Patent Grant
9856480
The invention relates to a DNAzyme for silencing the expression of EGFR. Particularly, the invention relates to an oligonucleotide that specifically hybridizes to EGFR T790M mRNA.
The epidermal growth factor receptor (EGFR) is a transmembrane protein expressed in epithelial surfaces. It plays an important physiological role in epithelial repair and regeneration. Epidermal growth factor (EGF) is a peptide secreted by salivary glands and other glands associated with epithelial surfaces that binds to a specific area in the extracellular domain of EGFR. Upon binding it generates a signal that is transmitted inside the cell. The first intracellular event as a result of EGF binding is a conformational change of the intracellular domain of EGFR that allows adenosine 5′-triphosphate (ATP) to enter the so-called tyrosine kinase (TK) domain, a pocket that contains a tyrosine residue, and donate a phosphate group to the tyrosine residue. The intracellular EGFR carrying a phosphorylated tyrosine becomes capable of associating with other intracellular proteins and originates a series of biochemical reactions that propagate downstream through a very complex network. The best known arms of this network are the mitogen-activated protein kinase (MAPK) pathway, which results in tumor cell division upon activation, and the AKT pathway, which results in enhanced cell survival upon activation. The results of EGFR activation are therefore increased cell proliferation and enhanced cellular tolerance to different insults. Many tumors overexpress EGFR compared to adjacent normal tissues or the epithelial surface from which they originate or have a mutated version of EGFR, intrinsically activated or with an enhanced susceptibility to activation. Such overexpression is thought to be one of the many mechanisms by which tumor cells gain a growth advantage, a key characteristic of the malignant phenotype. Consequently, blocking the EGFR signaling pathway is thought to be a rational strategy for the treatment of many human malignancies. There are basically two ways to inhibit upstream the EGFR signaling pathway: 1) preventing EGF and other natural peptide ligands from binding to the extracellular EGFR domain by the use of specific monoclonal antibodies, and 2) preventing ATP and other phosphate donors from entering the TK pocket of the intracellular EGFR domain by the use of small molecules that structurally fit very well into the pocket (i.e., EGFR TK inhibitors such as gefitinib and erlotinib).
Lung cancer is the leading cause of cancer-related death and non-small cell lung cancer (NSCLC) accounts for about 85% of the cases. In one unique subset of NSCLC patients, lung cancer cells harbor activating mutations in epidermal growth factor receptor (EGFR) and addict to aberrant EGFR signaling for cell survival. Among the activating mutations, L858R mutation and LREA deletion in EGFR account for over 90% of drug-sensitive mutations and show increased binding affinity toward tyrosine kinase inhibitors (TKIs) compared to wild-type EGFR. The administration of TKIs successfully induces the intrinsic apoptosis pathways in EGFR-mutant lung cancer cells; however, the dose-limiting side effect such as skin rash and diarrhea are unavoidably triggered by the concurrent inhibition of wild-type EGFR signaling in normal cells. Moreover, despite the success of tyrosine kinase inhibitors at the beginning of NSCLC treatment, the acquired secondary mutation at the gatekeeper residue 790 of EGFR (T790M), which is found in 50% of drug-resistant patients, weakens the interaction between TKIs and EGFR. Dose-limiting toxicity and T790M-derived drug resistance are the main issues in NSCLC treatment which still remain to be solved.
Ribozymes are naturally-occurring RNA molecules that contain catalytic sites, making them more potent agents than antisense oligonucleotides. However, wider use of ribozymes has been hampered by their susceptibility to chemical and enzymatic degradation and restricted target site specificity. A new generation of catalytic nucleic acids has been described containing DNA molecules with catalytic activity for specific RNA sequences. These DNA enzymes exhibit greater catalytic efficiency than hammerhead ribozymes, producing a rate enhancement of approximately 10 million-fold over the spontaneous rate of RNA cleavage, offer greater substrate specificity, are more resistant to chemical and enzymatic degradation, and are far cheaper to synthesize. With rational design, nucleic acid agents able to act on specific mRNAs to silence the expression of target genes at transcript- or allele-specific levels have been exploited by many labs around the world for decades. Among them, DNAzymes have been comprehensively studied to silence various genes with promising results for use as therapeutic agents. The basic structure of DNAzymes consists of a catalytic domain flanked by two substrate binding arms with their sequences complementary to targeted mRNA sequence.
DNAzyme has shown different reaction rate toward different nucleotide composition at mRNA cleavage site. Besides, unlike siRNAs which requires Dicer protein to form RNA-induced silencing complex (RISC) for mRNA cleavage, divalent metal ions such as Mg2+ or Ca2+, which are abundant in cell cytosol, are sufficient for catalyzing DNAzyme function. Combining these factors together, DNAzymes are cheap, stable, and easy manipulated nucleic acid agents with high efficient mRNA cleavage activity and low non-specific toxicity in cancer therapy.
Gary Beale et al. provide some ribozymes and DNAzymes in inhibiting EGFR expression in A431 cells (Journal of Drug Targeting, August 2003 Vol. 11 (7), pp. 449-456). However, the prior art reference indicates the efficacy of these ribozymes and DNAzymes are less effective in inhibition. Crispin R. Dass et al. published a review article that documents the rise of DNAzymes in the fight against cancer and serves as a forecast for this promising biotechnology in this context (Mol Cancer Ther 2008; 7(2):243-51). US 20120225870 discloses that an anti-ErbB or anti-MET therapeutic may be an enzymatic nucleic acid such as ribozymes, catalytic RNA, enzymatic RNA, catalytic DNA, aptazyme or aptamer-binding ribozyme, regulatable ribozyme, catalytic oligonucleotides, nucleozyme, DNAzyme, RNA enzyme, endoribonuclease, endonuclease, minizyme, leadzyme, oligozyme or DNA enzyme. However, no substantial enzymatic nucleic acid is provided in this reference.
There is still a need to develop DNAzymes which are capable to effectively silence the expression of EGFR or overcome TKI resistance accompanied with lower unwanted side effects.
The invention provides an oligonucleotide or a modified sequence thereof, which specifically hybridizes to EGFR mutation mRNA so as to inhibit the translation thereof in a cell.
The invention also provides an oligonucleotide or a modified sequence thereof, which specifically hybridizes to EGFR T790M mRNA so as to inhibit the translation thereof in a cell, wherein the oligonucleotide comprises consecutive nucleotides having the sequence selected from the group consisting of SEQ ID NOs:1 to 7.
The invention further provides an oligonucleotide or a modified sequence thereof that specifically hybridizes to EGFR E746-A750 deletion mRNA so as to inhibit the translation thereof in a cell, wherein the oligonucleotide comprises consecutive nucleotides having the sequence of SEQ ID NO: 8.
The invention further provides an oligonucleotide or a modified sequence thereof that specifically hybridizes to EGFR L858R mRNA so as to inhibit the translation thereof in a cell, wherein the oligonucleotide comprises consecutive nucleotides having the sequence selected from the group consisting of SEQ ID NOs: 9-15.
The invention also further provides a vector and a host, which comprises a sequence encoding the oligonucleotide or a modified sequence of the invention.
The invention also further provides a pharmaceutical composition comprising the oligonucleotide or a modified sequence thereof, a vector or a host of the invention and a pharmaceutically acceptable carrier.
The invention also further provides a method of specifically cleaving EGFR mutation mRNA or inhibiting EGFR mutation mRNA expression comprising contacting the mRNA with either of the oligonucleotides or a modified sequence thereof of the invention under conditions permitting the molecule to cleave the mRNA or inhibit the expression of the mRNA.
The invention also further provides a method of treating an EGFR-dependent cancer in a subject, comprising administering an effective amount of an oligonucleotide or a modified sequence thereof of the invention to the subject.
The invention also further provides a method of treating EGFR-dependent cancer in a subject, comprising administering a TKI inhibitor or an EGFR-specific antibody and an oligonucleotide or a modified sequence thereof of the invention to the subject.
The invention develops DNAzymes which are capable to silence the expression of EGFR at allele-specific level. These allele-specific DNAzymes against EGFR mutation (especially T790M) will knockdown the expression of EGFR mRNA (especially EGFR T790M mRNA) while keeping EGFR wild-type mRNA intact. Hence, these allele-specific DNAzymes against EGFR mutation (especially T790M) may overcome EGFR mutation-derived TKI resistance accompanied with lower unwanted side effects on normal cells in EGFR-dependent cancer (such as NSCLC) patients. Particularly, the DNAzyme of the invention in combination with a TKI inhibitor or an EGFR-specific antibody provides a synergistic effect in treating an EGFR-dependent cancer such as NSCLC.
The terms “a” and “an” refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
The term “nucleic acid” shall include without limitation any nucleic acid, including, without limitation, DNA, RNA, oligonucleotides, or polynucleotides, and analogs or derivatives thereof. The nucleotides that form the nucleic acid may be nucleotide analogs or derivatives thereof. The nucleic acid may incorporate non nucleotides.
The term “nucleotides” shall include without limitation nucleotides and analogs or derivatives thereof. For example, nucleotides may comprise the bases A, C, G, T and U, as well as derivatives thereof. Derivatives of these bases are well known in the art, and are exemplified in PCR Systems, Reagents and Consumables (Perkin Elmer Catalogue 1996-1997, Roche Molecular Systems, Inc., Branchburg, N.J., USA).
The term “nucleic acid enzyme” refers to a nucleic acid molecule that catalyzes a chemical reaction. The nucleic acid enzyme may be covalently linked with one or more other molecules yet remain a nucleic acid enzyme. Examples of other molecules include dyes, quenchers, proteins, and solid supports. The nucleic acid enzyme may be entirely made up of ribonucleotides, deoxyribonucleotides, or a combination of ribo- and deoxyribonucleotides.
The term “DNAzyme” refers to a single-stranded polynucleotide which is capable of cleaving both single and double stranded target sequences.
The term “treatment” or “treating” refers to a treatment of disease in a mammal, including: (a) protecting against the disease, that is, causing the clinical symptoms not to develop; (b) inhibiting the disease, that is, arresting, ameliorating, reducing, or suppressing the development of clinical symptoms; and/or (c) relieving the disease, that is, causing the regression of clinical symptoms. It will be understood by those skilled in the art that in human medicine, it is not always possible to distinguish between “preventing” and “suppressing” since the ultimate inductive event or events may be unknown, latent, or the patient is not ascertained until well after the occurrence of the event or events. Therefore, as used herein the term “prophylaxis” is intended as an element of “treatment” to encompass both “preventing” and “suppressing” as defined herein. The term “protection,” as used herein, is meant to include “prophylaxis”.
The term “effective amount” means a dosage sufficient to provide treatment for the disorder or disease state being treated. This will vary depending on the patient, the disease and the treatment being effected.
The term “administering” refers to administering according to any of the various methods and delivery systems known to those skilled in the art. The administering can be performed, for example, via implant, transmucosally, transdermally and subcutaneously. In the preferred embodiment, the administering is topical and preferably dermal.
The term “hybridize” refers to the annealing of one single-stranded nucleic acid molecule to another nucleic acid molecule based on sequence complementarity. The propensity for hybridization between nucleic acids depends on the temperature and ionic strength of their milieu, the length of the nucleic acids and the degree of complementarity. The effect of these parameters on hybridization is well known in the art.
The term “inhibit” means to slow, stop or otherwise impede.
The term “pharmaceutically acceptable carrier” refers to any of the various carriers known to those skilled in the art. In one embodiment, the carrier is an alcohol, preferably ethylene glycol. In another embodiment, the carrier is a liposome. The following pharmaceutically acceptable carriers are set forth, in relation to their most commonly associated delivery systems, by way of example, noting the fact that the instant pharmaceutical compositions are preferably delivered dermally.
The term “specifically cleave”, when referring to the action of one of the instant catalytic nucleic acid molecules on a target mRNA molecule, shall mean to cleave the target mRNA molecule without cleaving another mRNA molecule lacking a sequence complementary to either of the catalytic nucleic acid molecule's two binding domains.
The term “subject” shall mean any animal, such as a human, a primate, a mouse, a rat, a guinea pig or a rabbit.
The term “vector” shall include, without limitation, a nucleic acid molecule that can be used to stably introduce a specific nucleic acid sequence into the genome of an organism.
The following abbreviations shall have the meanings set forth below: “A” shall mean Adenine; “bp” shall mean base pairs; “C” shall mean Cytosine; “DNA” shall mean deoxyribonucleic acid; “G” shall mean Guanine; “mRNA” shall mean messenger ribonucleic acid; “RNA” shall mean ribonucleic acid; “RT-PCR” shall mean reverse transcriptase polymerase chain reaction; “RY” shall mean purine:pyrimidine; “T” shall mean Thymine; and “U” shall mean Uracil.
In one aspect, the invention provides an oligonucleotide or a modified sequence thereof that specifically hybridizes to EGFR mutation mRNA so as to inhibit the translation thereof in a cell. In one embodiment, the EGFR mutation is EGFR G719, E746-A750 deletion, T790, L858, D761, V765 and T783. In a preferred embodiment, the invention provides an oligonucleotide or a modified sequence thereof that specifically hybridizes to EGFR T790M mRNA so as to inhibit the translation thereof in a cell, wherein the oligonucleotide or a modified sequence thereof comprises consecutive nucleotides having the sequence selected from the group consisting of SEQ ID NOs:1 to 7.
The sequences of SEQ ID NOs: 1 to 7 are listed as follows:
Preferably, the oligonucleotide has the sequence of SEQ ID NO: 1 or SEQ ID NO:2. More preferably, the oligonucleotide has the sequence of SEQ ID NO: 1.
The above-mentioned embodiment mainly demonstrated the efficacy of allele-specific DNAzyme against T790M to overcome TKI-resistance and reduce toxicity on normal cells. All of the mutations on EGFR mRNA sequences can be designed and functioned in an allele-specific manner. In another embodiment, the invention provides an oligonucleotide or a modified sequence thereof that specifically hybridizes to EGFR E746-A750 deletion mRNA so as to inhibit the translation thereof in a cell, wherein the oligonucleotide or a modified sequence thereof comprises consecutive nucleotides having the sequence of SEQ ID NO: 8. In a further embodiment, the invention provides an oligonucleotide or a modified sequence thereof that specifically hybridizes to EGFR L858R mRNA so as to inhibit the translation thereof in a cell, wherein the oligonucleotide or a modified sequence thereof comprises consecutive nucleotides having the sequence selected from the group consisting of SEQ ID NOs: 9-15.
DNAzyme against EGFR E746-A750 deletion:
DNAzymes against EGFR L858R mutant:
The modified sequence of the invention can be obtained according to the method known in the art. DNAzymes are composed by deoxyribonucleotides which can be easily modified to increase accessibility to targeted RNA, enhance hybridization efficiency toward substrates, improve cleavage activity to complementary sequences, resist degradation against endo- or exo-nucleases in cells and blood stream, and prolong serum half-lives in circulation system. The feasible modifications include introducing modified base on nucleotide structure, modified linkage bonds between nucleotides, and functional groups at the 5′- or 3′-end of DNAzyme. Silverman, Scott K et al. mentioned that chemical modification can be easily introduced to C7 position of the 7-deazaadenine nucleobase and C5 position of the deoxyuriding nucleobase by organic synthesis and these modified bases can be simply incorporated into DNAzyme by suitable polymerases; examples include amine-modified dA, phenol-modified dU, imidazole-modified dU, and pyridine-modified U. (Silverman, S. K. 2008. Catalytic DNA (deoxyribozymes) for synthetic applications-current abilities and future prospects. Chem Commun (Camb):3467-3485.) Schubert, Steffen et al. mentioned that 2′-O-methyl modifications and locked nucleic acid bases comprise a 2′-O, 4′-C methylene bridge that locks in a C3′-endo conformation can enhance DNAzyme cleavage activity. (Schubert, S., Gul, D. C., Grunert, H. P., Zeichhardt, H., Erdmann, V. A., and Kurreck, J. 2003. RNA cleaving ‘10-23’ DNAzymes with enhanced stability and activity. Nucleic Acids Res 31:5982-5992.) Furthermore, phosphorothioate bonds between nucleotides, an inverted thymidine at the 3′-end, cholesterol-TEG group at the 3′-end, and different size of PEG moiety at 5′- or 3′-end of DNAzyme can elevate the feasibility in clinical therapy. (Dass, C. R., Choong, P. F., and Khachigian, L. M. 2008. DNAzyme technology and cancer therapy: cleave and let die. Mol Cancer Ther 7:243-251.) The invention provides a preferred embodiment with respect to the DNAzyme with phosphorothioate bonds between 3 bases at both ends and cholesterol-TEG group at the 3′-end. In other embodiments, different modifications can be introduced to DNAzyme.
The oligonucleotide of the invention is a DNAzyme capable of downregulating the expression of EGFR mutation mRNA (such as EGFR T790M mRNA, EGFR E746-A750 deletion mRNA and EGFR L858R mRNA) that can specifically cleave its complementary polynucleotide. DNAzymes are single-stranded nucleic acid agents which are capable of cleaving both single and double stranded target sequences (Breaker, R. R. and Joyce, G. Chemistry and Biology 1995; 2:6(55, Santoro, S. W. & Joyce, G. F. Proc. Natl, Acad. Sci. USA 1997; 94:4262). A general model (the “10-23” model) for the DNAzyme has been proposed. Schlosser, Kenny et al. mentioned that “8-17” DNAzyme may achieve cleavage reaction at all di-nucleotide compositions with different reaction rates from 0.0001 to 10/min under in vitro single-turnover conditions. This characteristic allows rational designed “8-17” DNAzyme to silence any sequences they are complemented. In addition, “10-23” DNAzyme could only conduct nucleotide cleavage at purine:pyrimidine junction (i.e. GC, AC, GU/T, AU/T) but not at other di-nucleotide junction. This distinguishing selection ability of “10-23” DNAzyme make it becomes beneficial tool for allele-specific silencing gene expression. (Table 1, Schlosser, K., Gu, J., Lam, J. C., and Li, Y. 2008. In vitro selection of small RNA-cleaving deoxyribozymes that cleave pyrimidine-pyrimidine junctions. Nucleic Acids Res 36:4768-4777.) The catalytic domain may optionally contain stem-loop structures in addition to the nucleotides required for catalytic activity. In one embodiment of the catalytic deoxyribonucleic acid molecule, the catalytic domain has the sequence
for 10-23 catalytic core sequence,
for 8-17 catalytic core sequence,
for 8-17 catalytic core sequence and
for bipartite catalytic core sequence, and cleaves mRNA at the consensus sequence purine:pyrimidine. In a preferred embodiment, cleavage occurs at one or more of the cleavage sites in the EGFR T790M mutation mRNA (shown in
Regular DNAzymes have flanked by two substrate-recognition domains of four to twelve deoxyribonucleotides each. These two binding arms provide thermo-stability and substrate specificity between DNAzymes and their complemented targets. For those DNAzymes which binding arms are too short, the interaction strength between DNAzymes and substrate will be too low for cleavage catalysis. On the other hand, the cleavage specificity will be compromised when the binding arm length are too long. Indeed, different nucleotide compositions in the binding arm of DNAzyme will change its hybridization ability and cleavage activity toward its substrate. For regular DNAzyme, the sequences in the binding arm region should perfectly match to the sequences of its targeted substrate. The more mismatches in the binding arm region, the less stability between DNAzyme and the substrate. Moreover, if the mismatches are located near the catalytic core, the catalytic activity will be severely damaged. Recently, Yi, Jz et al. mentioned that introduce the six oligo bulge at the 5′-end of the regular DNAzyme which 12-15 bp away from the catalytic core will increase the efficiency and specificity of the regular DNAzyme. (Yi, J. Z., and Liu, C. Q. 2011. Efficient Silencing of Gene Expression by an ASON-Bulge-DNAzyme Complex. Plos One 6.) The most proper binding arm length for cleavage reaction should be examined based on experiments. In an embodiment, different binding arm length and different size of bulge will be introduced to DNAzyme. The invention provides DNAzymes allele-specific silencing EGFR mutation mRNAs. Preferably, the invention provides DNAzymes allele-specific silencing EGFR T790M mRNA; more preferably, the invention provides SEQ ID NOs:1-7. Other DNAzymes with different binding arm length but the same cleavage site toward EGFR T790M mRNA can also be provided. Based on the results of experiments, SEQ ID NO:1 has shown the most effective anti-proliferation effect on T790M-harboring cancer cells. The details of the DNAzymes are described as follows: 10-23 catalytic core sequence:
8-17 catalytic core sequence:
In another aspect, the invention provides a vector which comprises a sequence encoding either of the nucleic acid molecules of the invention. The invention further provides a host comprising the vector therein. This invention still further provides a method of producing either of the nucleic acid molecules comprising culturing a cell having therein a vector comprising a sequence encoding either catalytic nucleic acid molecule under conditions permitting the expression of the nucleic acid molecule by the cell. Methods of culturing cells in order to permit expression and conditions permitting expression are well known in the art. For example see Sambrook et al., “Molecular Cloning: A Laboratory Manual”, Second Edition (1989), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Such methods can optionally comprise a further step of recovering the nucleic acid product.
The invention also provides a pharmaceutical composition comprising the oligonucleotide or a modified sequence thereof, vector or host of the invention and a pharmaceutically acceptable carrier.
The compositions of the present invention can be used as single agents (alone) or further in combination(s) with an EGFR TK inhibitor or an EGFR-specific antibody. The EGFR TK inhibitor may include any one or number of the following drugs (including all of them): afatinib (BIBW2992), XL647 (N-(3,4-dichloro-2-fluorophenyl)-6-methoxy-7-(((3aR,6aS)-2-methyloctahydrocyclopenta[c]pyrrol-5-yl)methoxy)quinazolin-4-amine), Neratinib (HKI-272), dacomitinib (PF-00299804), BMS-6690514 ((3R,4R)-4-Amino-1-[[4-[(3-methoxyphenyl)amino]pyrrolo[2,1-f][1,2,4]triazin-5-yl]methyl]piperidin-3-ol), gefitinib and erlotinib and the EGFR-specific antibody may include any one or number of the following drugs (including all of them): cetuximab and panitumumab. Accordingly, the pharmaceutical composition of the invention can further comprise a EGFR TK inhibitor and/or an EGFR-specific antibody.
The pharmaceutical compositions of the invention may be compounded according to conventional pharmaceutical techniques that will be familiar to persons of skill in the art. Physiologically acceptable carriers, excipients and stabilizers are described, for example in Remington's Pharmaceutical Sciences, 20.sup.th Ed. Mack Publishing Co. (2000). The carrier may be provided in a variety of forms depending on the form of preparation desired for administration. The oligonucleotide or a modified sequence thereof, vector, host and composition of the invention can be administered systemically or topically. The term systemic as used herein includes subcutaneous injection, intravenous, intramuscular, intrastemal injection, intravitreal injection, infusion, inhalation, transdermal administration, oral administration, rectal administration and intra-operative instillation. The followings are some examples of the compositions of the invention.
For oral delivery, the excipient or carrier formulation may contain inert customary ingredients or carriers such as sodium citrate or dicalcium phosphate and (a) binders, as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (b) humectants, as for example, glycerol, (c) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (d) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (e) adsorbents, as for example, kaolin and bentonite, (f) fillers, such as lactose, starches, saccharides, sucrose, glucose, mannitol, and silicic acid, and (g) lubricants, as for example, magnesium stearate, talc, calcium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. These and other suitable pharmaceutically acceptable excipients are described in Remington's Pharmaceutical Sciences and in Handbook of Pharmaceutical Excipients, 3.sup.rd edition, Ed. Arthur H. Kibbe (American Pharmaceutical Association, Washington, D.C. 1999.
For parenteral administration, solutions of the oligonucleotide or a modified sequence thereof, vector, host or pharmaceutical composition of the invention in sesame or peanut oil, aqueous propylene glycol, or in sterile aqueous solutions may be employed. Such aqueous solutions should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, the sterile aqueous media employed are all readily available by standard techniques known to those skilled in the art. In intravenous administration, the compounds may be dissolved in appropriate intravenous delivery vehicles containing physiologically compatible substances, such as sterile sodium chloride having a buffered pH compatible with physiologic conditions, e.g. saline. Injectable suspension may also be prepared, in which case appropriate liquid carriers, suspending agents and the like may be employed.
For topical delivery, creams, gels, ointments or aerosols ointments are typically prepared using an oleaginous base, e.g., containing fixed oils or hydrocarbons, such as white petrolatum or mineral oil, or an absorbent base, e.g., consisting of an absorbent anhydrous substance or substances, for example anhydrous lanolin. Following formation of the base, the active ingredients are added in the desired concentration.
Creams generally comprise an oil phase (internal phase) containing typically fixed oils, hydrocarbons, and the like, such as waxes, petrolatum, mineral oil, and the like, and an aqueous phase (continuous phase), comprising water and any water-soluble substances, such as added salts. The two phases are stabilized by use of an emulsifying agent, for example, a surface active agent, such as sodium lauryl sulfate; hydrophilic colloids, such as acacia colloidal clays, beegum, and the like. Upon formation of the emulsion, the active ingredients are added in the desired concentration.
Gels are comprised of a base selected from an oleaginous base, water, or an emulsion-suspension base, as previously described. To the base is added a gelling agent which forms a matrix in the base, increasing its viscosity to a semisolid consistency. Examples of gelling agents are hydroxypropyl cellulose, acrylic acid polymers, and the like. The active ingredients are added to the formulation at the desired concentration at a point preceding addition of the gelling agent.
For rectal delivery, suitable pharmaceutical compositions are, for example, topical preparations, suppositories or enemas. Suppositories are advantageously prepared from fatty emulsions or suspensions.
In a further aspect, the invention relates to a method of specifically cleaving EGFR mutation mRNA comprising contacting the mRNA with either of the oligonucleotides or a modified sequence thereof of the invention under conditions permitting the molecule to cleave the mRNA. In one embodiment, the invention relates to a method of specifically cleaving EGFR T790M mutation mRNA comprising contacting the mRNA with either of the oligonucleotides or a modified sequence thereof of the invention under conditions permitting the molecule to cleave the mRNA. In another embodiment, the invention relates to a method of specifically cleaving EGFR E746-A750 deletion mRNA comprising contacting the mRNA with either of the oligonucleotides or a modified sequence thereof of the invention under conditions permitting the molecule to cleave the mRNA. In another further embodiment, the invention relates to a method of specifically cleaving EGFR L858R mutation mRNA comprising contacting the mRNA with either of the oligonucleotides or a modified sequence thereof of the invention under conditions permitting the molecule to cleave the mRNA. The above-mentioned conditions are well known in the art and include physiological conditions. The invention further provides a method of specifically cleaving EGFR T790M mutation mRNA in a cell, comprising contacting the cell containing the mRNA with either of the oligonucleotides of the invention so as to specifically cleave the EGFR T790M mutation mRNA in the cell. The cell containing EGFR T790M mutation mRNA can be, for example, a naturally occurring cell or a transgenic cell.
This invention further provides a method of specifically inhibiting the expression of EGFR mutation mRNA in a cell that would otherwise express EGFR mutation protein, comprising contacting the cell with either of the oligonucleotides of the invention so as to specifically inhibit the expression of EGFR mutation protein in the cell. In one embodiment, the invention relates to a method of specifically cleaving the expression of EGFR T790M mutation mRNA in a cell that would otherwise express EGFR T790M protein, comprising contacting the cell with either of the oligonucleotides or a modified sequence thereof of the invention so as to specifically inhibit the expression of EGFR T790M protein in the cell. In another embodiment, the invention relates to a method of specifically inhibiting the expression of EGFR E746-A750 deletion mRNA in a cell that would otherwise express EGFR T790M protein, comprising contacting the cell with either of the oligonucleotides or a modified sequence thereof of the invention so as to specifically inhibit the expression of EGFR E746-A750 deletion protein in the cell. In another embodiment, the invention relates to a method of specifically inhibiting the expression of EGFR L858R mutation mRNA in a cell that would otherwise express EGFR T790M protein, comprising contacting the cell with either of the oligonucleotides or a modified sequence thereof of the invention so as to specifically inhibit the expression of EGFR L858R protein in the cell. The invention further provides a method of specifically inhibiting the expression of EGFR T790M protein in a subject's cells comprising administering to the subject an amount of either of the oligonucleotides of the invention effective to specifically inhibit the expression of EGFR T790M protein in the subject's cells.
In a further another aspect, the invention provides a method of treating EGFR-dependent cancer in a subject, comprising administering an effective amount of an oligonucleotide or a modified sequence thereof of the invention to the subject. The invention further provides a method of treating EGFR-dependent cancer in a subject, comprising administering a TKI inhibitor or an EGFR-specific antibody and an oligonucleotide of the invention to the subject. According to the invention, the TKI inhibitor or the EGFR-specific antibody and the oligonucleotide of the invention can be administered concurrently, sequentially or separately. In one embodiment, the EGFR-dependent cancer is a lung cancer; preferably, a NSCLC. According to the invention, the oligonucleotide of the invention can be used in an adjuvant therapy given after surgery, radiation or chemotherapy.
Targeted therapy has been proven as an effective and promising modality for cancer treatment. Several addictive oncogenic pathways involve mutated genes such as EGFR or KRAS. DNAzymes are capable to act on any genes to silence their expression to different extents. Furthermore, with their mRNA sequence specificity, DNAzymes are capable to knock down the expression of the mutated mRNA while keeping the other mRNAs intact. In this case, allele-specific DNAzymes may attack cancer cells without causing side effects on normal cells. Moreover, various studies have shown that the transcript variants of a gene may have opposing roles, and alternative splicing is known to be a key factor in cancer progression. For example, Bcl-x, which is associated with cell survival/apoptosis, has two isoforms, Bcl-xL and Bcl-xS. The longer Bcl-xL isoform acts as an apoptotic inhibitor, whereas the shorter Bcl-xS isoform acts as an apoptotic activator. DNAzymes against a particular splice variant may specifically trigger cell apoptosis without activating cell survival pathway. Furthermore, DNAzyme may serve as a complement in silencing the expression of mRNAs that are difficult to siRNA among the anti-mRNA nucleic acid agents. Recent studies revealed that mRNA knockdown efficiency is dependent on the turnover rate of the mRNA in particular cells. In other words, short lived transcripts are more difficult to be silenced by siRNA. Depending on the substrate sequences and their accessibility, the observed reaction rate constant for 8-17 DNAzyme can be as high as 9.2 min−1 whereas the rate constant for RISC can be as high as 1.1 min−1. DNAzymes might become surrogates of siRNAs based on their fast kinetic reaction.
The allele-specific DNAzymes of the invention with their mRNA sequence specificity will knock down the expression of a particular mutated mRNA while keeping the other mRNAs intact. These allele-specific DNAzyme may be clinically more effective and better tolerated than traditional tyrosine kinase inhibitors. These allele-specific DNAzymes against EGFR T790M mutation provided in the invention will knockdown the expression of EGFR T790M mRNA while keeping EGFR wild-type mRNA intact. Hence, these allele-specific DNAzymes against EGFR T790M mutation may overcome T790M-derived TKI resistance accompanied with lower unwanted side effects on normal cells in NSCLC patients.
This invention will be better understood by reference to the Examples which follow, but those skilled in the art will readily appreciate that the specific experiments detailed are only illustrative of the invention as described more fully in the claims which follow thereafter.
Cell Culture
A549 (EGFR wild-type), CL1-5 (EGFR wild-type), H1975 (EGFR T790M), and CL97 (EGFR T790M) were cultivated at 37° C. with 5% CO2 in RPMI-1640 medium (Gibco BRL, USA) supplemented with 10% (v/v) heat inactivated fetal bovine serum.
Real-Time PCR and Quantitative Real-Time PCR
A549, CL1-5, H1975, or CL97 was seeded onto 6-well at 3×105 cells/well and cultured overnight. Then, cells were separately treated with 100 nM DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen). After 48 h, total mRNA were extracted from DNAzyme-treated cells by Mestrisol following manufacturer's protocol. cDNA were synthesized by using RT III kit with random hexamers as primers (Invitrogen). The PCR primers were synthesized by Genomics BioSci & Tech (Taipei, Taiwan). The sequences of PCR primers are listed as follows:
The parameters for PCR were: 95° C. for 10 min, then 25 cycles of PCR at 95° C. for 30 s, 60° C. for 30 s, and 72° C. for 60 s. 3% agarose gels were used for electrophoresis of PCR products. The intensity of bands were quantified by Image J. Quantitative RT-PCR was performed on 40 ng total mRNA with the LightCycler 480 system (Roche). The PCR mix contained 5 μl of 2× Probe Master mix, 100 nM of UPL probe (Roche Diagnostics, Penzberg, Germany), 200 nM of forward primer and reverse primer, 0.1 ul RNAseout (Invitrogen), and 0.025 ul RTIII enzyme (Invitrogen) in a total volume of 10 μl. PCR parameters were as follows: 50° C. for 40 min, then 45 cycles of PCR at 95° C. for 10 s, 60° C. for 10 s, and 72° C. for 2 s. Data were analyzed by LC480 software (Roche Diagnostics, Penzberg, Germany). The relative amount of EGFR mRNA was normalized to ACTB mRNA. The sequences of PCR primers are as follows:
Western Immunoblotting
A549, CL1-5, H1975, or CL97 was seeded onto 6-well at 3×105 cells/well and cultured overnight. Then, cells were separately treated with 100 nM DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen). The transfected A549 and CL1-5 cells were serum-starved for 24 h and treated with 100 ng/ml of EGF at 37° C. for 15 min. 72 h after transfection, cell were collected for analysis. Cells were washed twice by ice-cold PBS and then total protein was extracted by RIPA buffer with protease inhibitor (Roche). 50 μg of total protein from the supernatants were boiled for 5 min at 95° C. The samples were resolved on 10% SDS-PAGE gel and transferred onto nitrocellulose membranes. EGFR expression and downstream signaling were detected by using primary antibodies specific to human pEGFR(Y1068) (Cell signaling), tEGFR (Santa Cruz), pSTAT3 (Y705) (Cell signaling), tSTAT3 (Cell signaling), pAKT (5473)(Cell signaling), tAKT (Santa Cruz), pERK (T202/Y204) (Cell signaling), tERK (Santa Cruz), and cleaved PARP (Cell signaling) at 1:1000 dilution and β-actin (Santa Cruz) at 1:10000 dilution, respectively. Secondary antibodies against rabbit IgG or mouse IgG was used at 1:5000 dilution. Protein bands on membrane were visualized by exposure to the chemiluminescence substrate.
Cell Proliferation Assay
A549, CL1-5, H1975, or CL97 was seeded onto 6-well and cultured overnight. Then, cells were separately treated with 100 nM DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen). Cells were trypsinized and counted at 0 h, 24 h, 48 h, or 72 h after transfection.
Apoptosis Assay
H1975 or CL97 was seeded onto 10-cm dish and cultured overnight. Then, cells were separately treated with 100 nM DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen). After 48 h, cells were collected, double stained by annexin V and PI, and analyzed by flow cytometry following the protocol of Dead cell apoptosis kit from manufacturer (Invitrogen).
In Vivo Tumorigenesis Assay
8-week-old Balb/c Nude mice were subcutaneously inoculated with 2×106 H1975 cells. After 7 days, mice were randomly divided into two groups consisting of ten mice in each group (DzControl or DzT790M-1). 500 pmoles of DzControl or DzT790M-1 mixed with lipofectamine 2000 were injected intratumorally at frequency of twice per week until completion of the experiments. The sizes of tumor were measured every 3-4 days. All the animal studies were performed according to the protocols approved by the Laboratory Animal Center, Academia Sinica. After the mice were sacrificed, the tumor tissues were excised and fixed by 10% formalin and embedded in paraffin. Xenograft tumor slides were stained for hematoxylin and eosin and analyzed with microscopy.
Statistical Analyses
The data are presented as the means±SD. All Statistical tests having two-sided P<0.05 were considered to be statistically significant.
Two allele-specific DNAzymes against EGFR T790M mutation (hereinafter referred to DzT790M-1 and DzT790M-2) are 10-23 subtype which comprising 15 deoxyribonucleotides in the catalytic core. The sequences in the binding arm region of DzT790M are complementary to mRNA sequences of EGFR harboring T790M mutation, which is a C to U nucleotide substitution. In DzT790M-1, the mRNA cleavage site is four-nucleotides away from the single nucleotide mutation (Abdelgany, 2005). While the sequences of DzT790M-1 completely match to the mRNA harboring T790M mutation, DzT790M-1 forms one nucleotide mismatch with wild-type mRNA. On the other hand, the allele specificity of DzT790M-2 against T790M mRNA rather than wild-type T790M is based on the different reaction rates of DNAzyme toward different nucleotide junctions. According to the previous study (Cairns, M. J., King, A., and Sun, L. Q. 2003. Optimisation of the 10-23 DNAzyme-substrate pairing interactions enhanced RNA cleavage activity at purine-cytosine target sites. Nucleic Acids Res 31:2883-2889), DNAzymes with 10-23 backbone exhibit higher cleavage rate against AU junction compared to AC junction under simulated physiological condition. Hence, DzT790M-2 may exhibit higher cleavage rate toward T790M mRNA compared to wild-type mRNA. Besides, the sequences of control DNAzyme (DzControl) are not complementary to any mRNA in human cells. Phosphorothioate bonds (underlined) are introduced at both end of DNAzyme to resist nuclease degradation. The DNA sequences are listed as follows (
CATCGGAGGCTAGCTACAACGAGACAGCTG
AGCTGCATGAGGCTAGCTACAACGAGAGC
GAGCTGCAGGCTAGCTACAACGAGATGAGCT
To examine the allele selectivity of DzT790M-1, EGFR mRNA knockdown efficiency was detected in two cell lines harboring wild-type EGFR (A549, CL1-5) and two cell lines containing EGFR T790M mutation (H1975, CL97). A549, CL1-5, H1975, or CL97 was seeded onto 6-well at 3×105 cells/well and cultured overnight. Then, cells were separately treated with 100 nM DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen). After 48 h, total mRNA was extracted. In
EGFR belongs to receptor tyrosine kinases. The binding of its extracellular ligands triggers receptor dimerization, tyrosine residues phosphorylation, and downstream signaling activation including signal transducer and activator of transcription 3 (STAT3), Akt, extracellular signal regulated kinases (ERK), and others. To examine the effects of DzT790M on protein expression level of EGFR and its downstream signaling, western immunoblotting was performed on DzT790M transfected cells. A549, CL1-5, H1975, or CL97 was seeded onto 6-well at 3×105 cells/well and cultured overnight. Then, cells were separately treated with 100 nM DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen). The transfected A549 and CL1-5 cells were serum-starved for 24 h and treated with 100 ng/ml of EGF at 37° C. for 15 min. 72 h after transfection, cell were collected for analysis. Cells were washed twice by ice-cold PBS and then total protein was extracted by RIPA buffer with protease inhibitor (Roche). In cell lines harboring wild-type EGFR (A549 and CL1-5), the protein level of EGFR did not decreased after DzT790M-1 or DzT790M-2 transfection compared to DzControl group (
EGFR and downstream signaling pathway regulates important cell functions including cell proliferation and survival. In order to examine functional effects of DzT790M-1 on cell survival, the number of cells was counted after DzControl or DzT790M-1 transfection respectively. In A549 and CL1-5 cells (EGFR wild-type), the rate of cell proliferation or the cell number was not different between DzControl and DzT790M-1 transfected group (
8-week-old Balb/c Nude mice were subcutaneously inoculated with 2×106 H1975 cells. After 7 days, mice were randomly divided into two groups consisting of ten mice in each group (DzControl or DzT790M-1). 500 pmoles of DzControl or DzT790M-1 mixed with lipofectamine 2000 were injected intratumorally at frequency of twice per week until completion of the experiments. The sizes of tumor were measured every 3-4 days. The results showed that allele-specific DNAzyme against T790M mutation significantly suppressed tumor growth after intratumorally injection (
Materials and Methods
Cell Viability Assay
CL1-5 (EGFR wild-type) or H1975 (EGFR T790M) were seeded in 12-well plates at 1×105 cells/well and cultured overnight. Then, cells were separately treated with 100 nM cholesterol-modified DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen) for 72 h. Cells were rinsed with PBS buffer for three times and 50 μl MTT solution (0.5 mg/ml) was added. After incubation at 37° C. for 3 h, MTT solution was replaced with DMSO. The cell proliferation was measured by the absorbance at 570 nm with a microplate reader.
Western Blotting
CL1-5 (EGFR wild-type) or H1975 (EGFR T790M) were seeded onto 6-well at 3×105 cells/well and cultured overnight. Then, cells were separately treated with 50 nM cholesterol-modified DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen). The transfected CL1-5 cells were serum-starved for 24 h and treated with 100 ng/ml of EGF at 37° C. for 15 min. 72 h after transfection, cells were collected for western blotting analysis following the above mentioned procedure. Expression of EGFR and downstream signaling were examined by primary antibodies against human pEGFR (Y1068), tEGFR, pSTAT3 (Y705), tSTAT3, pAKT (S473), tAKT, pERK (T202/Y204), and tERK at 1:1000 dilution and β-actin at 1:10000 dilution, respectively.
Cholesterol modification on siRNAs or antagomirs has proven to increase endosome escape ability of these therapeutic agents. Hence, we added a cholesterol-TEG group on the 3′-end of DNAzyme (
Materials and Methods
H1975 was seeded onto 6-well at 3×105 cells/well and cultured overnight. Then, cells were separately treated with 50 nM cholesterol-modified DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen). Simultaneously, DMSO or 100 nM BIBW2992 was added into culture medium. 72 h after transfection, cells were collected for western blotting analysis following the above mentioned procedure. Expression of EGFR and downstream signaling were examined by primary antibodies against human pEGFR(Y1068), tEGFR, pSTAT3 (Y705), tSTAT3, pAKT (S473), tAKT, pERK (T202/Y204), and tERK at 1:1000 dilution and β-actin at 1:10000 dilution, respectively.
Cell Viability Assay
H1975 were seeded in 12-well plates at 1×105 cells/well and cultured overnight. Then, cells were separately treated with 50 nM cholesterol-modified DzControl or DzT790M-1 with lipofectamine 2000 (Invitrogen) combined with DMSO or 100 nM BIBW2992 for 72 h. Cells were rinsed with PBS buffer for three times and 50 μl MTT solution (0.5 mg/ml) was added. After incubation at 37° C. for 3 h, MTT solution was replaced with DMSO. The cell proliferation was measured by the absorbance at 570 nm with a microplate reader.
In Vivo Tumorigenesis Assay
8-week-old Balb/c Nude mice were subcutaneously inoculated with 2×106 H1975 cells. After 10 days, mice were randomly divided into four groups consisting of ten mice in each group: (1) DzControl-chol+PBS, (2) DzControl-chol+BIBW2992, (3) DzT790M-1-chol+PBS, and (4) DzT790M-1-chol+BIBW2992. For cholesterol-modified DNAzyme treatment, 500 pmoles of DzControl-chol or DzT790M-1-chol mixed with lipofectamine 2000 were injected intratumorally at frequency of twice per week until completion of the experiments. For BIBW2992 treatment, BIBW2992 was suspended in PBS and administration by oral gavage at 20 mg/per kg mice at frequency of three times per week until completion of the experiments. The sizes of tumor were measured every 3-4 days. All the animal studies were performed according to the protocols approved by the Laboratory Animal Center, Academia Sinica.
The cholesterol-modified DzT790M-1 can be used as single agents or further in combination with other clinical drugs such as EGFR TKIs or EGFR-specific antibodies. In this invention, the efficacy of combined treatment of cholesterol-modified DzT790M-1 and afatinib (BIBW2992) against T790M-derived drug resistance was evaluated both in in vitro and in vivo assays. While cholesterol-modified DzT790M significantly silenced the expression of total EGFR, pEGFR (Y1068), and pSTAT3 (Y705), the level of pAKT (S473) and pERK (T202/Y204) was slightly suppressed. On the other hand, BIBW2992 dramatically inhibited the expression of pEGFR, pAKT, and pERK when the total level of EGFR and pSTAT3 were not affected. Combined treatment of cholesterol-modified DzT790M with BIBW2992 resulted in an additive inhibition effect on EGFR expression and downstream STAT3, AKT, and ERK signaling (
The DNAzyme: DzEGFR—ΔE746-A750
was designed based on the following mRNA sequence of EGFR E746-A750 deletion.
DNAzyme Against L858R Mutation
Seven DNAzymes were designed based on mRNA sequence of EGFR L858R mutant.
The DNAzyme sequences are listed in the following.
A549, PC9, and H1975 cells were seeded in 12-well plates at 1×105 cells/well and cultured overnight. Then, A549 and PC9 cells were separately treated with 50, 100, or 150 nM control DNAzyme or DzEGFR—ΔE746-A750 with Lipofectamine 2000 for 48 h. A549 and H1975 cells were separately treated with 100 nM control DNAzyme or different DzL858Rs with Lipofectamine 2000 for 48 h. RNA purification was done by conventional TRIzol® (Invitrogen Corp., Grand Island, N.Y.) method following manufacturer's protocol. Quantitative RT-PCR was performed on 40 ng total mRNA with the LightCycler 480 system (Roche). The PCR mix contained 5 μl of 2× ProbeMaster mix, 100 nM of UPL probe (Roche Diagnostics, Penzberg, Germany) and 200 nM of primer (each) in a total volume of 10 μl. The PCR conditions were 95° C. for 10 min, followed by 60 cycles at 95° C. for 10 s, 60° C. for 10 s, and 72° C. for 2 s. Data were analyzed by LC480 software (Roche Diagnostics). The relative amount of EGFR mRNA was normalized to ACTB mRNA. The sequences of PCR primers are as follows:
A549 and PC9 cells were seeded in 12-well plates at 1×105 cells/well and cultured overnight. Then, cells were separately treated with 50, 100, or 150 nM control DNAzyme or DzEGFR—ΔE746-A750 with Lipofectamine 2000 for 48 h. Cells were rinsed with PBS buffer for three times and 50 μl MTT solution (0.5 mg/ml) was added. After incubation at 37° C. for 3 h, MTT solution was replaced with DMSO. The cell proliferation was measured by the absorbance at 570 nm with a microplate reader.
Two cell lines were used in the experiment, A549 (wild type EGFR) and PC9 (E746-A750 deletion EGFR). The EGFR mRNA extracted from both A549 and PC9 cells were sequenced and the results were in accordance with literature reports. DzEGFR—ΔE746-A750 with its side arm sequences complementary to the ΔE746-A750 sequence did not bind and act on the wild type EGFR. On the other hand, the mutant EGFR expression was suppressed by DzEGFR—ΔE746-A750 and resulted in 60% death of PC9 cells while using DzControl-treated group as 100% expression of mRNA and 0% death of PC9 cells (
As shown in
H1975TM/LR and CL97TM/GA cells were harvested 72 h after transfecting with DzC or DzT. Potential EGF-mediated signaling was activated by adding 100 ng/ml EGF 15 min before cell lysates were harvested.
After EGF treatment, both DzC and DzT treated group revealed elevated phosphorylation level of EGFR, AKT, and ERK in H1975TM/LR compared to two groups without EGF treatment (
H1975 and CL97 cells were treated with 25, 50 nM cDzC or cDzT together with 25, 50, 75, 100, 150, 250 nM BIBW-2992 or DMSO (vehicle control) added to the culture medium. Seventy-two hours after treatment, MTT assays were performed to monitor cell viability. Combination index (CI) values were calculated using CompuSyn version 3.0.1 software (ComboSyn, Inc., Paramus, N.J., USA) by CI equation of Chou-Talalay.
(Dx)1 is the dose of cDzT alone that inhibits x % of cell viability while (Dx)2 is the dose of BIBW-2992 alone that inhibits x % of cell viability. (D)1 is the portion of cDzT and (D)2 is the portion of BIBW-2992 that achieve x % of inhibition when combined treatment of cDzT and BIBW-2992. “Fraction affected (Fa)” on the x-axis of Fa-CI plot represented the fraction of cell viability inhibition on drug treated cells. CI values greater than 1, equal to 1, and less than 1 indicate antagonistic effects, additive effects, and synergistic effects, respectively.
At suboptimal concentrations, individual drugs did not efficiently suppress downstream signaling (
The results showed that BIBW-2992 enhanced the cell-killing effect of cDzT in both H1975TM/LR and CL97TM/GA cells in a concentration-dependent manner (
All animal studies were performed according to protocols approved by the Laboratory Animal Center, Academia Sinica. Eight-week old Balb/c nude mice (BioLASCO, Taipei, Taiwan) were subcutaneously inoculated with 2×106 H1975TM/LR cells (day 0). In the combined-treatment study, mice were randomly divided into four groups on day 10 and administered the following drug or drug combinations: (1) cDzC, (2) cDzC+BIBW-2992, (3) cDzT, or (4) cDzT+BIBW-2992. Chol-TEG-modified DNAzyme (500 pmoles) mixed with Lipofectamine 2000 was injected intratumorally twice per week. BIBW-2992 was suspended in PBS and administered three times per week by oral gavage at 20 mg/kg. The length (L) and width (W) of tumors were measured with calipers every 3-4 days, and tumor volumes were calculated as (L×W2)/2. After mice were sacrificed, tumors were excised. Small sections of tumors were processed for immunoblot and the remaining tumor tissue was fixed with 10% formalin and embedded in paraffin. Xenograft tumor slides were stained with hematoxylin and eosin (H&E), anti-EGFR (L858R mutant specific; Cell Signaling), and anti-caspase 3 (Cell Signaling).
Synergistic effects of cDzT and BIBW-2992 were also seen in the xenograft animal model. Compared with the control group (cDzC), all three drug-treated groups (cDzC+BIBW-2992, cDzT, and cDzT+BIBW-2992) inhibited the growth of tumor originated from H1975TM/LR cells to different degrees (
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2014/011496 | 1/14/2014 | WO | 00 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2014/110577 | 7/17/2014 | WO | A |
| Number | Date | Country |
|---|---|---|
| WO 2012043633 | Apr 2012 | WO |
| Entry |
|---|
| Cassell et al. (Expert Opinion on Investigational Drugs, Jun. 2010, vol. 19:709-722). |
| Pao et al. (PLOS, Mar. 2005 | vol. 2 | Issue 3, pp. 0225-0235). |
| Yu et al. (BBRC, 2008 vol. 378:230-234). |
| Search report from the European Patent Office dated Aug. 16, 2016 for European application 14737655.2. |
| Gang Chen et al: “Effect of siRNAs targeting the EGFR T790M mutation in a non-small cell lung cancer cell line resistant to EGFR tyrosine kinase inhibitors and combination with various agents”, Biochemical and Bio Physical Research Communications, Academic Press Inc. Orlando, FL, US, vol. 431, No. 3, Dec. 22, 2012, pp. 623-629, XP028980106. |
| Gang Chen et al: “Targeting the epidermal growth factor receptor in non-small cell lung cancer cells: the effect of combining RNA interference with tyrosine kinase inhibitors or cetuximab”, BMC Medicine, Biomed Central Ltd., London, GB, vol. 10, No. 1, 21 Mar. 2012, p. 28, XP021123822. |
| Wei-Yun Lai et al: “Overcoming EGFR T790M-based Tyrosine Kinase Inhibitor Resistance with an Allele-specific DNAzyme”, Molecular Therapy-Nucleic Acids, vol. 3, No. 3, Mar. 4, 2014, p. e150, XP055286687. |
| Zhang Shuang et al: “Suppression of Epidermal Growth Factor Receptor (EGFR) Expression by Small Hairpin RNA Inhibits the Growth of Human Non-small Cell Lung Cancers Bearing Wild-type and Mutant EGFR”, Cancer Investigation, vol. 29, No. 10, Jan. 1, 2011, pp. 701-708, XP008180787. |
| European patent office search report for application EP 14737655.2 dated Dec. 23, 2016. |
| Office action and search report dated Oct. 28, 2016 by the Taiwan Intellectual Property Office for corresponding Taiwan application 103106607. |
| English abstract translation of the office action dated Oct. 28, 2016 by the Taiwan Intellectual Property Office for corresponding Taiwan application 103106607. |
| Gang Chen et al., Effect of siRNAs targeting the EGFR T790M mutation in a non-small cell lung cancer cell line resistant to EGFR tyrosine kinase inhibitors and combination with various agents, Biochem Biophys Res Commun. Feb. 15, 2013;431(3):623-629. |
| Xu, ZhiJie et al., Use of DNAzymes for cancer research and therapy, Chinese Science Bulletin, vol. 57, Issue 26, pp. 3404-3408. |
| Andre Cassell et al., Investigational EGFR-targeted therapy in head and neck squamous cell carcimoma, Expert Opin Investig Drugs. Jun. 2010;19(6):709-722. |
| Masaki Takahashi et al., Specific inhibition of tumor cells by oncogenic EGFR specific silencing by RNA interference, PLoS One. Aug. 8, 2013;8(8):e73214. |
| Raffaella Sordella et al., Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways, Science. Aug. 20, 2004;305(5687):1163-1167. |
| Number | Date | Country | |
|---|---|---|---|
| 20160145625 A1 | May 2016 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61752117 | Jan 2013 | US |
