This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted concurrently herewith as the sequence listing text file entitled “[P22413504US].Sequence Listing.TXT”, file size 34 KiloBytes (KB), created on Jun. 17, 2022. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5).
The present disclosure relates to the field of biotechnology, and in particular to a fusion protein that improves gene editing efficiency and application thereof.
Since 2013, a new generation of gene editing technology represented by CRISPR/Cas9 has entered various experiments in the field of biology, which changes the traditional means of gene manipulation. In April 2016, David Liu's laboratory firstly reported a single-base gene editing technology. Afterwards, other types of single-base gene editing technology based on a principle of cytosine deaminase (such as cytosine deaminase derived from lamprey and human being fused with dCas9 or Cas9n in different ways) were also reported successively. It uses spCas9 derived from Streptococcus pyogenes in CRISPR/Cas9, takes NGG as PAM (protospacer adjacent motif), and recognizes and specifically binds DNA, which realizes single-base mutation from C to T or G to A upstream of NGG.
The single-base gene editing technology has been reported to be highly effective in conducting gene mutation or repair of genomes, making animal models of disease and gene therapy. Currently, among the discovered single-base gene editing tools, BE3 (Base Editor 3) is the most widely applied. The BE3 has a base substitution efficiency of up to 37%, which is much higher than that achieved by homologous recombination, while maintaining a lower off-target effect, demonstrating its great potential in single-base mutation modification or single-base mutation therapy in the genome. With the deepening of the research, it has been found that the introduction two or more copies of UGI (uracil glycosidase inhibitor) into BE3 could further enhance the editing efficiency and product purity. With the introduction of bipartite NLS (nuclear localization signal) and codon (namely BE4max), the editing efficiency is further improved. These methods can improve the efficiency to some extent, but with relative limitations.
Beta-hemoglobinopathy, such as beta-thalassemia and sickle cell disease (SCD), are caused by mutations of the gene HBB that encodes beta-hemoglobin. In rare cases, hereditary persistence of fetal hemoglobin (HPFH) is a benign hereditary disease in which high expression of gamma-globin in adult patients can alleviate disease phenotypes resulting from mutations in beta-hemoglobin. It has been reported that the deletion of 13 bp of HBG1/2 promoter region with CRISPR/Cas9 can activate the expression of gamma-globulin, thus alleviate or treat thalassemia disease, which is an effective therapeutic strategy. It is reported that in one of the patients with HPFH, the heterozygous point mutation (G>A) at site −117 of HBG1/2 promoter region produces 10-20% expression of fetal hemoglobin (HbF), and its mechanism is that the mutation of −117 G>A destroys the binding site of transcription repressor BCL11A.
The efficiency of the existing gene editing technology using CRISPR/Cas9-mediated homologous recombination to prepare animal models due to base substitution is still relatively low. The novel single-base gene editing technology has attracted much attention for its 100% efficiency in producing the animal models of disease. However, the existing single-base gene editing technology is usually C3-C8, which is not very effective in targeting to C adjacent of the PAM region.
Aiming at the defects existed in the prior art, an objective of the present disclosure is to provide a fusion protein that improves gene editing efficiency and application thereof.
In one aspect, the present disclosure provides a fusion protein for improving gene editing efficiency, which comprises functional domain of a single-stranded DNA binding protein, nucleoside deaminase and nuclease.
Specifically, the connection sequence of the fusion protein is as follows: the nucleoside deaminase is located at N-terminal or C-terminal of the nuclease, and the functional domain of the single-stranded DNA binding protein is located at the N-terminal or C-terminal of the nucleoside deaminase and the nuclease, and/or between the nucleoside deaminase and the nuclease;
In the fusion proteins described above, the single-stranded DNA binding protein comprises sequence-specific single-stranded DNA binding protein and/or non-sequence-specific single-stranded DNA binding protein, preferably, the non-sequence-specific single-stranded DNA binding protein;
In the fusion proteins described above, the deaminase comprises cytosine deaminase (APOBEC) and/or adenosine deaminase, preferably, the cytosine deaminase can be derived from different organisms;
In the fusion proteins described above, NLS (nuclear localization signal) is further comprised; preferably, the NLS is located at at least one terminal (C-terminal and/or N-terminal) of the fusion protein; more preferably, amino acid sequence of the NLS comprises a sequence of SEQ ID NO: 7, and more preferably, coding sequence of the NLS comprises a sequence of SEQ ID NO: 8;
In another aspect, the present disclosure also provides any one of the following A)-C) biomaterials:
In another aspect, the present disclosure also provides an sgRNA for gene editing of target gene in cells, wherein target sequence of the sgRNA comprises at least one of SEQ ID NO: 17-36,
In another aspect, the present disclosure also provides a single-base gene editing system, which comprises any one of the fusion proteins described above or the biomaterials and the sgRNA, wherein the sgRNA guides the fusion protein to conduct single-base gene editing on the target gene in the target cell;
In another aspect, the present disclosure claims use of any one of the fusion proteins described above, the biomaterials and the single-base gene editing system in preparing a product for gene editing, treating and/or preventing disease, animal model or a new plant variety;
In another aspect, the present disclosure also provides a method for improving the efficiency of single-base gene editing, which comprises the steps of introduction any one of the fusion proteins described above and the sgRNA into a cell and conducting the gene-editing on the target gene, wherein the sgRNA guides the fusion protein to conduct the single-base gene editing on the target gene.
In the method described above, preferably, the target sequence of the sgRNA comprises at least one of SEQ ID NO: 17-36;
In another aspect, the present disclosure also provides a method for constructing animal models of disease, which comprises the steps of introduction any one of the fusion proteins described above and the sgRNA into animal cells and conducting gene-editing on the target gene;
The present disclosure claims use of the animal model obtained by the method in drug screening, evaluation of the therapeutic effects of disease or research on treatment mechanism of diseases.
In another aspect, the present disclosure provides a product for treating and/or preventing beta-hemoglobinopathy, which comprises: a delivery vector of the gene described above in A) and the sgRNA.
The sgRNA guides the fusion protein to conduct single-base gene editing on the HBG1 and HBG2 promoter regions (specifically, the G at the site −117 is edited as A, and the G at the site −117 is the G at the position 14 from the left in the promoter region CCAGCCTTGCCTTGACCAATAGCC) in the target cell;
In the above products, the delivery vector comprises a viral vector and/or a non-viral vector; the viral vector comprises adeno-associated viral vector, adenoviral vector, lentiviral vector, retroviral vector and/or oncolytic virus vector; and the non-viral vector comprises cationic high-molecular polymer, plasmid vector and/or liposome;
The term “at least one” described above refers to any one, any two combinations, any three combinations, . . . , or all combinations of all types defined therein, which are within the protection scope of the present application.
Among the above amino acid sequences or coding sequences, the sequences having more than 80%, more than 85%, more than 90%, more than 95%, more than 96%, more than 97%, more than 98%, or more than 99% homology with the sequences described in the present application, and/or the sequences subjected to substitution, deletion or insertion of amino acid residues or nucleotides based on the sequences described in the present application, and the sequences having the same or similar functions as that of the sequences used in the present application, are all within the protection scope of the present application.
The beneficial effects of the present disclosure are as follows:
In the present disclosure, in the process of conducting C-G to T-A base conversion according to CBEs (pyrimidine-base conversion technology), the nucleoside deaminase, such as cytosine deaminase, takes the single-stranded DNA as a substrate for deamination, and the fusion protein of the nucleoside deaminase and the nuclease is fused with the functional domain of the single-stranded DNA binding protein, which greatly increases the chance of the single-stranded DNA being exposed to the nucleoside deaminase, thereby the base editing efficiency is obviously improved.
In the present disclosure, by screening the functional domains of 10 non-sequence-biased single-stranded DNA binding proteins for fusion with BE4max, it is found that a single-stranded DNA binding functional domain (1-114AA) derived from human Rad51 fused between Apobec1 and Cas9n shows the highest efficiency improvement, and is named as hyBE4max. Compared with BE4max, the C-G to T-A editing efficiency of the hyBE4max is improved up to 16 times, especially the efficiency at the site near the PAM region is improved more obviously, while maintaining lower indels (insertions or deletions).
The present disclosure makes a breakthrough improvement on the single-base gene editing technology, and can greatly promote its application in gene editing, gene therapy, cell therapy, animal model making, crop genetics and breeding, and the like aspects.
In gene therapy, the present disclosure takes beta-hemoglobinopathy as examples, as compared with eA3A-BE4max and A3A-BE4max, hyeA3A-BE4max targets the HBG1 and HBG2 promoter regions (hereinafter referred to as HBG1/2) closer to the site −117 of the PAM region, which can more accurately and efficiently target −117 to generate G-to-A mutation, thus activating the expression of gamma-globin, and providing a more accurate and efficient therapeutic strategy for beta-hemoglobinopathy.
The present disclosure applies hyA3A-BE4max to the making of mouse disease animal models. Compared with A3A-BE4max, hyA3A-BE4max is more effective in the generation of the disease animal models by targeting C-to-T mutations closer to the PAM region, thus the present disclosure provides a novel platform for making the disease animal models with high efficiency, which will greatly facilitate the production progress of different animal models.
Wherein C in the abscissa of
1.1 Plasmid Design and Construction
1.1.1 According to the characteristics that Apobec1 of CBEs in single-base editing technology uses single-stranded DNA as substrate, we designed 10 different functional domains of human-derived non-sequence-biased single-stranded DNA binding proteins (mainly RPA70 (630aa)-A, RPA70-B, RPA70-AB, RPA70-C, RPA32-D, BRCA2-OB2, BRCA2-OB3, HNRNPK KH domain, PUF60 RRM, Rad51 DBD) (Table 1); since the reported fusion protein tended to be inactive at the C-terminal of BE4max (the first figure from top to bottom in
1.1.2 DNAs of 10 different functional domains of human-derived non-sequence-biased single-stranded DNA binding proteins shown in Table 1 were synthesized, and then seamlessly cloned and assembled to the N-terminal of BE4max in plasmid pCMV-BE4max (addgene, #112093), and 10 recombinant plasmids were constructed respectively (
The DNAs of the targets EMX1 site1 and Tim3-sg1 shown in Table 2 were synthesized, and connected to Bbs I site of sgRNA expression plasmid U6-sgRNA-EF1α-GFP (used to express the sgRNA of the corresponding targets), respectively, to obtain recombinant plasmids pE and pT.
1.1.3 The plasmids constructed in 1.1.1 and 1.1.2 were sequenced by sanger to ensure that they are completely correct.
1.2. Cell Transfection
5×105 HEK293T cells were plated into a 24-well plate. When the cells grew to 70%-80%, the plasmid combinations were transfected according to pssDBD-BE4max:pE (or pT)=750 ng:250 ng. 3 replicate wells were set for transfection of each plasmid combination, with 2×105 cells per well. Simultaneously, a blank control without transfection of any plasmid was set.
pssDBD-BE4max represents: any one of plasmids pRPA70-A-BE4max, pRPA70-B-BE4max, pRPA70-AB-BE4max, pRPA70-C-BE4max, pRPA32-D-BE4max, pBRCA2-OB2-BE4max, pBRCA2-OB3-BE4max, pKH-BE4max, pRRM-BE4max, and pRad51DBD-BE4max; and the plasmid pCMV-BE4max was used as a negative control.
1.3. Genome Extraction and Preparation of Amplicon Library.
72 h after transfection, genomic DNA of the cells was extracted using Tiangen Cell Genome Extraction Kit (DP304). Afterwards, the corresponding identification primers (Table 3) were designed according to the operation process of Hitom kit, i.e., a bridging sequence 5′-ggagtgagtacggtgtgc-3′ was added to the 5′ terminal of the forward identification primer, and a bridging sequence 5′-gagttggatgctggatgg-3′ was added to the 5′ terminal of the reverse identification primer to obtain one round of PCR products; then, the first round of PCR products was used as a template to conduct a second round of PCR, followed by the PCR products were mixed together for gel-cutting, recovering, purification, and then sent to a company for deep sequencing.
TGGTTGCCCACCCTAGTCAT
1.4. Analysis and Statistics of Deep Sequencing Results
The ratios of C to T and Indels were calculated by using the deep sequencing results of step 1.3 using a BE-analyzer website. The results were shown in Table 4 and Table 5.
The results show that, compared with BE4max, the BE4max fused with the functional domain of Rad51 single-stranded DNA binding protein (Rad51DBD-N-BE4max or Rad51DBD-BE4max) most obviously improved the C-to-T editing efficiency on the target, followed by the BE4max fused with the functional domain of a RPA70-C single-stranded DNA binding protein.
2. Best Editing Efficiency of hyBE4max
In order to further test the fusion position of the functional domain of Rad51 single-stranded DNA binding protein with the highest improvement on the C-to-T editing efficiency on the targets in step 1, the Rad51 DBD was fused to two other different positions of BE4max, and three recombinant plasmids of BE4max fused with Rad51 DBD (the third to the fifth figures from top to bottom in
Three types of BE4max fused with Rad51 DBD shown in the third to the fifth figures from top to bottom in
The results in Table 4 and Table 5 shown that, compared with Rad51 DBD fused between NLS and rA1 in BE4max (i.e., Rad51DBD-N-BE4max), Rad51 DBD fused between rA1 and spCas9n in BE4Max (i.e., hyBE4max) most obviously improves the C-to-T editing efficiency on targets.
3. Working Characteristics of hyBE4max
In order to further describe the working characteristics of hyBE4max fairly, 6 additional targets VEGFA site2, Lag3-sg2, HEK3, HEK4, EMX1-sg2p, and Nme1-sg1 (the sequences shown in Table 2) were designed and connected to BbsI site of plasmid U6-sgRNA-EF1α-GFP to obtain recombinant plasmids pV, pL, pH3, pH4, pEP and pN. Theses plasmids were sequenced by sanger to ensure that they are completely correct.
The recombinant plasmid containing hyBE4max in step 2 along with recombinant plasmids pE, pT, pV, pL, pH3, pH4, pEP or pN were respectively transfected into cells according to the method of 1.2 in step 1; the results of editing efficiency were obtained according to the methods of 1.3 and 1.4 in step 1; and statistical mapping was performed using GraphPad Prism 8.0.
The results were shown in
4. Effects of Fusion Proteins Containing Different Cytosine Deaminase
(1) Working Characteristics of Fusion Protein hyA3A-BE4max
4.1.1. Rad51-DBD was synthesized according to the coding sequences in Table 1, and then seamlessly cloned and assembled between hA3A and spCas9n in the plasmid pCMV-A3A-BE4max expressing protein A3A-BE4max (
4.1.2. 8 human endogenous targets were synthesized sequentially: the target sequences of EMX1 site1, Tim3-sg1, VEGFA site2, EMX1-sg2p, and Nme1-sg1 were shown in Table 2; the target sequences of FANCF site1, EGFR-sg5, and EGFR-sg21 were shown in Table 6; and recombinant plasmids pB1, pB2, . . . , pB8 expressing the corresponding targets of sgRNA were obtained by connecting them to Bbs I site of sgRNA-expression plasmid pU6-sgRNA-EF1α-GFP, respectively.
4.1.3. The plasmids constructed in 4.1.1 and 4.1.2 were sequenced by sanger to ensure that they are completely correct.
4.1.4. Cell Transfection
5×105 HEK293T cells were plated into a 24-well plate. When the cells grew to 70%-80%, the plasmid combination were transfected according to pA (or plasmid pCMV-A3A-BE4max):pB1 (or pB2, pB3, . . . , pB8)=750 ng:250 ng. 3 replicate wells were set for transfection of each plasmid combination, with 2×105 cells per well. Simultaneously, a blank control without transfection of any plasmid was set.
4.1.5. Genome Extraction and Preparation of Amplicon Library
The procedure of step 1.3 was followed, wherein the identification primers for the targets of FANCF site1, EGFR-sg5 and EGFR-sg21 were shown in Table 7, and the other identification primers for expression were shown in Table 3.
4.1.6. Analysis and Statistics of Deep Sequencing Results
The procedure of step 1.4 was followed.
The results show that, compared with the protein A3A-BE4max, the editing efficiency of single-base C-to-T at different positions (C3-C15) of individual targets was significantly improved by the fusion protein hyA3A-BE4max (
(2) Working Characteristics of Fusion Protein hyeA3A-BE4max
4.2.1. Construction of Working System Plasmid
Rad51-DBD was synthesized according to the coding sequences in Table 1, and then seamlessly cloned and assembled between eA3A and spCas9n in the plasmid pCMV-eA3A-BE4max expressing the protein eA3A-BE4max (
4.2.2. Construction of Target Plasmid
Meanwhile, 11 human endogenous targets were designed and synthesized: the target sequences of EMX1-sg2p, EMX1 site1, and Nme1-sg1 were shown in Table 2; the target sequence of EGFR-sg21 was shown in Table 6; and the other target sequences were shown in Table 8; which were respectively connected to BbsI site of sgRNA-expression plasmid U6-sgRNA-EF1α-GFP to express sgRNA of corresponding target, thus obtaining recombinant plasmids pC1, pC2, . . . , pC11.
4.2.3. The plasmids constructed in 4.2.1 and 4.2.2 were sequenced by sanger to ensure that they are completely correct.
4.2.4. Cell Transfection-Verification of hyeA3A-BE4max Working System
5×105 HEK293T cells were plated into a 24-well plate. When the cells grew to 70%-80%, the plasmid combination were transfected according to pA (or plasmid pCMV-eA3A-BE4max):pC1 (or pC2, pC3, . . . , pC11)=750 ng:250 ng. 3 replicate wells were set for transfection of each plasmid combination, with 2×105 cells in each well. Simultaneously, a blank control without transfection of any plasmid was set.
4.2.5. Genome Extraction and Preparation of Amplicon Library
The procedure of step 1.3 was followed, wherein the identification primers for EMX1-sg2p, EMX1 site1 and Nme1-sg1 were shown in Table 3, the identification primers for EGFR-sg21 were shown in Table 7, and the other target sequences were shown in Table 9.
4.2.6 Analysis and Statistics of Deep Sequencing Results
The procedure of step 1.4 was followed.
The results show that, compared with the protein eA3A-BE4max, the editing efficiency of single-base C-to-T at different positions (C3-C15) of individual targets was significantly improved by the fusion protein hyeA3A-BE4max, and the high activity windows were expanded from the original C3-C11 to C3-C15, which can specifically target the single base C in TC motif to achieve the C-to-T conversion (
5. Gene Therapy Using Fusion Protein hyeA3A-BE4max
5.1. Test of Editing Efficiency of hyeA3A-BE4max Targeting HBG-117G Sites on HEK293T Cells
Transfected HEK293T cells with the plasmid combination according to the cell transfection method of 4.2.4, pA (or plasmid pCMV-A3A-BE4max, or pAe, or pCMV-eA3A-BE4max):pC12=750 ng:250 ng; and deep sequencing and statistical analysis were carried out according to the method of 4.2.6.
The construction method of the recombinant plasmid pC12 is as follows: the sgRNA target sequence of HBG-117G (GGCTATTGGTCAAGGCAAGGCTGG, SEQ ID NO: 35) was connected to the BbsI site of the sgRNA-expression plasmid U6-sgRNA-EF1α-GFP to express the sgRNA of corresponding target to obtain the recombinant plasmid pC12.
The identification primers used for the above deep sequencing target HBG-117G are as follows:
Results: as shown in
5.2. Construction of Lentiviral Vector and Virus Packaging
5.2.1 Construction of Lentiviral Vector
pLenti-BE3-P2A-Puro (Addgene, #110838) was used as skeletal vector, the coding sequence of hyA3A-BE4max was cloned seamlessly to replace BE3 on the skeletal vector to obtain lentiviral vector Lenti-hyA3A-BE4max-P2A-GFP.
pLenti-BE3-P2A-Puro (Addgene, #110838) was used as skeletal vector, the coding sequence of hyeA3A-BE4max was cloned seamlessly to replace BE3 on the skeletal vector to obtain a lentiviral vector Lenti-hyeA3A-BE4max-P2A-GFP.
The target sequence of HBG-117G in 5.2 was connected to the upstream of the above two lentiviral vectors hyA3A-BE4max or hyeA3A-BE4max (top figure of
5.2.2. Lentiviral Packaging
5.2.2.1. Transfection
On the 1st day, HEK293T cells in good growth condition were digested and placed in 10 cm dishes, with about 30 dishes for each virus. On the 2nd day, when the confluence reached 80%-90%, the plasmid was transfected with following amount: Lenti-117G-hyA3A-BE4max-P2A-GFP (or Lenti-117G-hyeA3A-BE4max-P2A-GFP):PSPAX2:PMD2.G=10 μg:10 μg:10 μg.
5.2.2.2. Collection and Purification of Virus
The virus supernatant was collected from HEK293T cell supernatant at 48 h (i.e., 0 h was recorded from transfection) and 72 h after transfection. The supernatant was centrifuged at 4° C. under 4000 g for 10 min, the cell debris was removed, then the supernatant was filtered through a 0.45 μm filter into a 40 mL ultrafiltration centrifuge tube, the lentiviral crude extract was added into a filter cup and centrifuged at 4° C. under 25000 g for 2.5 hours. After the centrifugation, the centrifugal device was taken out, and filter cup was separated from the filtrate collection cup. The liquid in the sample collection cup is concentrated virus liquid (containing lentivirus Lenti-117G-hyA3A-BE4max-P2A-GFP or lentivirus Lenti-117G-hyeA3A-BE4max-P2A-GFP). The concentrated virus liquid was removed, subpackaged and stored in a virus tube, and preserved at −80° C. for long-term storage.
5.3. Gene Therapy
5.3.1. HUDEP-2 (ΔGγ) Cells Infected With Virus
5×104 HUDEP-2 (ΔGγ) cells were plated in culture medium with a total volume of 100 μl in 3 wells in a 96-well plate, and then infected with lentivirus Lenti-117G-hyA3A-BE4max-P2A-GFP and Lenti-117G-hyeA3A-BE4max-P2A-GFP in equal titer, respectively. The infection system is as follows:
5.3.2. Detection of Editing Efficiency
The HUDEP-2 (ΔGγ) cells infected with lentivirus Lenti-117G-hyA3A-BE4max-P2A-GFP or Lenti-117G-hyeA3A-BE4max-P2A-GFP were sorted by flow cytometry to obtain GFP-positive cells, the GFP-positive cells were cultured, and then collected after the number of cells was more than 5×104, the genomic DNA was extracted, and the deep sequencing and analysis were carried out according to the method of 5.1.
Results: compared with hyA3A-BE4max, hyeA3A-BE4max efficiently targeted the precise −117G>A mutation in HUDEP-2 (ΔGγ) cells and shown higher activity (
5.3.3 Differentiation and Detection of γ Globin Expression
The HUDEP-2 (ΔGγ) cells infected with lentivirus Lenti-117G-hyA3A-BE4max-P2A-GFP or Lenti −117G-hyeA3A-BE4max-P2A-GFP were sorted by flow cytometry to obtain GFP-positive cells, the GFP-positive cells were cultured until the number of cells was more than 5×104, and HUDEP-2 (ΔGγ) cells were collected after about 5-7 days for differentiation and expression. The differentiation process is as follows:
Detection of γ globin expression: the cells were collected after 8 days of differentiation and total mRNA was extracted by phenol-chloroform extraction method. HiScript II Q RT SuperMix (Vazyme) was used to reversely transcribe the isolated mRNA; qPCR was performed on QuantiStudio 3 real-time PCR system (ABI), and mRNA levels of HBG and HBB were quantified by SYBRGreen qPCR. The primers (5′-3′) are as follows:
Results: compared with WT cells of HUDEP-2 (ΔGγ), hyA3A-BE4max and hyeA3A-BE4max could significantly increase the mRNA level of γ-globin in HUDEP-2 (ΔGγ) cells; and hyeA3A-BE4max increased the mRNA level of γ-globin in HUDEP-2 (ΔGγ) cells by 3 times as much as that of hyA3A-BE4max (
6. Using Fusion Protein hyA3A-BE4max to Construct Animal Model of DMD Disease
The mice used below are C57/BL6 mice.
6.1. Construction of Transcription Template For Working System mRNA and Target sgRNA
A mouse-related gene sequence was download at NCBI, as shown in
6.2. In Vitro Transcription of sgRNA (DMD-sg3)
A common DNA product purification kit was used to purify the PCR product in 6.1, the purified PCR product was then used as a linearized DNA template and T7 in vitro transcription kit (MEGAshortscript™ Kit) was used to carry out in vitro transcription. The transcribed sgRNA was purified by using lithium chloride precipitation method.
6.3. Transcription of Working System mRNA (A3A-BE4max and HyA3A-BE4max)
T7 templates of A3A-BE4max and hyA3A-BE4max were transcribed in vitro using the in vitro RNA transcription kit (mMESSAGE mMACHINE®T7 Ultra Kit) to obtain the working system mRNA, which was then purified.
6.4. Preparation of Microinjection Mixture
An injection mixture was prepared with nuclease-free water to obtain a mixture with a total volume of 20 μL. The injection mixture contains working system mRNA (mRNA containing A3A-BE4max or hyA3A-BE4max) with a final concentration of 100 ng/μL and sgRNA (DMD-sg3) with a final concentration of 200 ng/μL.
6.5. Collection of One-Cell Stage Embryos
(1) The 1st day: donor female mice aged 6-8 weeks were intraperitoneally injected with 100 μL (5 IU) of PMSG working solution between 1 p.m. and 2 p.m.
(2) The 3rd day: 100 μL (5 IU) of hCG working solution was intraperitoneally injected into the female mice between 2 p.m. and 4 p.m. that had been injected with PMSG. After the injection, the hormone-treated female mice were co-caged one-to-one with male mice aged 10-14 weeks. Meanwhile, the estrous hormone-free female mice were mated with the tubal ligated male mice at around 4 p.m. for the preparation of pseudopregnant female mice.
(3) The 4th day: before 9 a.m., the recipient female mice that were co-caged with the ligated male mice were examined for the presence of pregnancy plugs, and the female mice having pregnancy plugs were collected in new cages for embryo transfer experiment in the afternoon.
(4) The superovulatory female donor mice were sacrificed by carbon dioxide asphyxiation method, and their oviducts were taken out and placed in dishes in which preheated M2 medium was added.
(5) The oviducts were placed in another new dish, and preheated M2 medium and hyaluronic acid were added into the dish with the volume ratio of M2 medium to hyaluronic acid being 9:1. The ampullae of the oviducts were pulled with tweezers under a stereomicroscope to release the embryos from the oviducts into the dish. Embryos were incubated in M2 medium containing hyaluronic acid until cumulus cells dropped. After the cumulus cells were removed, the embryos were transferred to a new dish, and M2 medium without hyaluronic acid was added into the dish, and the embryos were repeatedly rinsed with M2 medium to wash out both hyaluronic acid and cumulus cells.
(6) The washed embryos were transferred to a new dish, a few drops of KSOM medium was firstly added dispersedly into the dish, and then mineral oil was slowly added into the dish to separate and cover the KSOM medium with the mineral oil. In general, 6 droplets of KSOM medium can be added into a 35 mm dish with each droplet being 50 μL. 50 embryos as a group were placed firstly onto the middle KSOM medium droplets and rinsed, and then transferred to a new medium droplet. The embryos before microinjection were taken out and incubated in M2 medium in a cell incubator.
6.6. Microinjection and Embryo Transfer
(1) Fixing needle, injection needle and silicified glass slide were prepared, and a drop of M2 medium covered with mineral oil was dropped into the middle of the slide.
(2) The injection needle was allowed to automatically suck and filled with the microinjection mixture prepared in step 2.4 by capillary action, and the injection needle was loaded onto the fixed handle of the microinjection apparatus.
(3) 50 embryos were transferred into M2 medium on the glass slide, and the fixing needle was moved close to the embryos, so that the embryos could be fixed onto the fixing needle under negative pressure. After the embryos were fixed, the cytoplasm was found under a high-power microscope, and the tip of the injection needle was pushed through the zona pellucida and cell membrane, and the mixture was injected into the cytoplasm of the embryo.
(4) The injected embryonic cells were transferred to a new droplet of M2 medium. The steps (3) and (4) were repeated until all embryos were injected. After injection of a group of experimental groups, the embryos were transferred to new KSOM medium and incubated in a cell incubator for 1-2 hours or overnight. After all the embryos were injected, the embryos killed by mechanical damage were excluded, and the healthy embryos were transferred to new KSOM medium.
(5) The pseudopregnant rats were anesthetized by intraperitoneal injection of 600 μL avertin. A shaver was used to remove the hair from the back of the mice. The skin after being shaved was wiped with 70% ethanol.
(6) A small opening was formed by cutting at the position of the ovary, blunt forceps were used to pull the fat pad of the ovary to pull the ovary out, and at the same time the ovary was fixed to the outside with hemostatic forceps, and blunt forceps were used to find the funnel-shaped orifice of the oviduct at the lower side of the ovarian bursa.
(7) Transfer needle was used to sequentially suck M2 medium with two small bubbles, and about 15 embryos, and the bubbles were for observing the position of embryos in the transfer needle.
(8) Ovarian bursa was gently opened, the funnel-shaped orifice of the oviduct was positioned using a shaft, the transfer needle was extended to the opening of the ovary, then the embryo in the transfer needle was punched out, and the transfer needle was gently withdrawn.
(9) The hemostatic forceps fixing the fat pad of the ovary was released, the ovary was put back into the original cavity, and the muscle opening and the skin opening were sewn respectively with sutures.
(10) The mice after surgery were placed on a heat-preserving table with a constant temperature of 37 degrees; the mice were transferred to a feeding cage for feeding after the mice regained consciousness, followed by waiting for embryo development until delivery. Typically, the successfully transplanted female mice gave birth after 3 weeks.
6.7. Identification of Mouse Genome
The mice (in step 6.6) born about 10-15 days was taken and their toes were cut for genome identification. The specific steps are as follows:
6.7.1 Genomic Extraction
(1) Their toes were cut and put into 1.5 mL centrifuge tubes, into which 500 μL of toe digestion liquid was added. The digestion liquid was prepared according to the ratio of protease K:tissue lysate=1:500, and then the tubes were placed in a water bath at 55° C. overnight;
(2) The toes digested overnight were taken out and placed at room temperature for 10-15 minutes, mixed thoroughly upside down, and centrifuged at 13000 rpm for 15 minutes.
(3) 400 μL supernatant was sucked out from each tube, an equal volume of chloroform was added, fully mixed. After DNA precipitation, the mixture was centrifuged at 12000 rpm for 10 minutes.
(4) 200 μL of 75% alcohol pre-cooled in a refrigerator at −20° C. was added into each tube and mixed gently, then centrifuged at 12,000 rpm for 5 min, and the supernatant was discarded, followed by air-drying in a clean workbench.
(5) 50-100 μL of deionized ultra-pure water was added according to the content of DNA, and the DNA was dissolved at 55° C. for 2 hours to obtain PCR template.
6.7.2 Identification of Genome
Primer pair F/R of target DMA-sg3 (Table 11) was used to obtain a DNA fragment containing the target; firstly, the occurrence of double peaks was confirmed by first-generation sequencing, and then the editing efficiency was obtained by high-throughput deep sequencing. According to the high-throughput results, among the 10 F0s producing mutations in the hyA3A-BE4max treatment group, there were 6 homozygous terminating nonsense mutations from CAA to TAA (the mice numbered #BD03, #BD05, #BD07, #BD12, #BD15, and #BD16 in the lower figure of
6.8. Phenotype Identification of DMD Gene
Wild-type mice of 5 weeks old (blank control) and mice with DMD gene mutation identified in 2.7.2 were taken, and immunohistochemical detection was carried out according to the following methods:
The tibialis anterior muscles of mice was taken and rinsed with alcohol and PBS. They were placed into a small cube box covered with OTC gel and placed into an isopentane beaker, followed by freezing in liquid nitrogen for about 30 s, taking out and storing at −20° C., and then freezing and sectioning. The prepared sections were washed with PBST for 3 times/5 min, oil circles were drawn at the aligned positions of tissues. The sections were blocked by adding blocking solution, and after 1 h of blocking, the sections were incubated overnight with Laminin primary antibody or Dystrophin primary antibody (Abcam, ab11575 or Abcam, ab15277 diluted at 1:500), respectively. The sections were washed with PBST for 3 times/5 min, followed by incubation with 1:1000 anti-rabbit diluted secondary antibody for 2 h, and then washed with PBST for 3 times/5 min. DAPI diluted at 1:100 was added and incubated for 10 min, and then washed with PBST for 3 times/5 min. Followed by dropwise adding anti-quenching agent, adding a cover glass, sealing with nail polish, and finally observing the fluorescence of the sections with a fluorescence microscope.
The results show that, compared with the mice of WT (+/+) and A3A-BE4max-treated mice (such as #AD26), only six F0-generation mice (such as #BD03 in
According to the fluorescence observation results, a summary of F0 generation mice produced by editing hyA3A-BE4max and A3A-BE4max was obtained (as shown in Table 12).
6.9. Genetic Analysis of Germ Line of DMD Mutant Mice (F0→F1)
The homozygous female mice #BD12 (F0) with DMD phenotype were mated with male wild-type mice, 8 homozygous F1 mice were obtained, and the genotypes of the born F1 were identified; and sanger sequencing results show that the Reads frequency of nonsense mutation produced in each F1 exceeded 96%, i.e., this nonsense mutation could be stably inherited to F1 generation (
6.10. Off-Target Detection
Off-target primers were designed by using a Cas-OFFinder function on a CRISPR RGEN Tools website (http://www.rgenome.net) (Table 13): firstly, the PAM type of the tested tool and the species type to be tested (for example, for a mouse, being Mus musculus (mm10)-Mouse) were selected, then, the designed sgRNA sequence with a PAM portion removed was filled in the box of Query Sequences, the mismatched bases were selected to be within 3, and the resulting DNA Bulge Size was within 1, and then the corresponding off-target primers were obtained after submission.
The off-target primers described above were used to implement PCR respectively on the genomic DNA of F0 mice that have been edited by hyA3A-BE4max (with WT as blank control), and then the products were subjected to high-throughput deep sequencing to obtain the results for the off-target efficiency (
The results in
| Number | Date | Country | Kind |
|---|---|---|---|
| 201911310969.8 | Dec 2019 | CN | national |
| 201911312537.0 | Dec 2019 | CN | national |
| 201911312544.0 | Dec 2019 | CN | national |
The present disclosure is a continuation-in-part of International Application No. PCT/CN2020/137239, filed on Dec. 17, 2020 which claims the benefit of Chinese Patent Application No. 201911310969.8, filed on Dec. 18, 2019, Chinese Patent Application No. 201911312544.0, filed on Dec. 18, 2019, and Chinese Patent Application No. 210911312537.0, filed on Dec. 18, 2019. The entire disclosures of the applications referenced above are incorporated herein by reference.
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/CN2020/137239 | Dec 2020 | US |
| Child | 17843462 | US |