites.
This vector contains a promoter, untranslated region (UTR) and upstream segment of ABCA4 CDS with an AAV2 ITR at each end of the transgene (
The 199 nucleotides of the GRK1 promoter are followed by an untranslated region (UTR) 186 nucleotides in length. This nucleotide sequence was selected from the larger UTR (443 nucleotides) contained in the REP1 clinical trial vector (MacLaren et al., 2014). Specifically, the selected sequence includes a Gallus β-actin (CBA) intron 1 fragment (with predicted splice donor site), Oryctolagus cuniculus β-globin (RBG) intron 2 fragment (including predicted branch point and splice acceptor site) and Oryctolagus cuniculus β-globin exon 3 fragment immediately prior to the Kozak consensus, which leads into the ABCA4 CDS. This UTR fragment has been added to the original GRK1 promoter element to increase translational yield (Rafiq et al., 1997; Chatterjee et al., 2009). By itself, the GRK1 promoter has shown very good gene expression capabilities in photoreceptor cells.
Comparison of dual vector injected Abca4−/− retinae reveals more ABCA4 protein is generated from eyes in which the upstream vector carries the GRK1.5′UTR element compared to the GRK1 promoter element alone (
Having determined the optimal overlap sequence within the human ABCA4 coding sequence that both improved recombination efficiency and limited production of tABCA4, the dual vector system was optimized to further to increase full length ABCA4 expression levels from successfully recombined transgenes. Original transgene designs for in vivo assessments included the GRK1 promoter element with a portion of the ABCA4 coding sequence in the upstream transgene and ABCA4 coding sequence, WPRE and polyA signal in the downstream transgene. While the GRK1 promoter drives good expression in mouse photoreceptor cells, various elements could improve yield. Inclusion of an intron within a transgene has been shown to improve translational yield and in the case of a dual vector system, this could contribute to achieving the level of target protein required to elicit a therapeutic effect. To investigate the influence of a 5′UTR sequence containing a spliceable element, a region from the 5′UTR similar to an intron used in an AAV2/2 CAG vector was inserted.
The effect of the 5′ UTR can be seen in
Neural retinae were harvested for mRNA extraction and subsequent RT-PCR and sequencing analysis spanning the overlap zones confirmed that ABCA4 transcripts generated from recombined transgenes did not carry mutations (
Following the Kozak consensus in the upstream vector is the ABCA4 CDS from nucleotide 1 to 3,701 (105 to 3,805 in NCBI reference file NM_000350). The final 208 nucleotides of the ABCA4 CDS form the first 208 nucleotides of CDS contained in the downstream vector and serve as the overlap zone. The coding sequence fragment contained in the upstream vector matches the reference sequence NM_000350 with the exception of a base change at nucleotide 1,536 (NM_000350 1,640) G>T. This is the third base of the codon and does not result in an amino acid sequence change. The ABCA4 CDS is truncated within exon 25 with the 3′ITR downstream of this.
This vector contains the downstream segment of ABCA4 CDS, a Woodchuck hepatitis virus post-transcriptional response element (WPRE) and bovine growth hormone poly-adenylation signal (bGH polyA) with an AAV2 ITR at each end of the transgene (
The restriction site HindIII separates the ABCA4 CDS stop codon from the WPRE. This element is 593 nucleotides in length and matches the X antigen inactivated WPRE contained in the REP1 clinical trial vector. A restriction site for SphI then separates the WPRE from the bGH poly A signal, which is 269 nucleotides in length and matches the bGH poly A signal present in the REP1 clinical trial vector. The 3′ITR then lies downstream of the polyA signal.
The AAV2 5′ITR is known to have promoter activity and with the WPRE and bGH poly A signal within the downstream transgene, stable transcripts will be generated from unrecombined downstream vectors. The wild-type ABCA4 CDS contained in the downstream transgene carries multiple in-frame AUG codons that cannot be substituted for other codons without altering the amino acid sequence. This creates the possibility of translation occurring from the stable transcripts, leading to the presence of truncated ABCA4 peptides that are detectable by western blot (
In some embodiments of the dual overlapping vectors, the presence or absence of a WPRE affected protein expression from the dual overlapping vectors. Protein expression from the vectors with overlap zone B is shown in
Having identified an optimal vector and ABCA4 sequence to use for recombination, the effects of varying the overlap length of base pairing between plus and minus strands were assessed.
Table 2 contains transgene details for the dual vector combinations tested, numbered relative to the ABCA4 coding sequence (SEQ ID NO: 11). The final row contains the details for the optimized overlapping dual vector system. ABCA4=ATP-binding cassette transporter protein family member 4; CDS=coding sequence; GRK1=human rhodopsin kinase promoter; pA=polyA signal; WPRE=Woodchuck hepatitis virus post-transcriptional regulatory element.
Transgene length affects AAV packaging efficiency and therefore titre. A maximum transgene size of 4.9 kb was therefore targeted (Table 2). Six overlap variants were prepared (A-F) with an additional variant designed with no overlapping region between transgenes (X) in attempt to identify an optimal overlap zone within the ABCA4 coding sequence (
The optimal overlap zone was determined following in vitro and in vivo assessments of six overlap variants (
The overlap zone selected has a GC content of 52% and free energy prediction of −19.60 kcal/mol, which is nearly three times less that of overlap zone B at −55.60 kcal/mol (53% GC content),
HEK293T cells were transduced with each dual vector overlap variant (with expression driven from a CMV enhancer, CBA promoter element) at an MOI of 10,000. Cells were harvested 5 days post-transduction and ABCA4 expression was measured by western blot analysis with ABCA4 detection levels normalized to GAPDH and presented as values above background levels of the untransduced samples. The overlap region was observed to have a significant influence on the levels of ABCA4 generated (p<0.0001,
HEK293T cells were transduced with each dual vector overlapping variant and ABCA4 expression was measured by western blot analysis. The overlap region was observed to have a significant influence on the levels of ABCA4 generated (p<0.0001,
The dual vector variants were then injected into the sub-retinal space of Abca4−/− mice and the neural retinae removed 6 weeks post-injection for ABCA4 detection. Data were compiled from multiple injection groups with a total of 3-16 eyes per dual vector. Comparisons of ABCA4 protein levels in these retina samples indicated that as with the in vitro study, the overlap region influenced the levels of ABCA4 generated (p=0.001,
The effect of adding an intron immediately after the promoter, which may augment gene expression, was explored. Including an intron (In) between the promoter and start codon had a significant influence on levels of full length ABCA4 achieved, with a minimum 1.5-fold increase in detection observed following treatment with overlapping vector variants (p=0.004), in the presence of a WPRE element. Subsequent injections with the optimized dual vector variant InC revealed consistent detection of full length ABCA4 in Abca4−/− injected eyes (
Neural retinae were harvested for mRNA extraction and subsequent RT-PCR and sequencing analysis spanning the overlap zones confirmed that ABCA4 transcripts generated from recombined transgenes did not carry mutations. Further RT-PCRs confirmed that the intron included in the optimized dual vector system (InC) had been successfully spliced from mRNA transcripts. Hence the dual vector system is optimized in terms of capsid, overlap zone and transgene regulatory elements.
While the data confirm previous findings of improvements in transduction when using AAV8 Y733F compared to wild-type capsids to deliver transgenes to photoreceptor cells of the mouse retina, one aspect of the overlapping dual vector strategy is the event of recombination between two transgenes. The event of recombination between two transgenes is effected by changing the overlap region length. Six different overlap regions ranging from 1.1 kb to 0.02 kb were compared (
b, 8b: Abca4−/− mice received a 2 μl subretinal injection of a dual vector mix (1:1), delivering 1E+9 genome copies of each vector per eye. Enucleation of the eye was performed 6 weeks post-injection with the neural retina dissected from the eye cup and lysed in RIPA buffer. The tissue was homogenized and the supernatant extracted following centrifugation. Supernatants were mixed with denaturing loading buffer and run on a 7.5% TGX gel under denaturing conditions. Proteins were transferred to a PVDF membrane and ABCA4 detected with rabbit polyclonal anti-ABCA4 (Abcam) and Gapdh detected with mouse monoclonal anti-GAPDH (Origene). Bands were visualized and analyzed using the LICOR imaging system. ABCA4 levels were normalized to Gapdh for each sample and then represented relative to uninjected Abca4−/− eyes.
Transductions were performed by plating HEK293T cells then lifting one well of cells 24 hours after plating (being at 80-90% confluence) to count the cells in one well. HEK293T cells were used to seed 6 well culture plates at 2E5 cells per well. After 24 hours, one well of cells was lifted and counted. This count was used to determine the appropriate amount of vector to provide to each well to give a multiplicity of infection (MOI) of 20,000 per vector. Each AAV was applied at an MOI of 20,000 based on this count. Each AAV was applied at an MOI of 20,000 based on this count. The AAV vector was added at the desired MOI to a half well volume of culture media without FBS and with 200 nM doxorubicin (Sigma-Aldrich, UK). Wells were aspirated and the volume containing AAV and doxorubicin was added to the cells, which were incubated at 37° C., 5% C02 for one hour. The remaining volume of culture media was then added to each well containing 20% FBS and cells were incubated at 37° C., 5% C02 with a media change conducted 2 and 4 days post-transduction. 48 hours post-transduction the media was removed and fresh media containing 10% FBS applied. Cells were incubated for a further 48 hours after which another media change occurred. 24 hours later, cells were harvested and washed three times in cold PBS using a gentle centrifugation cycle. The final PBS wash was removed and the cell pellets frozen. Cell pellets were thawed on ice then lysed in RIPA buffer. Cells were harvested as described above one week post-transduction. Lysates were treated as per the retina samples described above for western blot analysis.
In vivo experiments: All animal breeding and experimental procedures were performed under approval of local and national ethical and legal authorities and were conducted in compliance with the ARVO statement for the Use of Animals in Ophthalmic and Vision Research. Pigmented Abca4−/− mice (129S4/SvJae-Abca4tm1Ght) were provided by Gabriel Travis (David Geffen School of Medicine, University of California, Los Angeles, Calif.) and bred in the Biomedical Sciences division, University of Oxford. Pigmented WT control mice (129S2/SvHsd) were purchased from ENVIGO (Hillcrest, UK). Animals were kept in a 12 hour light (<100 lux)/dark cycle with food and water available ad libitum. Sub-retinal injections were performed by delivering 2 μl of reagent under direct visual guidance using an operating microscope (Leica Microsystems, Germany). Early experiments used a scleral tunnel approach through the posterior pole to the superior retina with a Hamilton syringe and 34-gauge needle (ESS labs, UK), this injection system and method was used for eyes assessed in
Transcript analysis: Samples were either HEK293T frozen cell pellets or neural retina stored in RNAlater (ThermoFisher Scientific, UK). Neural retina samples were achieved by dissection of eye cups following enucleation and were placed in RNA immediately following dissection. Samples were thawed on ice and mRNA extracted using mRNA DIRECT Dynabeads-oligodT (Life Technologies, UK) with 500 ng of mRNA then used in a SuperScript III cDNA synthesis reaction with oligodT primer as per the manufacturers guidelines. The cDNA was cleaned in QIAGEN spin columns and eluted in 50 μl DEPC-treated water. Transcripts were assessed by qPCR using 2 μl of each cDNA preparation (qPCR primers listed above). ABCA4 levels were normalized to ACTINActin levels. For RT-PCR, 2 μl of cDNA was used to identify upstream only transcript length (FW 5′GATTACAAAGATGACG (SEQ ID NO: 71), REV 5′GCAATTCAGTCGATAACTA (SEQ ID NO: 72)), overlap (FW 5′ACCTTGATCAGGTGTTTCCA (SEQ ID NO: 73), REV 5′ACAGAAGGAGTCTTCCA (SEQ ID NO: 74)) and 5′UTR assessments (FW 5′CCACTCCTAAGCGTCCTC, REV 5′CAGGGATTGTTCACATTGC (SEQ ID NO: 75)). Amplicons for sequence analysis were PCR-purified or cloned and purified before Sanger sequencing.
Western blot assessment: Samples were either HEK293T frozen cell pellets or frozen neural retina tissue. Neural retina samples were achieved by dissection of eye cups following enucleation and were frozen in lysis buffer (RIPA buffer (MerckMillipore, UK), plus proteasome inhibitor (Roche, UK)) on dry ice immediately following dissection. Samples were thawed on ice and lysed using a hand-held homogeniser and rotated at 4° C. for one hour prior to spinning at 17,000×g for 30 mins, 4° C. The supernatant was removed with 20 μl added to 5 μl protein loading buffer (GeneFlow, UK). This was left at room temperature for 15 minutes prior to loading on a 7.5% TGX gel (BioRad, UK). Proteins were transferred to a PVDF membrane using a TransBlotTurbo with subsequent ABCA4/Abca4 (ab72955, Abcam, UK) and GAPDH/Gapdh detection (TA802519, Origene, US) conducted using a SNAPiD system (MerckMillipore, UK). Blots in
Data sets was assessed for normal distribution (Shapiro-Wilk test) and variance (Brown-Forsythe test). Ff data for comparison exhibited unequal variance (skewed and unpaired) then non-parametric tests were performed (Mann-Whitney U-test or Kruskal Wallis). If variances were equal (the data were normally distributed and paired) then parametric tests were used (Student's t-test or ANOVA). Multiple comparisons were conducted with correction using either Tukey's or Sidak's comparisons test (if ANOVA) or Dunn's comparisons (if Kruskal Wallis). Brief descriptions of the drawings indicate the test used to analyses each specific data set with n, p and F values provided where appropriate. Data are shown as mean and SEM.
The data presented in this Example demonstrate the expression of ABCA4 protein specifically localized in the photoreceptor outer segments of the Abca4−/− mouse model following sub retinal injection with an overlapping dual vector system of the disclosure.
Transgene design and production: Overlapping ABCA4 transgenes were packaged into AAV8 Y733F capsids. The upstream transgene contained the human rhodopsin kinase (GRK1) promoter and an upstream portion of the ABCA4 coding sequence (CDS) between AAV2 inverted terminal repeats (ITRs). The downstream transgene contained a downstream portion of the ABCA4 CDS, Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and a polyA signal (pA). Both the upstream and downstream transgenes carried a region of ABCA4 CDS overlap.
Injections: Abca4−/− mice received a 2 μl sub retinal injection at 4-5 weeks of age containing a 1:1 mix of the upstream and downstream vectors (1×1013 gc/ml). Eyes were harvested at 6 weeks post-injection for immunohistochemical (IHC) assessments.
Initial sub-retinal injections delivered 2E+9 total genome copies of the various dual vector combinations. Abca4−/− eyes injected with 2E+9 or 2E+10 total genome copies were compared in relation to ABCA4 protein levels achieved. More ABCA4 was detected in eyes that received the higher dose (
Immunohistochemical staining: Whole eye cups with the lens removed were fixed in 4% paraformaldehyde (PFA) for 20 minutes at room temperature. Eye cups were transferred to a 10% sucrose solution for one hour, followed by a 20% solution for one hour, and then incubated in 30% sucrose overnight at 4° C. Eye cups were placed in O.C.T compound (VWR, UK), incubated for 30 mins then frozen on dry ice and stored at −80° C. Eyes were sectioned using a cryostat and dried overnight on slides at room temperature under dark conditions before use. Tissue slices were dried overnight at room temperature then rinsed in phosphate buffered saline (PBS) for 5 minutes, three times. Samples were permeabilized with 0.2% Triton-X-100 for 20 minutes then washed three times in PBS before incubating with 10% donkey serum (DS), 10% bovine serum albumin (BSA) for one hour. Antibodies were diluted 1/200 in 1% DS, 0.1% BSA, applied to sections and left for two hours at room temperature or overnight at 4° C. Abca4/ABCA4 detection was achieved with goat anti-ABCA4 (AntibodiesOnline), hyperpolarization activated cyclic nucleotide gated potassium channel 1 (Hcn1) detection with mouse anti-Hcn1 (Abcam) and rhodopsin detection with mouse anti-1D4 (Abcam). Sections were rinsed three times with 0.05% Tween-20 then secondary antibodies applied (diluted 1/400) for two hour under dark conditions at room temperature. Sections were rinsed twice with 0.05% Tween-20 then incubated with Hoescht stain (1/1,000) for half an hour. Sections were rinsed in PBS then leg to air dry. ProLong Diamond anti-fade mounting medium was applied to each section and slides were left overnight before imaging. Primary antibodies used were: ABCA4/Abca4 detection (ABIN343052, AntibodiesOnline, Germany), Hcn1 detection (mouse monoclonal ab84816, Abcam, UK), Rho detection (ab5417, Abcam, UK). Anti-ABCA4 specificity was confirmed by western blot analysis using pCAG.ABCA4.pA transfected HEK293T lysate, wild-type mouse retinal lysate and commercially available human ABCA4 peptide (Abcam, ab114660). Secondary antibodies used were all donkey Alexa Fluor: anti-goat 488 (ab1050129, Abcam, UK) and anti-mouse 568 (ab175472, Abcam, UK).
Since ABCA4 is a large and complex folded protein that undergoes post-translational modification and is trafficked to the cell membrane of the specialized compartment of the photoreceptor outer segment, immuno-histochemical localization provides additional indirect information on protein structure beyond the western blot. Immunohistochemical staining was performed to confirm correct localization of ABCA4 in the photoreceptor cell outer segments of the retina after dual vector transduction by sub-retinal injection. Anti-Hcn1 was used to highlight the limit of the photoreceptor inner segments. Images were taken on a confocal microscope and focusing on the outer segments masked the RPE layer, which required imaging on a different focal plane to observe any staining therefore RPE images are presented separately (
ABCA4 Co-Localization with Rhodopsin.
For Abca4−/− eyes injected with the optimized dual vector system (5′C), ABCA4 staining was evident in the outer segments of the photoreceptor cells (
An optimized overlapping dual vector system can be used to generate ABCA4 expression in photoreceptor cells where it is trafficked to the desired outer segment structures at levels detectable by IHC.
Accumulation of bisretinoids are hallmarks of Stargardt disease and believed to play a primary role, or be the major driver for in retinal degeneration in humans. A reduction in these molecules provides a functional assay in which to assess the efficacy of the dual vector AAV system in Abca4−/− mice. The specific localization of dual vector delivered ABCA4 to the outer segment discs of the Abca4−/− photoreceptor cells implies correct folding of the full length ABCA4 protein, particularly given that the two transmembrane domains (TMD) were encoded across the two vectors, TMD1 in the upstream vector and TMD2 in the downstream. This study used pigmented Abca4−/−, a mouse model without significant photoreceptor cell loss, at least up to one year of age. The pigmented mouse model used in this study does not suffer from retinal degeneration nor does it have a detectable ERG phenotype. However, a consistent feature of these mice is the extensive accumulation of quantifiable bisretinoids over time, thus recapitulating a pathological hallmark of the human disease.
The Abca4−/− mouse model exhibits an increase with age in levels of bisretinoids and A2E compared to wild type mice. In contrast to humans, however, the increase in bisretinoids does not reach a level that would be required to cause any significant retinal degeneration. This suggests that other compensatory mechanisms may exist in the Abca4 deficient mouse eye. In a wild type retina, Abca4 facilitates the movement of retinal out of the photoreceptor cell outer segment disc membranes for recycling. When there is an absence of functional Abca4, as in the Abca4−/− mouse model, the retinal is maintained in the outer segment disc membranes where it undergoes biochemical changes into various bisretinoid forms (
Bisretinoid and A2E compounds can be accurately measured by high-performance liquid chromatography (HPLC). A measure of therapeutic efficacy in mice treated with ABCA4 gene therapy would therefore be to achieve a reduction in the levels of bisretinoids and A2E compared to untreated eyes. There are however two considerations that need to be addressed. In the first instance, for clinical application we need to use a human ABCA4 coding sequence and a human photoreceptor promoter and this is unlikely to be as efficacious in the mouse. Furthermore HPLC measurements are taken from the whole eye and not just the region exposed to the vector by the subretinal injection. Hence the overall reduction in bisretinoids in the Abca4 deficient mouse is unlikely to reach wild type levels. The second consideration is the subretinal injection, which may lead to damage of the outer segment discs. Since these structures are rich in bisretinoids, the effects of ABCA4 gene therapy need to be compared with a similar sham injection. Ideally the contralateral eye of the same mouse should be used for this to control for eye size and lifetime light exposure, which may also influence bisretinoid accumulation.
For this reason we compared the bisretinoid/A2E levels in a cohort of Abca4−/− mice that received a sham injection in one eye and a similar treatment injection in the contralateral eye. Each sham eye received the upstream vector at the same total AAV dose as that which was received in the paired dual vector treatment eye. Both eyes of each mouse therefore received a 2 μl subretinal injection, forming a bleb containing 2×1010 genome particles of AAV vector.
A total of 13 Abca4 knockout mice were injected at 4-5 weeks of age and eyes were harvested 3 months post-injection. To investigate whether the ABCA4 present in the photoreceptor outer segments of treated Abca4−/− mice was functioning and providing therapeutic effect, eyes were assessed for bisretinoid/A2E levels by HPLC analysis. Mice were dark adapted for 16 hours prior to tissue collection, which was conducted in the dark under dim red light.
In a completely blinded study, whole eyes of treated Abca4−/− mice were harvested then anonymized and shipped frozen to the Jules Stein Eye Institute for processing of the levels of all-trans-retinal dimer-phosphatidylethanolamine (atRALdi-PE), N-retinylidene-N-retinylphosphatidylethanolamine (A2PE), di-hydro-A2PE (A2PE-H2), conjugated N-retinylidene-N-retinylphosphatidylethanolamine (A2E) and a double bond isomer of A2E (iso-A2E) in Abca4−/− mice. Anonymized eyes of 13 Abca4−/− mice received the upstream vector-only in one eye (sham) and the dual vector in the contralateral eye (treatment), with each eye receiving the same total AAV dose. Eyes were harvested in dark conditions, processed, and analyzed by high performance liquid chromatography at another center (JSEI) to determine levels of all-trans-retinal dimer-phosphatidylethanolamine (atRALdi-PE), N-retinylidene-N-retinylphosphatidylethanolamine (A2PE), di-hydro-A2PE (A2PE-H2), conjugated N-retinylidene-N-retinylphosphatidylethanolamine (A2E) and its major cis-isomer (iso-A2E). Each whole eye was taken and processed without dissection. These assessments were performed with the identity of each eye masked. Enucleation was conducted under dim red light and eyes were immediately frozen and stored at −80° C. protected from light. Eyes were then shipped frozen at −70° C. by World Courier Services. The travel time was less than 48 hours and temperature logs confirmed the specimens remained frozen throughout. Bisretinoid extraction and assessment by HPLC was performed on the eyes as previously described. Following HPLC assessments of all 26 eyes, the identities were subsequently unmasked and bisretinoid/A2E levels for each treated eye were compared to their paired sham injected eye. Two-way ANOVA determined the treatment to have an effect on the levels of bisretinoid/A2E with a reduction in dual vector treated eyes observed compared to paired sham injected eyes (p=0.0171),
An initial study consisted of two groups of 11 mice, the first group had an uninjected eye and a dual vector treated eye whilst the second group had an uninjected eye plus a sham injected eye. The sham injection contained the upstream vector only of the same total dose as that which was received in the dual vector injected group (2E+10 total genome copies). ). Levels of each bisretinoid marker in the uninjected eye were compared to levels in the paired injected eye of each mouse and presented as the fold change between eyes with “1” therefore representing the bisretinoid value in the paired uninjected eye (
Variability in baseline bisretinoid/A2E levels were noted between uninjected control eyes. To reduce the influence of this natural variability, which may have related to different eye cup sizes in animals of different ages, a second confirmatory study was performed which used the fellow eye in each animal as an internal control. In the second study, Abca4−/− mice received the upstream vector in one eye (sham) and the dual vector in the contralateral eye (treatment), with each eye receiving the same total AAV dose. 13 mice received the upstream vector in one eye (sham) and the dual vector in the contralateral eye (treatment), both eyes received the same total vector dose of 2E+10 genome copies. The same bisretinoids were assessed with the data presented as a comparison of the levels of each biomarker detected in paired eyes. The treatment was observed to have an influence on the bisretinoid/A2E levels in Abca4−/− mouse eyes compared to sham injected eyes (p=0.03,
Using antibodies directed against the C-terminus of the ABCA4 protein, western blot assessment identified additional truncated ABCA4 (tABCA4) protein −135 kDa following downstream vector only injection in Abca4−/− mice (
One aspect in the optimization of the dual vector system was limiting unwanted expression from unrecombined transgenes. Despite the detection of ABCA4 mRNA transcripts from upstream vector only injected eyes, ABCA4 protein forms were not detected (
AAV doses in vitro were consistent for all variants and Abca4−/− eyes received 1×109 genome copies of each vector per eye except dual vector variant A, which due to its larger transgene size packaged less efficiently and therefore the final dose was 8×108 genome copies per eye. Dual vector variant 5′C was identified as the optimal dual vector system and when used at a higher dose of 1×1010 genome copies per eye, a significant improvement in levels of ABCA4 was achieved (p=0.006,
In one case, to reduce expression of truncated ABCA4 from the downstream vector overlap C (207 bp) was selected. Overlap C, although slightly less efficient than B (505 bp), gave a purer ABCA4 protein which could have safety benefits in the clinical scenario. Therefore, overlap C was combined with the intron-containing upstream vector and both were packaged into AAV8 Y733F capsids. This dual vector combination was used for subsequent testing in vivo in the Abca4−/− mouse at 1010 genome copies per eye.
Based on evidence that a WPRE increases AAV transcript expression levels, we initially included this element in our downstream transgene design. However, with the observations of mRNA transcripts and truncated protein being generated from unrecombined downstream transgenes, we contemplated removing the WPRE to potentially limit this unwanted expression. Levels of truncated ABCA4 protein were reduced in vitro when the WPRE from variant B was removed (variant Bx) (
Assessing the safety of a dual vector system includes the identification of unwanted byproducts from unrecombined transgenes. Assessments using either upstream or downstream vectors (not in combination) revealed that each vector in an unrecombined state can generate truncated ABCA4 mRNA transcript forms. The upstream transgene nucleotide sequence contained a SwaI restriction site used for cloning purposes that could be acting as a cryptic polyA signal: TTTAAA, which has been identified as a polyA signal in 1-2% of human genes. The absence of any protein detection following treatment with the upstream vector could be attributed to the lack of an in-frame stop codon in the resulting mRNA transcript, which would lead to degradation of any generated peptide. Truncated ABCA4 (tABCA4) protein was detected from original downstream vector designs (
Having improved recombination efficiency and determined an optimal overlap region using the WT ABCA4 sequence, further ways to increase expression from recombined transgenes were demonstrated. There is evidence indicating that including a WPRE in the transgene structure could increase ABCA4 expression from recombined transgenes. However, an added complication in including this genetic element was that in early transgene designs, unwanted protein expression of truncated (tABCA4) was observed from the unrecombined downstream vector, which did contain a WPRE. Removing the WPRE reduced the levels of tABCA4 but given that the chance of the dual vector approach achieving therapeutic levels of ABCA4 could rely on generating the most amount of protein from a given recombined transgene, keeping the WPRE was also effective. Subsequent changes to the downstream transgene design were able to reduce truncated ABCA4 to negligible levels whilst maintaining the WPRE in the construct.
Including a spliceable 5′UTR element improved levels of full length ABCA4 protein achieved following dual vector treatment. It has previously been shown that introns near the promoter can augment pre-mRNA synthesis and interact synergistically with the polyadenylation machinery to enhance 3′ end transcript processing. Studies have shown that mRNA transcripts which undergo splicing exhibit higher translational yields than equivalent intronless transcripts and placing the intron near the promoter enhances gene expression more than when used inside the coding sequence. This data supports and reinforces these findings, and encourage and support the standard use of introns in vector transgenes.
Other dual vector approaches and nanoparticle delivery have led to successful ABCA4 expression in adult Abca4−/− mice and provided evidence of positive effects attributed to the ABCA4 expression. This study shows for the first time convincing expression of ABCA4 in the photoreceptor outer segments of adult Abca4−/− mouse retinae following injection with an optimized overlapping dual vector system. This ABCA4 exhibited functional activity by reducing the levels of bisretinoids that accumulate in the disease model, an effect that was confirmed in two independent in vivo studies in the mouse model. In patients with Stargardt disease, the bisretinoid accumulation leads to death of the RPE cells and subsequently the degeneration and death of the photoreceptor cells, which results in blindness. Given the progressive degenerative nature of this disorder, providing therapeutic intervention at any age could be anticipated to be beneficial by preserving the surviving cells of the retina. By optimizing an overlapping dual vector system to increase the levels of therapeutic protein delivered to the target cells and, importantly, reducing the expression of unwanted products that often occur in dual vector strategies, AAV gene therapy clinical trial prospects for Stargardt disease are now looking increasingly achievable.
Initial comparisons of ABCA4 protein levels were compared from wild-type and codon-optimized ABCA4 coding sequences: In some cases, protein production could be enhanced through the use of a codon optimized (CO) ABCA4 coding sequence. Plasmids were generated carrying an expression cassette identical but for the inclusion of WT or CO coding sequence. Samples were harvested 48 hours post-transfection and lysates assessed by western blot analysis with ABCA4 detection standardized to GAPDH sample levels and data presented as values above background (of transfected samples). Constructs identical but for the inclusion of wild-type (WT) or codon-optimized (CO) ABCA4 coding sequence were compared and revealed a significant 3.1-fold increase in ABCA4 protein generated from CO coding sequence compared to WT coding sequence (
To investigate whether an increase in ABCA4 protein generation by codon optimization could also be achieved in a dual vector scenario, AAV2/2 in vitro transductions using overlapping dual vectors (identical but for the inclusion of WT or CO coding sequence) were performed. The protein analysis from these samples revealed no difference in ABCA4 levels (
To determine if such positive effects of the CO coding sequence could be achieved in vivo, Abca4-mice received a sub-retinal injection of AAV2/8 overlapping dual vectors carrying transgenes identical but for the coding sequence being WT or CO with expression driven by the GRK1 promoter (transgene details Table 2). The overlap zone for both dual vector systems started at position 3,154 of the ABCA4 cDNA and finished at nucleotide 4,326, the GC content of the overlap region for both WT and CO sequences was 55% (Table 2). ABCA4 detection from isolated retinae was assessed at 2 weeks and 6 weeks post-injection with an influence of the coding sequence observed (p=0.04,
Side-by-side comparisons of intact full length WT and CO ABCA4 coding sequence indicated that the codon-optimization of ABCA4 did enable higher translational rates. However, given that the coding sequence was used as the region of overlap in the dual vector system, the changes made to the coding sequence in the CO variant may have influenced the success of recombination. If the CO transgenes were recombining as efficiently as the WT version, it would have been anticipated that from an equivalent number of transgenes, the CO variant would produce more protein. Yet when tested in vivo, dual vectors containing the WT coding sequence generated more ABCA4 than the equivalent CO dual vector system. This may indicate that WT dual vector injected eyes contained more successfully recombined transgenes than CO dual vector injected eyes. Alternatively, the transgenes could have recombined to a similar extent yet the CO ABCA4 coding sequence was translated less efficiently in mouse photoreceptor cells. The codon-optimization was weighted towards human expression therefore the translation rate in the mouse may have been negatively influenced. However, the WT sequence used was human-derived and would also have a different codon-bias preference than would be ideal for use in mouse cells therefore both sequences could be considered to be disadvantaged when translated in mouse cells. Another consideration is that only one overlap region for the WT and CO dual vector systems was compared, and the importance of the overlap region in the success of the overlapping dual vector system has since been shown. Finally, the codon changes in this scenario are not just limited to mRNA translation, but also to DNA repair, because the second strand synthesis is contributes to the success of the dual vector strategy and this may be favored by certain nucleotides being exposed.
Whilst ABCA4 detection was higher when using a codon-optimized construct in plasmid form, for dual vector AAV recombination it was found that the wild-type sequence was more efficacious. In some embodiments, changing codons also affects DNA base pairing and hence has a direct influence on dual vector recombination in this scenario.
With no enhancement observed in ABCA4 production with the use of CO ABCA4 coding sequence in the overlapping dual vector system, we opted to use the WT coding sequence in subsequent optimizations. It was noted that from retinae injected with only the downstream vector, either WT or CO coding sequence, that a truncated ABCA4 (tABCA4) protein ˜135 kDa was detectable (
Directly measuring bisretinoid levels in Abca4−/− mice enabled quantifiable assessment of therapeutic efficacy in vivo. In addition to directly measuring bisretinoid/A2E levels of treated Abca4−/− mice three months post-injection, scanning laser ophthalmoscopy (SLO) assessment of autofluorescence was also performed at 3 and 6 months post-injection using the 790 nm wavelength shown to be associated with melanin accumulation. Scanning laser ophthalmoscopy (SLO) assessment of autofluorescence was also performed using the 790 nm wavelength as an in vivo measure for melanolipofuscin accumulation. SLO assessment of autofluorescence is a potential human clinical trial endpoint. The mouse model exhibits an increase in lipofuscin and melanin-related autofluorescence over time, compared to WT control mice. The 488 nm wavelength autofluorescence measurements were shown to reflect an accumulation of lipofuscin whilst the 790 nm wavelength autofluorescence was associated with melanin accumulation.
In this cohort, mice were injected in one eye with a sham injection (PBS) to control for the effects of retinal detachment, while the contralateral eye received the optimized overlapping dual vector system (2E+10 total genome copies), with the aim of observing a treatment-related decrease in lipofuscin and melanin-related autofluorescence. A standardized SLO protocol based on previous work was used (52) and when extracting the mean grey value of each image, a standardized area of measurement was taken only from the inferior retina to avoid disrupted autofluorescence caused by surgical damage or surgically induced changes around the site of injection which was in the superior hemi-retina. Twelve mice each received the sham injection in one eye and the treatment in the contralateral eye. The eyes that received treatment showed a reduction in mean grey values at both 488 nm and 790 nm wavelengths compared to the paired sham injected eyes (488 nm sham 221.4±4.7 and treatment 205.9±6.3; 790 nm sham 119.9±5.2 and treatment 101.4±7.1). Between 3 and 6 months post-injection, eyes exhibited an increase in 790 nm autofluorescence but the increase was greater in the sham injected eyes compared to the paired dual vector injected eyes (p=0.04,
Mouse fundus autofluorescence (AF) imaging using a confocal scanning laser ophthalmology (cSLO; SpectralisHRA, Heidelberg Engineering, Heidelberg, Germany) was performed using a standardized protocol. Fluorescence was excited using a 488 nm argon laser or a 790 nm diode laser. Animals were anaesthetized and pupils fully dilated as described. A custom-made contact lens was placed on the cornea with hypromellose eye drops (Hypromellose eye drops 1%, Alcon, UK) as a viscous coupling fluid. The NIR reflectance image (820 nm diode laser) was used to align the fundus camera relative to the pupil and to focus on the confocal plane of highest reflectivity in the outer retina. Images were recorded using the “automatic real time” (ART) mode, set to average 24 consecutive images in real time to reduce signal-to-noise ratio. The mean grey value of 488 nm and 790 nm AF images were extracted by measuring a standardized ring shaped area between 250 and 500 pixel radii from the optic disc center using ImageJ software. Each image was then cut to remove the superior retina and the standardized ring applied only to the inferior retina.
Initial in vivo experiments used the AAV2/8 serotype. For example, the WT vs CO comparisons employed AAV8 vectors. However, successful homologous recombination of overlapping plus and minus strands released from two separate AAV vectors might be optimized if the vectors remained within the cell for longer. In some embodiments, changes to the AAV capsid protein amino acids by substituting tyrosine (Y) for phenylalanine (F) have been shown slow down proteosomal degradation but without affecting tropism. In some embodiments, changes to the AAV capsid protein amino acids by substituting tyrosine (Y) for phenylalanine (F) have been shown to improve transduction and in the Abca4−/− retina. The success of the overlapping dual vector approach in Abca4−/− retinae using identical transgenes packaged in either AAV2/8 or AAV2/8 Y733F capsids was compared.
This study has addressed the need for improved dual vector strategies for the treatment of disorders caused by mutations in large genes by demonstrating step-by-step investigations to improve the success of a dual vector overlapping AAV treatment strategy for Stargardt disease. Previously, questions have been raised regarding whether these strategies could lead to production of enough target protein to provide therapeutic effect. Developing a treatment for Stargardt disease is a good example for assessing the possibility of achieving therapeutic effect because the target protein, ABCA4, is required in abundance in the photoreceptor cells of the retina. The optimizations achieved in this work include those universally applicable to AAV gene therapies but specific enhancements presented could also be recommended for implementation in other dual vector strategies.
This data confirmed previous findings of improvements in transduction when using AAV8 Y733F compared to AAV8 capsids to deliver ABCA4 coding sequence in dual vector transgenes. Enhancing transgene delivery and survival in the photoreceptor cells by capsid and dose selection is influential to the dual vector treatment success to increase the opportunity for intermolecular interactions between transgenes. This was further highlighted by comparison of eyes injected with dual vector at different doses in which a higher dose led to an increase in the detection of full length ABCA4 protein. An improvement in dual vector success by increasing dose has been previously shown with a hybrid dual vector approach and this data shows a similar result using an optimized overlapping dual vector system.
The Abca4 KO mouse model presents no electroretinogram (ERG) phenotype or histological degeneration except for age-related changes, therefore signs of toxicity can be measured by changes to retinal function and loss of retinal structure.
In a blinded study, Abca4 KO mice received a subretinal injection in the superior retina of the right eye at 4-5 weeks of age (n=8-11 per group). Injected materials tested were: AAV diluent (PBS PF68 0.001%); GRK1.GFP.pA high dose (2E+10 genome copies); upstream vector low dose (2E+9 genome copies); upstream vector high dose (2E+10 genome copies); downstream vector (1E+10 genome copies); dual vector low dose (2E+9 total genome copies); dual vector high dose (2E+10 total genome copies). All vectors were AAV8 Y733F. Standardised optical coherence tomography (OCT) and ERG assessments were performed at 3 and 6 months post-injection.
Mice in all cohorts revealed varying degrees of post-injection damage. Performing a subretinal injection had a significant influence on superior total retinal thickness compared to uninjected paired eyes at both 3 and 6 months post-injection (3 months two-way ANOVA: eye p<0.001, cohort p=0.7012, interaction p=0.6203; 6 months two-way ANOVA: eye p<0.001, cohort p=0.6858, interaction p=0.6230). The reduction in total retinal thickness was not influenced by the injection material with no additional loss observed in vector injected mice compared to those that received AAV diluent only. All cohorts exhibited a significant reduction in ERG amplitude at 1cd.s/m2 between injected and uninjected eyes (3 months two-way ANOVA: eye p<0.0001, cohort p=0.0173, interaction p=0.5954; 6 months two-way ANOVA: eye p<0.0001, cohort p=0.0102, interaction p=0.4437). The change in the magnitude of response between paired eyes was not significantly different between the cohorts at either time point (two-way ANOVA: time point p=0.8507, cohort p=0.4014, interaction p=0.0491).
Performing a subretinal injection in Abca4 KO mice led to loss of total retinal thickness and a drop in ERG amplitude. The magnitude of such changes were no different in dual vector injected mice than those that received AAV diluent only.
All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described products, systems, uses, processes and methods of the disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the disclosure. Although the disclosure has been described in connection with specific preferred embodiments, it should be understood that the disclosure as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the disclosure, which are obvious to those skilled in biochemistry and biotechnology or related fields, are intended to be within the scope of the following claims.
This application claims the benefit of provisional application U.S. Ser. No. 62/653,085, filed Apr. 5, 2018, U.S. Ser. No. 62/765,181, filed Aug. 16, 2018, U.S. Ser. No. 62/734,479, filed Sep. 21, 2018, and U.S. Ser. No. 62/774,004, filed Nov. 30, 2018, the contents of each of which are herein incorporated by reference in their entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US19/26061 | 4/5/2019 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62653085 | Apr 2018 | US | |
| 62765181 | Aug 2018 | US | |
| 62734479 | Sep 2018 | US | |
| 62774004 | Nov 2018 | US |
