Patent Application
20240417434
The present invention relates to nucleic acid constructs, viral vectors and viral particles for use in the treatment and/or prevention of disease associated with a loss of syntaxin binding protein 1 (STXBP1) functional activity, identified for example in neurodevelopmental disorders associated with epilepsy such as Ohtahara syndrome, West syndrome and Dravet syndrome.
Many neurodevelopmental disorders have been associated with genetic alterations leading to the manifestation of severe clinical symptoms early in life. Genetic alteration of STXBP1 is associated with severe early onset epileptic encephalopathies (EOEE) such as Ohtahara syndrome, West syndrome and Dravet syndrome (Saitsu et al. 2008, Stamberger et al. 2016). STXBP1 encephalopathies (STXBP1-E) are characterized by a large spectrum of symptoms but it is now established that all patients have profound intellectual disability and up to 85% of patients develop seizures (Abramov et al. 2020). STXBP1-E may be caused by dominant, heterozygous, de novo mutations in the STXBP1 (Munc-18) gene. Multiple genetic variants have been reported including missense, nonsense, frameshift, deletions, duplication and splice site variants. Most cases are caused by heterozygous loss of function (LoF) mutations, typically de novo but in rare cases inherited from heterozygous or mosaic parents. A recent variant has been described that leads to a homozygous mutation of STXBP1. Genotype-phenotype correlation studies have failed to identify a clear association between mutation type and the different expressions of STXBP1-E to date.
STXBP1 (Munc-18; Syntaxin binding protein 1) is an essential component of the molecular machinery that controls SNARE-mediated (N-ethylmaleimide-sensitive factor attachment protein receptor) membrane fusion in neurons and neuroendocrine cells. STXBP1 regulates the formation of the SNARE complex by binding to the closed conformation of syntaxin-1, a process that drives the fusion of synaptic vesicles and the neurotransmitter release at the synapse.
STXBP1 knock-out (KO) studies have demonstrated that absence of the protein in neurons leads to a complete loss of neurotransmitter secretion from synaptic vesicles throughout development (Verhage et al. 2000). The characterization of heterozygous KO models for STXBP1 (HET) indicated that a reduction of about 50% of the STXBP1 protein levels results in a strong seizure phenotype characterized by myoclonic jerks and spike-wave discharges (Kovacevic et al. 2018, Orock et al. 2018, Chen et al. 2020). The extended phenotyping of such HET mice also showed impaired cognitive performance, hyperactivity and anxiety-like behavior. The generation of mice with a heterozygous expression in only gabaergic neurons provided further insights into the mechanism of STXBP1 mutations by highlighting differences in synaptic transmission from gabaergic interneurons to glutamatergic pyramidal neurons (Chen et al. 2020).
The STXBP1 HET mouse neurons show normal synaptic transmission although more detailed analysis indicated that reduced levels of STXBP1 result in increased synaptic depression during intense stimulation at glutamatergic, GABAergic, and neuromuscular synapses (Toonen et al. 2006). Experiments with stem cell derived human neurons indicated that a 20-30% reduction in STXBP1 levels results in a dramatic decrease of the normal synaptic function (Patzke et al. 2015) further highlighting that the effects of STXBP1 mutations may vary between neuronal subtypes and species background. On the contrary, overexpression of STXBP1 in normal mouse neurons results in increased synaptic function (Toonen et al. 2006) and phenotypic analysis of a transgenic mouse strain that overexpresses the protein isoform munc18-1a in the brain displayed several schizophrenia-related behaviors (Uriguen et al. 2013). Additional non-synaptic roles have been described for STXBP1 and suggested to regulate the mechanism of radial migration of cortical neurons. STXBP1 may thus also modulate vesicle fusion at the plasma membrane to distribute various proteins on the cell surface and the vesicle transport from Golgi to the plasma membrane (Hamada et al. 2016).
Mutations in STXBP1 that result in loss of functional activity have been characterized in vitro and in model systems to establish the impact on neuronal function. Mutations that lead to a truncation of the STXBP1 protein, in general linked to nonsense, frameshift or deletions, are not detected in neuronal systems and it is hypothesized that such mutant proteins are rapidly downregulated by a nonsense mediated decay mechanism of their RNA messengers. About 40-50% of mutations in STXBP1 are missense mutations (Abramov et al. 2020) and in vitro experiments have demonstrated that such point mutations result in a decreased stability of the STXBP1 protein and leading to a reduced expression levels in neuronal systems (Kovacevik et al. 2018, Zhu et al. 2020). The study of stem cell derived neurons from Othahara patients carrying STXBP1 missense mutations also indicated a reduction of STXBP1 protein levels (Yamashita et al. 2016). More recently, a homozygous STXBP1 mutation was identified and in vitro studies indicated that the homozygous L446F mutation causes a gain-of-function phenotype while having less impact on protein levels than previously reported for the heterozygous mutations (Lammertse et al. 2020).
Overall, STXBP1 genetic disorder is linked to a loss of function of the STXBP1 protein and multiple therapeutic approaches have been proposed including, small molecule chaperons to prevent aggregation of mutant forms and antisense oligonucleotides to downregulate specific miRNA that negatively regulate STXBP1 expression (Abramov et al. 2020). The complexity for developing a disease modifying therapy for STXBP1 lies in the development of new specific tools able to restore normal STXBP1 functional activity and that can be translated to the clinic. No approved drug therapy addressing the underlying disease mechanism is available at this point.
There is a clear unmet medical need for effective treatment of STXBP1 genetic disorders. The present disclosure provides a disease modifying gene therapy overexpressing STXBP1 to restore normal STXBP1 functional activity with the potential to cure.
The present invention provides by means of gene therapy, a healthy copy of the STXBP1 gene, that is capable of compensating for the effects of STXBP1 mutation and restoring normal STXBP1 functional activity.
The present invention provides:
A nucleic acid construct comprising a transgene encoding:
The invention further provides:
The present invention will now be described with respect to particular non-limiting aspects and embodiments thereof and with reference to certain figures and examples.
Technical terms are used by their common sense unless indicated otherwise. If a specific meaning is conveyed to certain terms, definitions of terms will be given in the context of which the terms are used.
Where an indefinite or definite article is used when referring to a singular noun, e.g. “a”, “an” or “the”, this includes a plural of that noun unless something else is specifically stated.
As used here, the term “comprising” does not exclude other elements. For the purposes of the present disclosure, the term “consisting of” is considered to be a preferred embodiment of the term “comprising”.
As used herein, the terms “treatment”, “treating” and the like, refer to obtaining a desired pharmacologic and/or physiological effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse symptoms attributable to the disease. Treatment thus covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease symptoms from occurring in a subject, i.e. a human, which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.
12 transcript variants of human STXBP1 have been identified, encoding 8 protein isoforms. The amino acid sequences are highly conserved between rodents and humans. In the central nervous system, STXBP1 is specifically expressed in neurons and broadly distributed across major brain areas including cortex, cerebellum, hippocampus and basal ganglia (Kalidas et al. 2000). Two major splice variants have been described, including a short and a long version:
The longer splice version (M18L, Munc18-1a, 603 amino acids) shows a difference in the last 25 C-terminal amino acids and is reported to be expressed to a major part at the synaptic level and in gabaergic neurons in the rat brain (Ramos et al. 2015). The smaller splice version (M18S, Munc18-1b, 594 amino acids) has been localized in different cellular compartments and is more ubiquitously expressed in gabaergic and glutamatergic neurons. Functional studies indicated that STXBP1 splice variants could play different roles in synaptic plasticity (Meijer et al. 2015).
STXBP1 gene is located on the chromosome 9q34.11 (GRCh38 genomic coordinates: chr9:127,579,370-127,696,029) and the human encoded protein has a high level of identity with both rat and murine STXBP1 (Swanson et al. 1998). STXBP1 gene contains 25 exons. Alternative splicing of the final exon in the STXBP1 primary transcript may include or skip a sequence of 110 bp containing a stop codon, resulting in two different C-terminal amino acid sequences for STXBP1. The STXBP1-202 transcript (ENST00000373302.8) (SEQ ID NO: 22) is the longest, encoding for a 603 amino acid protein (SEQ ID NO: 9). STXBP1-201 (ENST00000373299.5) (SEQ ID NO: 23) encodes for a 594 amino acid protein (SEQ ID NO: 10). Both of these variants are detected in the central nervous system although their expression pattern may vary between brain tissues and cell types (Ramos-Miguel et al. 2015).
The 12 transcript variants and 8 protein isoforms of human STXBP1 are summarised in Table 2.
Syntaxin binding protein 1 or STXBP1 is sometimes referred to in the art by the alternative names listed in Table 3. The most common ones are “Munc18-1” and to a lesser extent “Sec1”. The accepted gene name is STXBP1.
Protein sequence alignment of the human, monkey and mouse STXBP1 sequences (human isoform a according to SEQ ID NO: 9) is shown in
The present invention provides a nucleic acid construct comprising a transgene encoding:
The term “transgene” refers to a nucleic acid molecule (“nucleic acid molecule” and “nucleic acid” are used interchangeably), DNA or cDNA encoding a gene product for use as the active principle in gene therapy. The gene product may be one or more peptides or proteins.
In one embodiment the transgene encodes STXBP1 isoform a having the sequence given in SEQ ID NO: 9; or a sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO: 9.
In one embodiment the transgene encodes STXBP1 isoform b having the sequence given in SEQ ID NO: 10; or a sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO: 10.
In one embodiment the transgene encodes STXBP1 isoform c having the sequence given in SEQ ID NO: 11; or a sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO:11.
In one embodiment the transgene encodes STXBP1 isoform d having the sequence given in SEQ ID NO: 12; or a sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO:12.
In one embodiment the transgene encodes STXBP1 isoform e having the sequence given in SEQ ID NO: 13; or a sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO: 13.
In one embodiment the transgene encodes STXBP1 isoform f having the sequence given in SEQ ID NO: 14; or a sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO: 14.
In one embodiment the transgene encodes STXBP1 isoform g having the sequence given in SEQ ID NO: 15; or a sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO: 15.
In one embodiment the transgene encodes STXBP1 isoform h having the sequence given in SEQ ID NO: 16; or a sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO: 16.
In one embodiment the transgene encodes:
As is conventional practice in the art, the mRNA sequences of STXBP1 transcript variants 1 to 12 are reported as DNA sequences for consistency with the reference genome sequence. (National Center for Biotechnology Information, www.ncbi.nlm.nih.gov). The goal of this is to more directly perform a genomic alignment with fewer mismatches reported. In order to express STXBP1 isoform a, b, or c, for example, a person skilled in the art would express a cDNA from transcript variant 1, 2, or 3.
In one embodiment the transgene encodes STXBP1 isoform a and comprises a cDNA sequence of SEQ ID NO: 7; or a sequence having at least 95% or 96% or 97% or 98% or 99% or 99.5% sequence identity to SEQ ID NO: 7.
The terms “nucleic acid” and “polynucleotide” or “nucleotide sequence” may be used interchangeably to refer to any molecule composed of or comprising monomeric nucleotides. A nucleic acid may be an oligonucleotide or a polynucleotide. A nucleotide sequence may be a DNA or RNA. A nucleotide sequence may be chemically modified or artificial. Nucleotide sequences include peptide nucleic acids (PNA), morpholinos and locked nucleic acids (LNA), as well as glycol nucleic acids (GNA) and threose nucleic acid (TNA). Each of these sequences is distinguished from naturally-occurring DNA or RNA by changes to the backbone of the molecule. Phosphorothioate nucleotides may be used. Other deoxynucleotide analogs include methylphosphonates, phosphoramidates, phosphorodithioates, N3′P5′-phosphoramidates and oligoribonucleotide phosphorothioates and their 2′-0-allyl analogs and 2′-0-methylribonucleotide methylphosphonates.
The term “nucleic acid construct” refers to a non-naturally occurring nucleic acid resulting from the use of recombinant DNA technology. Especially, a nucleic acid construct is a nucleic acid molecule which has been modified to contain segments of nucleic acid sequences, which are combined or juxtaposed in a manner which does not exist in nature.
In specific embodiments, said nucleic acid construct comprises all or a fragment of a coding nucleic acid sequence having at least 70%, 80%, 90%; 95%, 99% or 100% identity to the coding sequence of a naturally-occurring or recombinant functional variant of STXBP1.
The term “fragment” as used herein refers to a contiguous portion of a reference sequence. For example, a fragment of a sequence having 1000 nucleotides in length may refer to 5, 50, 500 contiguous nucleotides of said sequence.
The term “pathological variant” as used herein refers to a nucleic acid or amino acid sequence which is modified relative to a reference sequence and which has impaired function compared to said reference sequence. Pathological variants and likely pathological variants of STXBP1 are shown in Tables 5 and 6 respectively.
The term “functional variant” as used herein refers to a nucleic acid or amino acid sequence which is modified relative to a reference sequence but which retains the function of said reference sequence. Functional variants of STXBP1 are shown in Table 7.
The term “sequence identity” or “identity” refers to the number of matches (identical nucleic acid or amino acid residues) in positions from an alignment of two polynucleotide or polypeptide sequences. The sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps. In particular, sequence identity may be determined using any of a number of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithms (e.g. Needleman and Wunsch algorithm; Needleman and Wunsch, 1970, J Mol Biol.; 48(3):443-53) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith and Waterman algorithm (Smith and Waterman, 1981, J Theor Biol.; 91(2):379-80) or Altschul algorithm (Altschul S F et al., 1997, Nucleic Acids Res.; 25(17):3389-402.; Altschul S F et al., 2005, Bioinformatics.; 21(8):1451-6). Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software available on internet web sites such as http://blast.ncbi.nlm.nih.gov/or http://www.ebi.ac.uk/Tools/emboss/. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, % nucleic acid or amino acid sequence identity values refers to values generated using the pair wise sequence alignment program EMBOSS Needle that creates an optimal global alignment of two sequences using the Needleman-Wunsch algorithm, wherein all search parameters are set to default values, i.e. Scoring matrix=BLOSUM62, Gap open=10, Gap extend=0.5, End gap penalty=false, End gap open=10 and End gap extend=0.5.
The nucleic acid construct according to the present disclosure comprises a transgene and at least a suitable nucleic acid element for its expression in a host, such as in a host cell.
For example, said nucleic acid construct comprises a transgene encoding STXBP1 and one or more control sequences required for expression of STXBP1 in the relevant host. Generally, the nucleic acid construct comprises a transgene and regulatory sequences preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the transgene that are required for expression of STXBP1.
In one embodiment, the nucleic acid construct comprises a transgene encoding STXBP1 and a promoter operably-linked to said transgene. Preferably, the transgene is under the control of the promoter.
The term “promoter” refers to a regulatory element that directs the transcription of a nucleic acid to which it is operably linked. A promoter can regulate both rate and efficiency of transcription of an operably-linked nucleic acid. A promoter may also be operably-linked to other regulatory elements which enhance (“enhancers”) or repress (“repressors”) promoter-dependent transcription of a nucleic acid. These regulatory elements include, without limitation, transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known by one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter, e.g. attenuators, enhancers, and silencers. The promoter is located near the transcription start site of the gene or coding sequence to which is operably-linked, on the same strand and upstream of the DNA sequence (towards the 5′ region of the sense strand). A promoter can be about 100-1000 base pairs long. Positions in a promoter are designated relative to the transcriptional start site for a particular gene (i.e., positions upstream are negative numbers counting back from −1, for example −100 is a position 100 base pairs upstream).
The term “operably-linked in a 5′ to 3′ orientation” or simply “operably-linked” refers to a linkage of two or more nucleotide sequences in a functional relationship which allows each of said two or more sequences to perform their normal function. Typically, the term operably-linked is used to refer to the juxtaposition of a regulatory element such as promoter and a transgene encoding a protein of interest. For example, an operable linkage between a promoter and a transgene permits the promoter to function to drive the 5′ expression of the transgene in a suitable expression system, such as in a cell.
The promoter may be a tissue or cell type specific promoter, or an organ-specific promoter, or a promoter specific to multiple organs, or a systemic or ubiquitous promoter.
The term “ubiquitous promoter” more specifically relates to a promoter that is active in a variety of distinct cells or tissues, for example in both the neurons and astrocytes.
Examples of promoter suitable for expression of the transgene across the central nervous system include chicken beta actin (CBA) promoter (Miyazaki 1989, Gene 79:269-277), the CAG promoter (Niwa 1991, Gene 108:193-199), the Elongation factor 1 alpha promoter (EF1α) (Nakai 1998, Blood 91:4600-4607), the human synapsin 1 gene promoter (hSyn) (Kugler S. et al. Gene Ther. 2003. 10(4):337-47) or the phosphoglycerate kinase 1 promoter (PGK1) (Hannan 1993, Gene 130:233-239), the methyl CPG Binding Protein 2 (MECP2) promoter (Adachi et al., Hum. Mol. Genetics. 2005; 14(23): 3709-3722), the human neuron-specific enolase (NSE) promoter (Twyman, R. M. and E. A. Jones (1997). J Mol Neurosci 8(1): 63-73)), the calcium/calmodulin dependent protein-kinase II (CAMKII) promoter (Nathanson, J. L., et al. (2009). Neuroscience 161(2): 441-450) and the human ubiquitin C (UBC) promoter (Schorpp, M., et al. (1996). Nucleic Acids Res 24(9): 1787-1788).
In one embodiment, the promoter is a CAG 1.6 kb promoter of SEQ ID NO: 1.
In one embodiment, the promoter is a hSYN promoter of SEQ ID NO: 2.
In one embodiment, the promoter is a MECP2 promoter of SEQ ID NO: 3.
In one embodiment, the promoter is a hNSE promoter of SEQ ID NO: 4.
In one embodiment, the promoter is a CamKII promoter of SEQ ID NO: 5.
In one embodiment, the promoter is an endogenous hSTXBP1 promoter of SEQ ID NO: 6.
In one embodiment, the promoter is a MECP2 promoter of SEQ ID NO: 3, operably-linked in a 5′ to 3′ orientation to a MECP2 intron of SEQ ID NO: 37.
In alternative embodiments, the nucleic acid construct comprises a transgene encoding STXBP1 and a promoter operably-linked to said transgene, wherein the promoter is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to:
The promoter may be a functional variant or fragment of the promoters described herein. A functional variant or fragment of a promoter may be functional in the sense that it retains the characteristics of the corresponding non-variant or full-length promoter. Thus, a functional variant or fragment of a promoter retains the capacity to drive the transcription of a transgene to which it is operably linked, thereby driving the expression of STXBP1 encoded by said transgene. A functional variant or fragment of a promoter may retain specificity for a particular tissue type. For example, a functional variant or fragment of a promoter may be specific for cells of the CNS. A functional variant or fragment of a promoter may specifically drive expression of STXBP1 in neurons.
The promoter may comprise a “minimal sequence”, which means a nucleotide sequence of the promoter having sufficient length and containing the required elements to function as a promoter, i.e. capable of driving the transcription of the transgene to which said promoter is operably linked, thereby driving the expression of STXBP1.
The minimal promoter used in the nucleic acid constructs of the present invention may be for example the CAG promoter comprising SEQ ID NO: 1, or the hSYN promoter comprising SEQ ID NO: 2, or the MECP2 promoter comprising SEQ ID NO: 3.
The promoter may comprise one or more introns. The term “intron” refers to an intragenic non-coding nucleotide sequence. Typically, introns are transcribed from DNA into messenger RNA (mRNA) during transcription of a gene but are excised from the mRNA transcript by splicing prior to its translation.
The promoter may comprise a functional variant or fragment of an intron described herein. A functional variant or fragment of an intron may be functional in the sense that it retains the characteristics of the corresponding non-variant or full-length intron. Thus, functional variants or fragments of an intron described herein are non-coding. Functional variants or fragments of an intron described herein may also retain the capacity to be transcribed from DNA to mRNA and/or the capacity to be excised from mRNA by splicing.
Introns that may be incorporated in the promoters used in the present invention may be from naturally non-coding regions or may be engineered.
In one embodiment, the intron is a MECP2 intron comprising or consisting of SEQ ID NO: 37; or a functional variant or fragment thereof having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% identity to SEQ ID NO: 37.
A promoter and/or intron may be combined with one or more non-expressing exonic sequence(s). Non-expressing exonic sequences are not capable of producing a transcript, rather they may flank an intronic sequence to provide splice sites.
Alternatively, a promoter may be a chemically-inducible promoter. A chemically-inducible promoter is a promoter that is regulated by the in vivo administration of a chemical inducer to a subject in need thereof. Examples of suitable chemically-inducible promoters include without limitation tetracycline/minocycline inducible promoters (Chtarto 2003, Neurosci Lett. 352:155-158) or rapamycin inducible promoters (Sanftner 2006, Mol Ther. 13:167-174).
The nucleic acid construct may comprise a 3′ untranslated region comprising a polyadenylation signal sequence and/or transcription terminator.
The term “polyadenylation signal sequence”, (or “polyadenylation site or “poly(A) signal” which are all used interchangeably) refers to a specific recognition sequence within the 3′ untranslated region (3′ UTR) of a gene, which is transcribed into precursor mRNA and guides the termination of gene transcription. The polyadenylation signal sequence acts as a signal for the endonucleolytic cleavage of the newly formed precursor mRNA at its 3′-end, and for the addition to this 3′-end of a stretch of RNA consisting only of adenine bases (polyadenylation process; poly(A) tail). The polyadenylation signal sequence is important for the nuclear export, translation, and stability of mRNA. In the context of the invention, the polyadenylation signal sequence is a recognition sequence that can direct polyadenylation of mammalian genes and/or viral genes, in mammalian cells.
The polyadenylation signal sequence typically consists of (a) a consensus sequence AAUAAA, which has been shown to be required for both 3′-end cleavage and polyadenylation of pre-messenger RNA (pre-mRNA) as well as to promote downstream transcriptional termination; and (b) additional elements upstream and downstream of AAUAAA that control the efficiency of utilization of AAUAAA as a poly(A) signal. There is considerable variability in these motifs in mammalian genes.
In one embodiment, optionally in combination with one or more features of the various embodiments described herein, the polyadenylation signal sequence of the nucleic acid construct of the invention is a polyadenylation signal sequence of a mammalian gene or a viral gene. Suitable polyadenylation signals include, among others, a SV40 early polyadenylation signal, a SV40 late polyadenylation signal, a HSV thymidine kinase polyadenylation signal, a protamine gene polyadenylation signal, an adenovirus 5 Elb polyadenylation signal, a growth hormone polyadenylation signal, a PBGD polyadenylation signal, or an in silico designed synthetic polyadenylation signal.
In one embodiment, the polyadenylation signal sequence is a SV40 polyadenylation signal sequence comprising SEQ ID NO: 8.
The nucleic acid construct may comprise additional regulatory elements, for example enhancer sequence, intron, microRNA targeted sequence, a polylinker sequence facilitating the insertion of a DNA fragment within a vector and/or splicing signal sequence.
The present invention further provides a viral vector comprising the nucleic acid construct as described herein.
The term “viral vector” refers to the nucleic acid part of the viral particle as disclosed herein, which may be packaged in a capsid.
Viral vectors typically comprise at least (i) a nucleic acid construct including a transgene and suitable nucleic acid elements for its expression in a host, and (ii) all or a portion of a viral genome, for example inverted terminal repeats of a viral genome.
The term “inverted terminal repeat” (ITR) refers to a nucleotide sequence located at the 5′-end (5′ITR) and a nucleotide sequence located at the 3′-end (3′ITR) of a virus, that contain palindromic sequences and that can fold over to form T-shaped hairpin structures that function as primers during initiation of DNA replication. They are also needed for viral genome integration into the host genome, for the rescue from the host genome and for the encapsidation of viral nucleic acid into mature virions. The ITRs are required in cis for the vector genome replication and its packaging into the viral particles.
In one embodiment, the viral vector comprises a 5′ITR, and a 3′ITR of a virus.
In one embodiment, the viral vector comprises a 5′ITR and a 3′ITR of a virus independently selected from the group consisting of parvoviruses (in particular adeno-associated viruses), adenoviruses, alphaviruses, retroviruses (in particular gamma retroviruses and lentiviruses), herpesviruses, and SV40.
In one embodiment the virus is an adeno-associated virus (AAV), an adenovirus (Ad), or a lentivirus.
In one embodiment the virus is an AAV.
In one embodiment, the viral vector comprises a 5′ITR and a 3′ITR of an AAV.
AAV has generated considerable interest as a potential vector for human gene therapy. Among the favourable properties of the virus are its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the wide range of cell lines derived from different tissues that can be infected. The AAV genome is composed of a linear, single-stranded DNA molecule which contains 4681 bases (Berns and Bohenzky, 1987, Advances in Virus Research (Academic Press, Inc.) 32:243-307). The genome includes inverted terminal repeats (ITRs) at each end, which function in cis as origins of DNA replication and as packaging signals for the virus. The ITRs are typically about 100-150 bp in length.
AAV ITRs may have a wild-type nucleotide sequence or may be altered by the insertion, deletion or substitution of one or more nucleotides, typically, no more than 5, 4, 3, 2 or 1 nucleotide insertion, deletion or substitution as compared to known AAV ITRs. The serotype of the inverted terminal repeats (ITRs) of the AAV vector may be selected from any known human or non-human AAV serotype.
In specific embodiments, the viral vector may comprise ITRs of any AAV serotype. Known AAV ITRs include without limitation, AAV1, AAV2, AAV3 (including types 3A and 3B), AAV-LK03, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 (AAVrh10), AAV11, AAV12, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV. Recombinant serotypes such as Rec2 and Rec3 identified from primate brain are also included.
Alternatively, the viral vector may comprise a synthetic 5′ITR and/or 3′ITR.
In one embodiment, the nucleic acid construct of the present invention is comprised in a viral vector which further comprises a 5′ITR and/or a 3′ITR of an AAV of a serotype AAV2.
In one embodiment, the viral vector comprises a 3′ITR and/or 5′ITR of an AAV of a serotype AAV2, having the sequence given in SEQ ID NO: 18 and/or 19 respectively; or a sequence having at least 80% or at least 90% identity with SEQ ID NO: 18 and/or 19 respectively.
The present invention further provides a viral particle comprising the nucleic acid construct or the viral vector as described herein.
The term “viral particle” refers to an infectious and typically replication-defective virus particle comprising (i) a viral vector packaged within (optionally comprising a nucleic acid construct) and (ii) a capsid.
In one embodiment, the capsid is formed of capsid proteins of an adeno-associated virus.
Proteins of the viral capsid of an adeno-associated virus include the capsid proteins VP1, VP2, and VP3. Differences among the capsid protein sequences of the various AAV serotypes result in the use of different cell surface receptors for cell entry. In combination with alternative intracellular processing pathways, this gives rise to distinct tissue tropisms for each AAV serotype.
AAV-based gene therapy targeting the CNS is reviewed in Pignataro D, Sucunza D, Rico A J et al., J Neural Transm 2018; 125:575-589. Viral particles may be selected and/or engineered to target at least neuronal cells in various area of the brain and CNS.
AAV viruses are commonly referred to in terms of their serotype. A serotype corresponds to a variant subspecies of AAV which, owing to its profile of expression of capsid surface antigens, has a distinctive reactivity which can be used to distinguish it from other variant subspecies. AAV serotypes include AAV1, AAV2, AAV3 (including A and B) AAV-LK03, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 (AAVrh10) or AAV11, or combinations thereof. The AAV may be a recombinant serotype, such as Rec2 or Rec3 identified from primate brain; and AAV2-true-type (AAVtt). AAVtt is described in detail in Tordo et al., Brain. 2018; 141(7): 2014-2031 and WO 2015/121501. Reviews of AAV serotypes may be found in Choi et al (Curr Gene Ther. 2005; 5(3); 299-310) and Wu et al (Molecular Therapy. 2006; 14(3), 316-327).
In the viral particle of the invention, the capsid may be derived from any AAV serotype or from a combination of serotypes (such as VP1 from one AAV serotype and VP2 and/or VP3 from a different serotype).
In specific embodiments, the capsid proteins may be derived from AAV2, AAV5, AAV8, AAV9, AAV2-retro or AAVtt.
In one embodiment, the viral particle comprises at least a VP1 capsid protein from an AAV, wherein said capsid protein is derived from AAV2, AAV5, AAV6, AAV8, AAV9 (for example AAV9.hu14 as shown in SEQ ID NO: 21), AAV10, AAV-true type (AAVtt as shown in SEQ ID NO: 20) or combinations thereof.
In one embodiment, the viral particle comprises the capsid protein from AAVtt as shown in SEQ ID NO: 20. In one embodiment the capsid protein is at least 98.5%, 99% or 99.5% identical to SEQ ID NO: 20.
In one embodiment, the viral particle comprises the capsid protein from AAV9 as shown in SEQ ID NO: 21. In one embodiment, the capsid protein is at least 98.5%, 99% or 99.5% identical to SEQ ID NO: 21.
AAV genomes or elements of AAV genomes including ITR sequences, rep or cap genes for use in the invention may be derived from the following accession numbers for AAV whole genome sequences: Adeno-associated virus 1 NC_002077, AF063497; Adeno-associated virus 2 NC_001401; Adeno-associated virus 3 NC_001729; Adeno-associated virus 3B NC_001863; Adeno-associated virus 4 NC_001829; Adeno-associated virus 5 Y18065,5AF085716; Adeno-associated virus 6 NC_001862; Avian AAV ATCC VR-865 AY186198, AY629583, NC_004828; Avian AAV strain DA-1 NC_006263, AY629583; Bovine AAV NC_005889, AY388617.
AAV viruses may also be referred to in terms of clades or clones. This refers to the phylogenetic relationship of naturally derived AAV viruses, and typically to a phylogenetic group of AAV viruses which can be traced back to a common ancestor, and includes all descendants thereof. Additionally, AAV viruses may be referred to in terms of a specific isolate, i.e. a genetic isolate of a specific AAV virus found in nature.
The term “genetic isolate” describes a population of AAV viruses which has undergone limited genetic mixing with other naturally occurring AAV viruses, thereby defining a recognizably distinct population at a genetic level. Examples of clades and isolates of AAV that may be used in the invention include:
The invention encompasses the use of capsid protein sequences from different serotypes, clades, clones, or isolates of AAV within the same vector. The invention also encompasses the packaging of the genome of one serotype into the capsid of another serotype i.e. pseudotyping. Chimeric, shuffled or capsid-modified derivatives may be selected to provide one or more desired functionalities. Thus, these derivatives may display increased efficiency of gene delivery, decreased immunogenicity (humoral or cellular), an altered tropism range and/or improved targeting of a particular cell type compared to an AAV viral vector comprising a naturally occurring AAV capsid. Increased efficiency of gene delivery may be achieved by improved receptor or co-receptor binding at the cell surface, improved internalization, improved trafficking within the cell and into the nucleus, improved uncoating of the viral particle or improved conversion of a single-stranded genome to double-stranded form. Increased efficiency may also relate to an altered tropism range or targeting of a specific cell population, such that the vector dose is not diluted by delivery to tissues where it is not needed.
Chimeric capsid proteins include those generated by recombination between two or more capsid coding sequences of naturally occurring AAV serotypes. This may be performed for example by a marker rescue approach in which non-infectious capsid sequences of one serotype are co-transfected with capsid sequences of a different serotype, and directed selection is used to select for capsid sequences having desired properties. The capsid sequences of the different serotypes can be altered by homologous recombination within the cell to produce novel chimeric capsid proteins.
Chimeric capsid proteins include those generated by engineering of capsid protein sequences to transfer specific capsid protein domains, surface loops or specific amino acid residues between two or more capsid proteins, for example between two or more capsid proteins of different serotypes. Shuffled or chimeric capsid proteins may be generated by DNA shuffling or by error-prone PCR. Hybrid AAV capsid genes can be created by randomly fragmenting the sequences of related AAV genes e.g. those encoding capsid proteins of multiple different serotypes and then subsequently reassembling the fragments in a self-priming polymerase reaction, which may also cause crossovers in regions of sequence homology. A library of hybrid AAV genes created in this way by shuffling the capsid genes of several serotypes can be screened to identify viral clones having a desired functionality. Similarly, error prone PCR may be used to randomly mutate AAV capsid genes to create a diverse library of variants which may then be selected for a desired property.
The sequences of the capsid genes may be genetically modified to introduce specific deletions, substitutions or insertions with respect to the native wild-type sequence. For example, capsid genes may be modified by the insertion of a sequence of an unrelated protein or peptide within an open reading frame of a capsid coding sequence, or at the N- and/or C-terminus of a capsid coding sequence. The unrelated protein or peptide may advantageously be one which acts as a ligand for a particular cell type, thereby conferring improved binding to a target cell or improving the specificity of targeting of the viral particle to a particular cell population. The unrelated protein may be one which assists purification of the viral particle as part of the production process i.e. an epitope or affinity tag. The site of insertion will typically be selected so as not to interfere with other functions of the viral particle such as internalization or trafficking of the viral particle. Suitable insertion sites are disclosed in Choi et al (Curr Gene Ther. 2005; 5(3); 299-310).
In one embodiment, a viral particle may be prepared by encapsulating an AAV viral vector derived from a particular AAV serotype in a viral particle formed by natural Cap proteins corresponding to an AAV of the same serotype.
Nevertheless, several techniques have been developed to modify and improve the structural and functional properties of naturally occurring viral particles (Bunning H et al. J Gene Med 2008; 10: 717-733).
Thus, in another embodiment, a viral particle may include a nucleic acid construct comprising a transgene encoding STXBP1, flanked by ITR(s) of a given AAV serotype, packaged into:
AAVtt capsid also named AAV2 true-type capsid is described in WO2015/121501. In one embodiment, AAVtt VP1 capsid protein comprises at least one amino acid substitution with respect to the wild-type VP1 capsid protein at a position corresponding to one or more of the following positions in an AAV2 protein sequence (NCBI Reference sequence: YP_680426.1): 125, 151, 162, 205, 312, 457, 492, 499, 533, 546, 548, 585, 588 and/or 593.
In one embodiment, AAVtt comprises one or more of the following amino acid substitutions with respect to a wild-type AAV2 VP1 capsid protein (NCBI Reference sequence: YP_680426.1): V1251, V151A, A162S, T205S, N312S, Q457M, S492A, E499D, F533Y, G546D, E548G, R585S, R588T and/or A593S.
In one embodiment, AAVtt comprises four or more mutations with respect to the wild type AAV2 VP1 capsid protein at the positions 457, 492, 499 and 533.
The construction of recombinant AAV viral particles is generally known in the art and has been described for instance in U.S. Pat. Nos. 5,173,414; 5,139,941; WO 92/01070; WO 93/03769; Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, B. J. (1992) Current Opinion in Biotechnology 3:533-539; Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158:97-129; and Kotin, R. M. (1994) Human Gene Therapy 5:793-801.
Production of viral particles carrying the viral vector and nucleic acid construct as described herein can be performed by means of conventional methods and protocols, which are selected by taking into account the structural features of the viral particles to be produced.
Briefly, viral particles can be produced in a host cell, more particularly in a specific virus-producing cell (packaging cell), which is transfected with the nucleic acid construct or viral vector in the presence of a helper vector or virus or other DNA construct(s).
The term “packaging cell” refers to a cell or cell line which may be transfected with a nucleic acid construct or viral vector and provides in trans all the missing functions that are required for the complete replication and packaging of a viral vector. Packaging cells may express such missing viral functions in a constitutive or inducible manner. Packaging cells may be adherent or suspension cells.
Typically, a process of producing viral particles comprises the following steps:
Conventional methods can be used to produce viral particles, which involve transient cell co-transfection with a nucleic acid construct or expression vector (e.g. a plasmid) carrying the transgene encoding STXBP1; a second nucleic acid construct (e.g. an AAV helper plasmid) that encodes rep and cap genes, but does not carry ITR sequences; and a third nucleic acid construct (e.g. a plasmid) providing the adenoviral functions necessary for AAV replication.
Viral genes necessary for AAV replication are referred to as viral helper genes. Typically, said genes necessary for AAV replication are adenoviral helper genes, such as E1A, E1B, E2a, E4, or VA RNAs. In one embodiment, the adenoviral helper genes are of the Ad5 or Ad2 serotype.
Production of AAV particles may alternatively be carried out by infection of insect cells with a combination of recombinant baculoviruses (Urabe et al. Hum. Gene Ther. 2002; 13: 1935-1943). SF9 cells are co-infected with two or three baculovirus vectors respectively expressing AAV rep, AAV cap and the AAV vector to be packaged. The recombinant baculovirus vectors provide the viral helper gene functions required for virus replication and/or packaging. Smith et al 2009 (Molecular Therapy, vol. 17, no. 11, pp 1888-1896) describes a dual baculovirus expression system for large-scale production of AAV particles in insect cells.
Suitable culture media are known to a person skilled in the art. The ingredients that make up a culture medium may vary depending on the type of cell to be cultured. In addition to nutrient composition, osmolarity and pH are considered important parameters of culture media. The cell growth medium comprises a number of ingredients well known by the person skilled in the art, including amino acids, vitamins, organic and inorganic salts, sources of carbohydrate, lipids, trace elements (to name a few, CuS04, FeS04, Fe(N03)3, ZnS04), each ingredient being present in an amount which supports the cultivation of a cell in vitro (i.e., survival and growth of cells). Ingredients may also include auxiliary substances, such as buffer substances (for example sodium bicarbonate, Hepes, Tris or similarly performing buffers), oxidation stabilisers, stabilisers to counteract mechanical stress, protease inhibitors, animal growth factors, plant hydrolysates, anti-clumping agents, anti-foaming agents. Characteristics and compositions of cell growth media vary depending on the particular cellular requirements. Examples of commercially available cell growth media include: MEM (Minimum Essential Medium), BME (Basal Medium Eagle), DMEM (Dulbecco's modified Eagle's Medium), Iscoves DMEM (Iscove's modification of Dulbecco's Medium), GMEM, RPMI 1640, Leibovitz L-15, McCoy's, Medium 199, Ham (Ham's Media) F10 and derivatives, Ham F12, DMEM/F12.
Further guidance for the construction and production of viral vectors for use according to the disclosure can be found in Viral Vectors for Gene Therapy, Methods and Protocols. Series: Methods in Molecular Biology, Vol. 737. Merten and Al-Rubeai (Eds.); 2011 Humana Press (Springer); Gene Therapy. M. Giacca. 2010 Springer-Verlag; Heilbronn R. and Weger S. Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics. In: Drug Delivery, Handbook of Experimental Pharmacology 197; M. Schäfer-Korting (Ed.). 2010 Springer-Verlag; pp. 143-170; Adeno-Associated Virus: Methods and Protocols. R. O. Snyder and P. Moulllier (Eds). 2011 Humana Press (Springer); Bünning H. et al. Recent developments in adeno-associated virus technology. J. Gene Med. 2008; 10:717-733; Adenovirus: Methods and Protocols. M. Chillón and A. Bosch (Eds.); Third Edition. 2014 Humana Press (Springer).
The disclosure further provides a host cell comprising a nucleic acid construct or a viral vector encoding STXBP1 as described herein. The host cell according to the disclosure is a virus-producing cell, also named packaging cell which is transfected with the nucleic acid construct or viral vector in the presence of a helper vector or virus or other DNA constructs; and provides in trans all the missing functions which are required for the complete replication and packaging of a viral particle. Said packaging cells can be adherent or suspension cells.
The packaging cell may be a eukaryotic cell such as a mammalian cell, including simian, human, dog and rodent cells. Examples of human cells are PER.C6 cells (WO01/38362), MRC-5 (ATCC CCL-171), WI-38 (ATCC CCL-75), HEK-293 cells (ATCC CRL-1573), HeLa cells (ATCC CCL2) and fetal rhesus lung cells (ATCC CL-160). Examples of non-human primate cells are Vero cells (ATCC CCL81), COS-1 cells (ATCC CRL-1650) or COS-7 cells (ATCC CRL-1651). Examples of dog cells are MDCK cells (ATCC CCL-34). Examples of rodent cells are hamster cells, such as BHK21-F, HKCC cells, or CHO cells.
As an alternative to mammalian sources, the packaging cell for producing the viral particles may be derived from an avian source such as chicken, duck, goose, quail or pheasant. Examples of avian cell lines include avian embryonic stem cells (WO01/85938; WO03/076601), immortalized duck retina cells (WO2005/042728), and avian embryonic stem cell derived cells including chicken cells (WO2006/108846) or duck cells, such as EB66 cell line (WO2008/129058; WO2008/142124).
In another embodiment, the host cell can be any packaging cell permissive for baculovirus infection and replication. In one example said cells are insect cells, such as SF9 cells (ATCC CRL-1711), Sf21 cells (IPLB-Sf21), MG1 cells (BTI-TN-MG1) or High Five™ cells (BTI-TN-5B1-4).
In one embodiment the host cell comprises:
The disclosure further provides a host cell transduced with a viral particle of the disclosure and the term “host cell” as used herein refers to any cell line that is susceptible to infection by a virus of interest, and amenable to culture in vitro.
The present disclosure further provides a pharmaceutical composition comprising a nucleic acid construct, a viral vector, a viral particle of the disclosure in combination with a pharmaceutical acceptable excipient, diluent or carrier.
The term “pharmaceutically acceptable” means approved by a regulatory agency or recognized pharmacopeia such as European Pharmacopeia, for use in animals and/or humans. The term “excipient” refers to a diluent, adjuvant, carrier, or vehicle with which the therapeutic agent is administered.
Any suitable pharmaceutically acceptable carrier, diluent or excipient can be used in the preparation of a pharmaceutical composition (See e.g., Remington: The Science and Practice of Pharmacy, Alfonso R. Gennaro (Editor) Mack Publishing Company, April 1997). Pharmaceutical compositions are typically sterile and stable under the conditions of manufacture and storage. Pharmaceutical compositions may be formulated as solutions (e.g. saline, dextrose solution, or buffered solution, or other pharmaceutically acceptable sterile fluids), microemulsions, liposomes, or other ordered structure suitable to accommodate a high product concentration (e.g. microparticles or nanoparticles). The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol or sorbitol, or salts such as sodium chloride in the composition.
In one embodiment, the pharmaceutical composition is formulated as a solution, for example a buffered saline solution.
Supplementary active compounds may be incorporated into the pharmaceutical compositions of the disclosure. Guidance on co-administration of additional therapeutics can be found in the Compendium of Pharmaceutical and Specialties (CPS) of the Canadian Pharmacists Association.
In one embodiment, the pharmaceutical composition is a composition suitable for intraparenchymal, intracerebral, intravenous, or intrathecal administration. These pharmaceutical compositions are exemplary only and do not limit the pharmaceutical compositions suitable for other parenteral and non-parenteral administration routes. The pharmaceutical compositions described herein can be packaged in single unit dosage or in multi-dosage forms.
Pharmaceutical compositions, nucleic acid constructs, viral vectors and viral particles of the present disclosure may be used in treating or preventing any condition that is associated with a loss of STXBP1 functional activity; for example any condition associated with STXBP1 mutation.
Such conditions include Dravet syndrome, Lennox-Gastaut syndrome, infantile spasms, myoclonic epilepsy, epileptic encephalopathy, early myoclonic encephalopathy, non-syndromic epilepsy, Ohtahara syndrome, early onset epileptic encephalopathy, West syndrome, development delay, autism spectrum disorders, ataxia-tremor-retardation syndrome, Rett syndrome and intellectual disability without epilepsy.
Pharmaceutical compositions, nucleic acid constructs, viral vectors and viral particles of the present disclosure may be especially useful for treating or preventing neurodevelopmental and/or epileptic disorders associated with genetic mutations in the STXBP1 gene, for example mutations that contribute to the development of syndromes such as Ohtahara, Dravet and West syndrome.
Thus in one embodiment, the pharmaceutical composition, nucleic acid construct, viral vector or viral particle is provided for use in therapy.
In one embodiment, the pharmaceutical composition, nucleic acid construct, viral vector or viral particle is provided for use in the treatment of an STXBP1 genetic disorder.
In one embodiment, the STXBP1 genetic disorder is Dravet syndrome, Lennox-Gastaut syndrome, infantile spasms, myoclonic epilepsy, epileptic encephalopathy, early myoclonic encephalopathy, non-syndromic epilepsy, Ohtahara syndrome, early onset epileptic encephalopathy, West syndrome, development delay, autism spectrum disorders, ataxia-tremor-retardation syndrome, Rett syndrome or intellectual disability without epilepsy.
In one embodiment, the STXBP1 genetic disorder is Dravet syndrome, Ohtahara syndrome or West syndrome.
In one embodiment, use of the nucleic acid construct, viral vector or viral particle is provided for the manufacture of a medicament for the treatment of an STXBP1 genetic disorder.
In one embodiment, the present disclosure provides a method of treating an STXBP1 genetic disorder, comprising administering a therapeutically effective amount of a pharmaceutical composition or viral particle to a patient in need thereof.
The term “therapeutically effective amount” refers to a number of viral particles or an amount of a pharmaceutical formulation comprising such viral particles, which, when administered to a patient or subject, achieves a desired therapeutic result. Desired therapeutic results include:
The term “patient” or “subject” as interchangeably used, refers to mammals. Any mammalian species may benefit from the methods of treatment. Typically, the patient is human. The patient may be a neonate, an infant, a child or an adolescent.
STXBP1 genetic disorder may be identified by known genetic mutations.
In one embodiment, the STXBP1 genetic disorder is associated with a pathological STXBP1 variant comprising a mutation or combination of mutations.
The term “pathological STXBP1 variant” means a variant of STXBP1 found in patient samples and identified through clinical testing or research, which is reported as being associated with a pathological phenotype. Pathological and likely pathological STXBP1 variants are described in Example 3 and illustrated in Tables 5 and 6 respectively.
In one embodiment the pathological STXBP1 variant comprises one or more mutation(s) selected from the group listed in Table 5.
In one embodiment the pathological STXBP1 variant comprises one or more mutation(s) selected from the group listed in Table 6.
The STXBP1 gene therapy described herein may be administered in combination with anti-epileptic drugs or other neuromodulatory treatments.
The pharmaceutical compositions, nucleic acid constructs, viral vectors or viral particles may be administered to the brain and/or the cerebrospinal fluid (CSF) of the patient. For example, they may be administered by injection or by the use of a purpose-specific administration device. Delivery to the brain may be selected from intracerebral delivery, intraparenchymal delivery, intracortical delivery, intrahippocampal delivery, intraputaminal delivery, intracerebellar delivery, and combinations thereof. Delivery to the CSF may be selected from intra-cisterna magna delivery, intrathecal delivery, intracerebroventricular (ICV) delivery, and combinations thereof.
The treatment may be provided as a single dose, but repeat doses may be considered, for example in cases where the treatment may not have targeted the correct region, or in future years and/or with different AAV serotypes.
The sequences included in the present invention are shown in Table 4.
The following Examples illustrate the invention.
Plasmids used in this study were constructed by recombinant DNA techniques. AAV Cis backbone plasmids were synthesized de-novo and contained two AAV inverted terminal repeats (ITRs), a kanamycin resistance cassette, a prokaryotic origin of replication, and an SV40 polyadenylation sequence. DNA sequences coding isoform variant X1 of the human STXBP1 (comprising SEQ ID NO: 7) were synthesized de-novo with convenient cloning restriction sites. Individual promoters were synthesized de-novo with convenient restriction sites. The Human influenza hemagglutinin (HA) or Myc tags (according to SEQ ID NO: 33 and 32, respectively) were synthesized as oligonucleotides from Integrated DNA Technologies™ (Coralville, IA, USA) and inserted at the amino or carboxy terminal. Seven different promoters (MECP2-intron, MECP2, hNSE, CamKII, hSyn, hSTXBP1p, CAG) were tested for human STXBP1 gene.
A schematic cartoon of the designed constructs is shown in
The human-derived AD-HEK293 (Agilent Technologies™, Santa Clara, CA, USA) and mouse-derived Neuro-2A (ATCC™, Manassas, VA) cell lines were passaged in DMEM+10% FBS+1% Penicillin/Streptomycin (all from Thermo Fisher Scientific™, Waltham, MA, USA). Neuro-2A cells were differentiated by supplementing the growth media with 10 μM Retinoic Acid (MilliporeSigma™, Burlington, MA, USA) for 72 hours as previously described (Tremblay, R. G. et al. 2010). Cells were transfected using X-tremeGene 360 Transfection reagent (Roche, Mannheim, Germany) according to the manufacturer's protocol. A control transfection, with control plasmid was also included.
Imaging experiments were performed on a Zeiss Axio Observer 7 epifluorescent microscope (Carl Zeiss AG™, Oberkochen, Germany) equipped with a 40× objective lens, and a Hamamatsu Orca 4 flash cooled monochrome camera (Hamamatsu Photonics KK™ Hamamatsu City, Japan). Transfected AD-HEK293 and Neuro-2A cells were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA, 19440), and stained with the rabbit polyclonal anti-STXBP1 (MilliporeSigma™, Burlington, MA, USA) at1:500. Cells were then stained with donkey anti-rabbit secondary antibodies conjugated to Alexa Fluor 488 at 1:1,000 prior to imaging.
As shown in
Neuro-2A transfected cells transfected with the STXBP1 plasmids driven by ubiquitous CAG promoter and neuro-specific promoters (MECP2 and MECP2-intron) were also analyzed, as shown in
STXBP1 is a cytosolic protein interacting with a set of membrane associated proteins. Enlarged images of transfected AD-HEK293 and Neuro-2A show that STXBP1 expressed from these plasmids localizes to the plasma membrane (
Transfected AD-HEK 293 cells were harvested in 1× Cell Lysis Buffer (Cell Signaling Technology™, Danvers, MA, USA) containing 1× Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific™, Waltham, MA, USA) according to the manufacturer's instructions. Lithium dodecyl sulfate (LDS) Sample Buffer supplemented with 10% reducing agent (both Thermo Fisher Scientific™, Waltham, MA, US) were added to the protein lysates to a final concentration of 1×. Samples were resolved by 1 D SDS-PAGE gel electrophoresis. For each sample, 30 μg of proteins were loaded per lane. Proteins were transferred to nitrocellulose membranes (Li-Cor Biosciences™, Lincoln, NE, USA) using a semi-dry transfer apparatus (Bio-Rad Laboratories™, Hercules CA). Following transfer, membranes were incubated in blocking solution (Li-Cor Biosciences™, Lincoln, NE, USA) for 1 hour at room temperature. Membranes were then incubated with blocking solution containing primary antibodies overnight at 4° C. The following primary antibodies were used for this analysis: rabbit polyclonal anti-STXBP1 (MilliporeSigma™, Burlington, MA, USA) at 1:1,000, goat polyclonal anti-STXBP1 (Abnova, Taoyuan, Taiwan) at 1:1,000, rabbit polyclonal anti-c-myc at 1,1000 (MilliporeSigma™, Burlington, MA, USA), rabbit monoclonal anti-HA at 1:1,000 (Cell Signalling Technology™, Danvers, MA, USA), mouse monoclonal anti-GAPDH at 1:1,000 (MilliporeSigma™, Burlington, MA, USA). Membranes were washed three times with PBST solution, placed in blocking solution containing IRDye 680RD donkey anti-goat or IRDye 680RD donkey anti-rabbit secondary antibodies or 800CW donkey anti-mouse (1:15,000; Li-Cor Biosciences™, Lincoln, NE, USA) suitable for detection on the far-red spectrum for 1 hour at room temperature. Proteins were visualized using a Li-Cor Odyssey CLx far red imager (Li-Cor Biosciences™, Lincoln, NE, USA.
The molecular mass of the STXBP1 monomer under reducing conditions is predicted at ˜70 kDa and the protein was detected by western blot as a monomer. Detection of GAPDH was used as a loading control. These results show that robust expression was achieved by various promoters in differentiated Neuro-2A (
These results also show that robust expression was achieved by both the N- and C-terminal tagged constructs driven by the CAG promoter (
The ClinVar database (https://www.ncbi.nlm.nih.gov/clinvar/), a freely accessible, public archive of reports of the relationships among human variations and phenotypes, with supporting evidence, was mined to identify STXBP1 gene variants using search term “STXBP1” and “pathogenic” or “likely pathogenic”. The list of pathogenic variants was 35 complemented with mutations published in scientific peer-reviewed literature and manually curated from a PubMed (https://pubmed.ncbi.nlm.nih.gov/) search using search terms “STXBP1, Munc18, variant, mutation” and defined as pathogenic by the authors to identify additional STXBP1 pathogenic variants not reported in ClinVar.
The pathological variants and likely pathological variants leading to a change in the STXBP1 protein were then identified. (Tables 5 and 6 respectively).
STXBP1 gene variants may include missense mutations, leading to amino acid substitutions. For example, R190Q in Table 5 means that arginine at position 190 with reference to SEQ ID NO: 9 is replaced by glutamine.
Other mutations may also occur. One type of mutation that was identified was a mutation involving the insertion or deletion of nucleotides in which the number of changed base pairs is not divisible by three which leads to the creation of a new amino acid sequence, a frameshift, indicated as “fs”. If the mutation disrupts the correct reading frame, the entire DNA sequence following the mutation will be read incorrectly. For example, E12fs in Table 5 means that glutamic acid at position 12 with reference to SEQ ID NO: 9 is changed due to a frameshift of nucleotides, resulting in an abnormal protein with an incorrect amino acid sequence.
Another type of mutation found in the variants was a mutation at the DNA level which removes one or more amino acid residues in the protein. This type of mutation is indicated as deletion (del) in the Tables. For example, 1539del in Table 5 means that isoleucine at position 539 with reference to SEQ ID NO: 9 is removed.
Other mutations included the introduction of a stop codon, indicated by an asterisk (*), which means that translation of the protein is stopped at this position, resulting in a shortened or truncated protein. For example, Y531* in Table 5 means that the stop mutation occurs in the codon that normally encodes tyrosine 531 with reference to SEQ ID NO: 9, terminating translation of the protein at this position.
Naturally occurring variants in healthy population were derived from gnomAD (The Genome Aggregation Database—https://gnomad.broadinstitute.org/v2.1.1), a publicly available control data-set containing genetic information from 60.146 samples from unrelated individuals using the query term “STXBP1”. The variants extracted from the control dataset include missense, start lost and stop gained variants resulting in amino acid change. The naturally occurring variants resulting in amino acid change are reported in Table 7.
Trans plasmids containing the AAV2 Rep sequences followed by the AAV9.hu14 (hereinafter AAV9) or AAV-true type (hereinafter AAVtt) capsid sequences (according to SEQ ID NO: 17 and 34, respectively) were synthesized de-novo by ATUM™ (Newark, CA, USA). AAV helper plasmid pALD-X80 was purchased from Aldevron, LLC™ (Fargo, ND, USA).
Non-replicating AAV vectors were produced by the triple transfection method. Expi293 cells (Thermo Fisher™, Waltham, MA, USA) were passaged every 3-4 days using Expi293 Expression Media (Thermo Fisher™, Waltham, MA, USA) in shake flasks at a seeding density of 3.0E+05-5.5E+05 cells/mL. The Expi293 cells were cultured on an orbital shaker at 125 rpm in an Eppendorf incubator set at 37° C. with 5% CO2. To set up the production flasks, a 125 mL shake flask was inoculated the day before transfection at 1.5E+05 cells/mL in a total volume of 30-66 mL per viral preparation. Viable cell density was calculated using a Vi-Cell Blu (Beckman Coulter™, Pasadena, CA, USA).
A transfection complex was created for each flask as follows for the production flask with a 30 mL working volume: 180 μL Polyethylenimine (PEI) MAX at 1 mg/mL (Polysciences Inc™, Warrington, PA, USA) was diluted in 1.5 mL OptiPRO serum free media (Thermo Fisher™, Waltham, MA, USA), vortexed at setting 8 four times and incubated for 5 minutes at room temperature. Separately, 20 μg of the Cis plasmid (as indicated in Table 10), 30 μg of the Rep/Cap plasmid (AAV9 or AAVtt), and 40 μg of the helper plasmid (pALD-X80) were diluted in 1.5 mL OptiPRO serum free media, vortexed at setting 8 four times and incubated for 5 minutes at room temperature. These two mixtures were then combined, vortexed at setting 8 four times, and incubated at room temperature for 15 minutes. Transfection complexes were then added to shake flasks containing cells. Cells were cultured with the transfection mixture at 37° C. with constant agitation at 125 rpm.
After 96 hours, flasks were spiked with the concentrated AAV lysis buffer to a final concentration of 1× (150 mM NaCl, 120 mM Tris-HCl [pH=8.0], 2 mM MgCl2, 0.1% Triton X-100), and Benzonase (MilliporeSigma™, Burlington, MA, USA) to a final concentration of 50 U/mL. This mixture was incubated for 1 hour at 37° C. with constant agitation at 125 rpm. The mixture was clarified by centrifugation at 2,880×g for 10 minutes at 23° C. Samples were stored at −80° C. until further analysis.
Each sample was removed from −80° C. and allowed to thaw at room temperature for 15 minutes. Once the sample was thawed, it was briefly vortexed and centrifuged for one minute. After this, 10 μL of sample was added to an individual well of a 96-well PCR plate combined with 10× DNase Buffer, 50 U DNase, and DNase-free water (all from Promega™, Madison, WI, USA) to a total volume of 100 μL in each well.
The plate was then transferred to a Bio-Rad™ (Hercules, CA, USA) thermal cycler and was heated for 30 minutes at 37° C. then cooled to 4° C. Samples were then serially diluted as described in the Table 8.
Five (5) μL of dilutions D2, D3, D4, and D5 were mixed with 20 μL of a ddPCR master mix composed of Supermix for Probes (No dUTP; Bio-Rad™, Hercules, CA, USA), forward primer GATCCAGACATGATAAGATACATTG (SEQ ID NO: 40), reverse primer GCAATAGCATCACAAATTTCAC (SEQ ID NO: 41), Probe 6-Fam/Zen/3′IB FQ: TGGACAAACCACAACTAGAATGCA (SEQ ID NO: 42), and DNase-free water to a final concentration of 1×. This primer set targets SV40 polyA region of the transgene. Each sample was run in duplicate in a 96-well PCR plate.
The plate was heat sealed with a foil covering, pulse vortexed, and centrifuged at 1,000×g for 5 minutes. The plate was placed into the Bio-Rad™ QX-200 droplet generator and droplets were generated per the manufacturer's instructions.
After droplet generation, the plate was heat-sealed with a foil covering and placed into a BioRad™ thermocycler programmed to run the cycle described in Table 9.
Once complete, the plate was placed into a Bio-Rad™ QX200 droplet for droplet reading per the manufacturer's instruction. The concentration of vector genomes (VG/mL) was quantified using the following formula:
VG/ML:X=[(aY)(1000/b)]D, where:
Assay acceptance criteria were defined as follows:
The % CV between the replicates must be ≤15%; if >15% one outlier may be omitted. If an outlier is omitted and the % CV remains >15%, the assay must be repeated. The inter-dilution % CV must be ≤20% and reported dilutions must be at least two consecutive dilutions. If the % CV is >20%, a dilution can be omitted so long the reported dilutions are at least two consecutive dilutions. If the averaged dilutions are still >20%, the assay must be repeated. Each reaction well must have ≥1,000 accepted droplets. If <10,000 droplets, the well will be excluded from analysis.
The viral particle titer was determined by ELISA kits (PROGEN™ Biotechnik GmbH, Heidelberg, Germany) according to the manufacturer's instructions. For AAV9, the mouse monoclonal ADK9 antibody was used for both the capture and detection steps. For AAVtt, the A20R monoclonal antibody was used for both capture and detection steps. Washes in the provided 1× Assay Buffer (ASSB) were performed between each step using a Molecular Devices™ (San Jose, CA, USA) AquaMax 4000 microplate washer. Samples were detected with a Molecular Devices™ SpectraMax M5e plate reader. Capsid titers were interpolated from the standard curve and are reported in Table 10.
The viral genome titers obtained by ddPCR and capsid titers obtained by ELISA indicated that both AAV9 and AAVtt viral particles comprising a viral vector with a nucleic acid comprising an indicated promoter operably-linked to a human STXBP1 transgene could be successfully produced.
A gene edited iPSC-line (EBiSC, Ref: BIONi010-C-13) carrying a DOX-inducible NGN2 expression cassette was used to generate iPSC derived glutamatergic neurons. In this protocol, the NGN2 transcription factor was induced by doxycycline for 9 days to prime neuronal differentiation. At division (DIV) 21, the iPSC derived NGN2 neurons were transduced with serial dilutions of lentiviral vectors expressing human STXBP1 (SEQ ID NO: 9) under the control of the hSyn or MECP2 promoter. The lentiviral vectors were produced in HEK 293 cells using a third-generation system for improved safety. At DIV28, immunocytochemistry (ICC) analysis was performed as follows: cells were fixed with 2% paraformaldehyde and stained with a primary rabbit polyclonal anti-STXBP1 antibody (Sigma, Ref: HPA008209) at a dilution of 1:250. Cells were then stained with a goat anti-rabbit secondary antibody conjugated to Alexa Fluor 568 at a 1:1000 dilution. Imaging was performed with an InCell analyser 6000 instrument using empirical parameters.
Representative ICC images from cells transduced with lentiviral vectors with a multiplicity of infection (MOI) of 2 are shown in
Pictures were taken using the same acquisition setting for all conditions. Comparison of the signal with the non-transduced cells allowed the visualization of the over-expression of STXBP1 in the human iPSCs derived NGN2 neurons. STXBP1 under the control of the hSyn promoter resulted in a higher expression than the MECP2 promoter (summarized in Table 11)
AAV9 vectors were produced as described in Example 4 and capsid characteristics are listed in Table 12. The transgene expressed STXBP1 protein (SEQ ID NO: 9) fused to a HA tag at the N-terminus and expression was driven by the following promoters: hSyn, MECP2 or MECP2-intron. The HA-tagged protein was used to differentiate transgene expression from endogenous STXBP1 levels. An AAV9 capsid with a CAG-eGFP-NLS cassette was used as a control vector for transduction efficiency. STXBP1 expression was investigated in vitro by transducing mouse primary cortical neurons. Non-transduced cells were used as a control for endogenous STXBP1 expression.
Mouse primary cortical neuronal cells were prepared from cortical tissue of E17 mouse embryos. Cortical tissues were dissociated using papain for 30 min at 37° C. and maintained in culture in Neurobasal™ Medium supplemented with B27 supplement 2%, GlutaMAX-I 1 mM and Penicillin-Streptomycin 50 units/ml. Half medium change was performed every week.
At division (DIV) 7, cells were transduced with the different AAV9 constructs at two different MOIs (2.5E+6 GC/cell and 5.0E+5 GC/cell). The level of transduction was confirmed by including the hSyn-eGFP-NLS construct which was high in both MOI conditions. At DIV13, cells were fixed with 2% paraformaldehyde and stained with the primary rabbit polyclonal anti-STXBP1 antibody (1:250; Sigma, Ref: HPA008209) and by anti-HA tag staining (1:100; Ref: 2367S, Cell Signaling Technology). Imaging was performed with an InCell analyser 6000 instrument using empirical parameters.
Using similar acquisition parameters we confirmed increased STXBP1 expression levels for all three promoters when compared to non-transduced cells (
To demonstrate that STXBP1 transduction was specific to neuronal cells we counter-stained the mouse primary cultures with an antibody directed against the pan neuronal marker MAP2 (1:5000; Ref: ab5392; Abcam™, Cambridge, MA, USA).
AAV9 mediated transduction of STXBP1 in mouse brain was investigated in vivo. Viral vectors were administrated by bilateral intracerebroventricular (ICV) injection into the brain of post-natal 1 day old neonatal mice (PND1). The methodology for ICV neonatal injections has been previously described (Bertrand-Mathon, et al. 2015; Kim, et al. 2014; Hamodi, et al. 2020). Injected animals were monitored for a period of 5 weeks and the expression and distribution of STXBP1 was analyzed by biochemical readouts on brain tissues.
Experiments included 5 groups: Control (vehicle injected), Control virus (AAV9/hSyn_eGFP), AAV9/hSyn-HA-STXBP1, AAV9/MECP2-HA-STXBP1 and AAV9/MECP2-intron-HA-STXBP1. AAV9 vectors were the same as described in Table 12. A summary of the in vivo experimental conditions is shown in Table 15.
Body weight differences were monitored over the course of the study (5 weeks post-injection) to assess the overall health of the mice. There were no significant differences in the body weights of the different cassette groups at the time of the last assessment. None of the groups showed any clinical signs of toxicity. Additionally, there were no obvious signs of morbidity or delays in development in adult wild-type mice treated with AAV9/hSyn-HA-STXBP1, AAV9/MECP2-HA-STXBP1 or AAV9/MECP2-intron-HA-STXBP1. The results of this experiment demonstrated that the viral vector cassettes exhibited long-term tolerance and low toxicity and therefore can be safely used in a pre-clinical setting.
At 5 weeks post-injection, brain tissues were collected, dissected and submitted for biochemical analysis. DNA/RNA was extracted from left frontal cortex and hippocampus, while proteins were extracted from matching right frontal cortex. DNA/RNA extraction was performed using the AllPrep mini kit (Qiagen, 80204) following manufacturer instructions and including a DNAse treatment for the RNA extraction. The tissues were lysed in RLT Plus buffer (supplemented with α-mercaptoethanol) using the Precellys 24 instrument (Bertin Technologies). The DNA concentration was measured and adjusted to 20 ng/μl for all samples. Then, 40 ng were submitted to qPCR using primers/probe specific for the SV40 polyA signal (present in all the AAV cassettes). The amount of mouse genomes was analyzed using the ValidPrime® kit (tataabiocenter, A106P25). The ValidPrime® sequence is specific to a non-transcribed locus of gDNA that is present in exactly one copy per haploid normal genome. For both qPCR, copy numbers were determined using the standard curve method. The RNA concentration was measured, and 500 ng of RNA were submitted to RT using the kit High Capacity cDNA RT Kit+RNase Inhibitor (Applied Biosystems cat n° 4374966). The obtained cDNAs were submitted to the human STXBP1 signal qPCR, as well as two reference genes for normalization of the results obtained. Relative expression was determined and scaled to the average value for all groups. For the protein extraction, tissues were lysed in RIPA buffer (Pierce, 89900) including 2× concentrated Protease and phosphatase inhibitors cocktail (Cell Signaling Technology, #5872) using the Precellys 24 instrument (Bertin Technologies) and cooling system. The samples were left on ice for 30 min, centrifuged and the supernatant was collected as the final protein extract. Protein concentration was determined using the BCA Protein Assay Kit (Pierce, 23227) and 7.5 μg of protein was mixed with Laemli buffer and β-mercaptoethanol and incubated at 90° C. for 10 minutes prior to SDS-Page. Gels were transferred to nitrocellulose membranes and analysed by Western blot. Membranes were incubated in blocking solution (Ref: 927-50000; Li-Cor) for 1 hour at 4° C. followed by incubation with the primary antibodies mouse monoclonal anti-HA (1:2000; Ref: 2367S, Cell Signaling Technology) and mouse monoclonal anti GAPDH (1:10000; Ref: G8795, Sigma). The secondary antibodies used were IRDye® 680RD Donkey anti-Mouse IgG Secondary Antibody (1:20000; Ref: 926-68072, Li-Cor) and IRDye® 800CW Donkey anti-Rabbit IgG Secondary Antibody (1:20000; Ref: 926-32213, Li-Cor).
As illustrated in
The distribution of STXBP1 expression in the mouse brain following PND1 injection of AAV9 vectors was investigated by immunohistochemistry (IHC). Mouse brain tissues were collected from the same animals as described in Example 7.
Fixed frozen sections (12 μm thickness; sagittal sections) were generated with a cryostat-microtome and stored at −80° C. All of the following incubation steps were carried out at room temperature. The cryosections were rinsed 10 min in PBS 1×, and then incubated with the following primary antibodies: GFP (1:2,000; #1020, Aves), HA (hemagglutinin tag; 1:5,000; #3724, Cell Signaling), NeuN (1:2,000; ab177487, Abcam), GFAP (1:2,000; #173006, Synaptic Systems), parvalbumin (1:500; PV235, Swant), alone or in combination for double immunofluorescence, diluted in PBS containing 0.3% Triton X-100, overnight in a humidified chamber. Following incubation, the sections were washed 3 times with PBS, then incubated for 1 hour with the appropriate Alexa-conjugated secondary antibodies (anti-mouse, rabbit, chicken, conjugated to Alexa 488 or 647). Then, they were counterstained with DAPI (300 nM dilution) to label cell nuclei, and washed 3 times with PBS. The sections were finally mounted with Prolong Gold antifade mounting media (Life Technologies) and a coverslip was applied. Digital images of stained sections were obtained using an AxioScan Z1 slide scanner with a 20× objective (Zeiss) and analyzed using Zen 3 software (Zeiss). To study the distribution of transduced cells in the brain expressing a transgene from a neuronal promoter, mouse pups were injected icv with AAV9/hSyn_eGFP at PND1. The animals were sacrificed 1 month after virus administration and the brains were dissected out and processed for immunohistochemistry to label GFP.
Overall, GFP+ cells were observed throughout the entire brain from the olfactory bulbs to the cerebellum and brainstem (
The tissue distribution of HA-tagged STXBP1 overexpressed from 3 different neuronal promoters, hSyn, MECP2 or MECP2-intron, was analyzed by performing immunohistochemistry against HA (
To evaluate the expression of STXBP1 protein variants in normal and disease conditions, a transgenic mouse model that recapitulates human STXBP1 haploinsufficiency-mediated epilepsy was generated and that has been described by Kovacevic et al. (2018). This mouse model was acquired through a license from the University of Amsterdam. The heterozygous model was generated with Stxbp1 floxed (Stxbp1fl/fl) mice with loxP sites on either side of exon 2 in the Stxbp1 gene. Stxbp1fl/fl were crossed to Ella-Cre (Jax: 003724) to delete Stxbp1 exon 2 in germ line resulting in Stxbp1fl/− null mutant mice. The floxed allele has been outbred to C57BL/6J generating the Stxbp1+/− KO HET mouse strain. Deletion of exon 2 in one allele leads to a premature stop codon and results in expression of a truncated and non-functional STXBP1 protein. All in vivo experiments were conducted in compliance with guidelines issued by the ethics committee for animal experimentation according to Belgian law. The experiments were performed in accordance with the European Committee Council directive (2010/63/EU). All efforts were made to minimize animal suffering.
To evaluate the endogenous STXBP1 variants expression, heterozygous KO (STXBP1+/−) and wildtype (WT) littermate (STXBP1+/+) male mice were sacrificed 5-7 weeks post-natal and the brain tissues were collected, dissected and analyzed by biochemical readouts. RNA was extracted from caudal cortex (right hemisphere) while protein was extracted from matching right frontal (medial) cortex for Western Blot (WB) analysis and from lateral half of the frontal cortex for Liquid Chromatography Mass Spectrometry (LC-MS) analysis.
For RNA extraction, the samples were transferred into Precellys tubes containing RLT Plus lysis buffer (with 10 μl/ml of β-mercaptoethanol) (Precellys Lysing Kit CK14 −2 ml (VWR, 432-3751)). DNAse treatment was performed for the RNA. The RNA extraction was performed on KingFisher Flex (ThermoFisher), using Mag-Bind Total RNA 96 kit (Omega, M6731). The RNA concentration was measured with Nanodrop, and 500 ng of RNA were submitted to reverse transcription using the kit High Capacity cDNA RT Kit+RNase Inhibitor (catalog n° 4374966, ThermoFisher). Subsequently, the cDNA obtained was analyzed by qPCR, in triplicates, using commercially available and custom-made primers and probes, mouse STXBP1 and mouse and human STXBP1-long and mouse and human STXBP1-short isoforms, as well as two reference genes. mRNA expression level was obtained by calculating the 2−ΔCt value, where the expression of each gene was normalized to the average of the two reference genes.
For protein extraction, the tissue was lysed in RIPA buffer (Sigma R0278) containing 2× Protease and phosphatase inhibitors cocktail (Cell Signaling Technology #5872) using the Precellys 24 instrument (Bertin Technologies) and cooling system. The samples were left on ice for 30 min, centrifuged and the supernatant was collected as the final protein extract. Protein concentration was determined using the BCA Protein Assay (Thermo Scientific™) and 10 μg of protein were mixed with Laemmli buffer and β-mercaptoethanol and incubated at 90° C. for 10 minutes prior to SDS-Page. Gels were transferred to nitrocellulose membranes and then submitted to standard Western Blot procedure. First, membranes were incubated in blocking solution (Ref: 927-50000; Li-Cor) for 1 hour at RT. The following primary antibodies were incubated overnight at 4° C.: goat polyclonal anti-STXBP1 (1:1000, Ref:PAB6504, Abnova) rabbit polyclonal anti-STXBP1 (1:1000, Ref:116002, SySy), rabbit polyclonal anti-STXBP1 (1:1000, Ref:HPA008209, Sigma), mouse monoclonal anti-Syntaxin-1A (1:2500, Ref:110111, SySy), mouse monoclonal anti-β-Actin (1:10000, A2228, Sigma) and rabbit monoclonal anti-β-Actin (1:10000, 8457P, Cell Signaling Technology). The secondary antibodies were incubated 1 h at RT, and the following were used: IRDye® 680RD donkey anti-mouse IgG secondary antibody (1:20000; Ref: 926-68072, Li-Cor), IRDye® 800CW donkey anti-rabbit IgG secondary antibody (1:20000; Ref: 926-32213, Li-Cor) and IRDye® 800CW donkey anti-goat IgG secondary antibody (1:20000; Ref: 926-32214, Li-Cor).
For LC-MS analysis, the tissue samples were homogenized in 5% SDS/50 mM TEAB/1× protease inhibitor using a Precellys tissue homogenizer (Bertin-Instruments). After, protein concentration was determined by BCA (Pierce, A53227), 100 μg of each sample was reduced and alkylated. Sample clean up and digestion were performed on a 96 well-plate S-Trap per manufacturer instructions (Protifi Llc, Huntington, NY) and using Trypsin/Lys-C (Promega, V5072). Digested samples were eluted from the plate and dried down under vacuum, before resuspension for LC-MS analysis. The resuspension buffer contained heavy labelled AQUA peptides (Thermo, Paisley, UK) at 50 fmol/μl in 0.1% formic acid in water. For the total lysate samples, STXBP1 peptides were measured using a Waters Acquity UPLC M-Class with an IonKey source, connected to a Waters Xevo TQ-XS. Peptides were trapped on a Waters nanoEase M/Z Sym100 C18 column (5 μm, 300 μm×25 mm) and separated on a Waters Peptide BEH C18 iKey (150 μm×100 mm, 130 1.7 μm). A 17 min gradient was applied at a flow rate of 3 μl/min, with mobile phase A (0.1% formic acid/100% H2O) and mobile phase B (0.1% formic acid/100% acetonitrile). The gradient used was: 1.0% B for 0 to 1 min, 1.0-25% B from 1 to 3 min, 25-40% B from 3 to 6 min, 40-99% B from 6 to 9 min, 99-1% B from 12 to 13 min. Column temperature was set at 50° C. A scheduled Multiple Reaction Monitoring (MRM) method was used with the source parameters as follows: capillary voltage—3.8 kV, source temperature—150° C., cone gas—150 L/hr, nebulizer gas—5.3 bar. NanoFlow gas—0.3 bar. For all analyses the peptides monitored were: DNALLAQLIQDK (SEQ ID NO: 43), YETSGIGEAR (SEQ ID NO: 44), ISEQTYQLSR (SEQ ID NO: 45), WEVLIGSTHILTPTK (SEQ ID NO: 46) (long isoform specific), and WEVLIGSTHILTPQK (SEQ ID NO: 47) (short isoform specific). Three transitions per peptide were monitored. Data analysis was performed in Skyline (MacLean et al., 2010). Each analysis included an 8-point standard curve and QC samples (low, mid, high, n=2). These consisted of blank, pooled mouse liver homogenate spiked with purified HA-tagged STXBP1 protein prepared from recombinant expression in E. coli. Endogenous QC samples consisting of pooled mouse brain membrane homogenate (blank and spiked with additional STXBP1) were also included. Quantification of the total protein and short isoform was performed against this standard curve. Relative quantitation of the isoform specific peptides was performed against their respective internal standard.
The results of RNA transcript analysis in WT and heterozygous (+/−) KO mice (referred as HET in the figures) are shown in
The quantification of STXBP1 protein isoforms by LC-MS (
STXBP1 has been reported to act as a chaperone for the syntaxin-1A protein (STX1A), ensuring the trafficking, docking and release of synaptic vesicles (Dulubova I. et al. 2007, Saitsu H. et al. 2008). As illustrated in
Altogether the data provides for the first time an extensive characterization of the STXBP1 isoforms expression levels in mouse brain and the validation of the reduction of endogenous STXBP1 variant mRNA and protein levels in the transgenic mouse model that recapitulates human STXBP1 haploinsufficiency.
Viral vectors were administrated by bilateral intracerebroventricular (ICV) injection into the brain of post-natal 1 day old neonatal mice (PND1) as described in Example 7. The methodology for ICV neonatal injections has been previously described (Bertrand-Mathon, et al. 2015; Kim, et al. 2014; Hamodi, et al. 2020). Injected animals were monitored for a period of 7 weeks and the expression and distribution of STXBP1 was analyzed by biochemical readouts on brain tissues. Experiments included the following groups:
One additional group of WT and HET mice were injected with vehicle-PBS to be used as control. A summary of the in vivo experimental conditions is shown in Table 18.
At 7 weeks post-injection, brain tissues were collected, dissected and submitted for biochemical analysis. DNA/RNA were extracted from caudal cortex (right hemisphere) while proteins were extracted from matching right frontal (medial) cortex. The DNA and RNA were both extracted with the same lysis buffer composition, as described in Example 7. Proteinase K and RNase treatment were performed for the DNA. DNA was extracted using Mag-Bind™ HDQ Blood DNA & Tissue 96 Kit (Omega, M6399). The DNA concentration was measured using Qubit™ Flex Fluorometer (ThermoFisher) with Qubit™ dsDNA BR Assay Kit (ThermoFisher, Q32853), and the same total DNA amount was adjusted for all samples, being used 40 ng for qPCR with primers/probe specific for the SV40 20 polyA signal (present in all the AAV cassettes). The amount of mouse genomes was analyzed using the ValidPrime® kit (tataabiocenter, A106P25). The ValidPrime® sequence is specific to a non-transcribed locus of gDNA that is present in exactly one copy per haploid normal genome. For both SV40p and ValidPrime®, absolute copy numbers were determined using the standard curve method.
RNA extraction steps and conversion into cDNA are described in Example 7. The cDNA obtained was analyzed by qPCR, in triplicates, using commercially available and custom-made primers and probes, such as SV40 polyA, human STXBP1, mouse STXBP1, mouse STX1A, mouse and human STXBP1-long isoform and mouse and human STXBP1-short isoform, as well as two reference genes. mRNA expression level was obtained by calculating the 2−ΔCt value, where the expression of each gene was normalized to the average of the two reference genes. The protein extraction and Western Blot analyses were performed as described in Example 7.
As illustrated in
AAV9 transduction of HET animals resulted in a robust and selective over-expression of the short and the long STXBP1 variants without affecting endogenous mouse variant expression levels (
Western Blot analysis confirmed a significant overexpression of total STXBP1 levels in both AAV treated groups, when compared to HET mice injected with vehicle-PBS, as illustrated in
Overall, HET animals treated with either the short or the long variant showed efficient overexpression of the human STXBP1 transgene product and resulted in a similar rescue of STXBP1 haploinsufficiency in this mouse model.
The distribution of STXBP1 transgene product expression in the mouse brain following PND1 injection of AAV9 vector was investigated by immunohistochemistry (IHC), using an additional animal group injected with a viral cassette encoding an HA-tagged fusion with the STXBP1 long variant (as described in Example 7). Fixed frozen sections (12 μm thickness; sagittal sections) were generated with a cryostat-microtome and stored at −80° C. The staining procedure and detection method were as described in Example 8.
As illustrated in
To evaluate the efficacy of AAV vectors in normal and disease conditions, a transgenic mouse model that recapitulates human STXBP1 haploinsufficiency-mediated epilepsy was generated and that has been described by Kovacevic et al. (2018). This mouse model was acquired through a license from the University of Amsterdam. The heterozygous model was generated with Stxbp1 floxed (Stxbp1fl/fl) mice with loxP sites on either side of exon 2 in the Stxbp1 gene. Stxbp1fl/fl were crossed to Ella-Cre (Jax: 003724) to delete Stxbp1 exon 2 in germ line resulting in Stxbp1fl/−null mutant mice. The floxed allele has been outbred to C57BL/6J generating the Stxbp1+/−KO HET mouse strain. Deletion of exon 2 in one allele leads to a premature stop codon and results in expression of a truncated and non-functional STXBP1 protein. All in vivo experiments were conducted in compliance with guidelines issued by the ethics committee for animal experimentation according to Belgian law. The experiments were performed in accordance with the European Committee Council directive (2010/63/EU). All efforts were made to minimize animal suffering.
Heterozygous (HET) KO and wildtype littermate (WT) male mice were bilaterally injected into lateral ventricle with one of two viral vectors encoding the long or the short STXBP1 variants (see Table 17) at postnatal day 1. Experimental conditions are summarized in Table 18. One additional group of mice from each genotype were injected with vehicle-PBS to be used as control. Clinical signs were monitored once a week over the course of the 3 weeks post-injection and daily from week 3 to 7 post-injection in order to assess the overall health status of the mice. Limited mortality across groups related to methodological procedures and aggressive behavior was observed but it was not treatment or genotype related.
Six weeks after injections, in vivo wireless EEG (electroencephalogram) video-telemetry recordings were performed for 1 week to evaluate seizure occurrence. STXBP1+/− mice were surgically implanted with subcutaneous telemetry transmitter and cortical EEG electrodes 5 weeks after injections. Surgery was performed under sterile/aseptic conditions. Anaesthetized mice (isoflurane in oxygen-induction: 5% at 2 l/min, maintenance 2.5-1.5% at 1.5 l/min) were placed in a stereotaxic frame with heating pad, holes were drilled on the skull surface of the prefrontal cortex (over bregma) for the recording electrode and on the skull surface of the cerebellum (behind the lambda) for the reference electrode. Thereafter, an Open Source Instruments (OSI) A3028S2 ECoG transmitter was implanted subcutaneously over the dorsum with the attached wires extending subcutaneously up to the cranium where the recording and reference electrodes were positioned through each hole approximately 0.5 mm into the brain parenchyma. Each electrode was secured in place with a screw (Plastics One). The whole assembly was held in place with cyanoacrylate and dental cement forming a small, circular headpiece and the dorsum was closed with nylon absorbable suture material. Post-operative medication and pain management included a second Carprofen dose (10 mg/kg) 24 hours following the pre-surgery dose. After the surgery, mice were recovering in warm-chamber for 2-3 h. For in vivo wireless EEG video-telemetry recordings, mice were group housed (2-3 mice/cage). Mice cages were placed in Faraday enclosures to facilitate recordings. Welfare monitoring of implanted mice was conducted once per day for 2 weeks. Mice were weighed daily for 4 days, thereafter weekly. All recordings were carried in a purposely designed recording room with temperature and humidity control in order to decrease ambient interference and improve the reception of the transmitting signals. Signals were radio transmitted from the implanted transmitter to the antennas placed inside the Faraday enclosures. EEG signal from one recording channel was digitized at 256 Hz (Band-pass filter: 0.3-80 Hz). Spike wave discharges (SWDs), typical of absence seizures, were analysed with an in-house automated seizure detection software. SWDs detection algorithm was based on event duration analysis (>2 s), band frequency analysis (5-9 Hz) and identification of specific fundamental harmonic frequencies. Each SWD detected by the algorithm was confirmed by at least one experienced observer in a blinded fashion. Consequently, EEG analysis was performed during this period for the different cassette vector and vehicle groups. A total of 4 animals were excluded from the analysis due to the occurrence of technical artefacts in the EEG signal in the vector treated groups: (AAV9-MECP2+INTRON-hSTXBP1 (Long Variant) (2 out of 17), and AAV9-MECP2+INTRON-hSTXBP1 (Short Variant) (2 out of 18).
As illustrated in
The difference between groups for SWD frequency was analyzed by non-parametric one-way ANOVA followed by a post hoc multiple comparisons test (****p<0.0001) and for Seizure free analysis a chi-square contingency test was used.
Furthermore, biochemical and histopathological analysis was performed on the brain and organs tissues from the animals injected with the different groups. For transgene expression evaluation, mice were sacrificed 7 weeks post injection following the same methodology as described in Example 7. Caudal cortex was collected and subjected to DNA/RNA extraction and matching half medial frontal cortex was used for protein extraction using the same methodology described in Example 7.
A longitudinal 6 months study was performed in a separate group of animals to measure the persistence of effects of SXTBP1 gene therapy treatment using the same experimental design. Twenty four weeks after injections, in vivo wireless EEG (electroencephalogram) video-telemetry recordings were performed for 1 week to evaluate seizure occurrence. As illustrated in
To evaluate the efficacy of AAV mediated gene therapy on different behavioral disease phenotypes in heterozygous STXBP1 KO (HET) male mice and their sex- and age-matched wildtype (WT) littermates, viral vectors encoding the long or short variant of human STXBP1 under the control of the Mecp2_intron promoter (see Table 17) were bilaterally injected into lateral ventricle. These groups of animals were separate to the ones used in Example 11.
Treated animals were subjected to a battery of behavioral tests from 4 weeks to 22 weeks of age. One additional group of mice from each genotype was injected with vehicle-PBS to be used as control. All behavioral experiments were conducted in compliance with guidelines issued by the ethics committee for animal experimentation according to Belgian law. The experiments were performed in accordance with the European Committee Council directive (2010/63/EU). All efforts were made to minimize animal suffering.
Animal body weight was followed weekly from 1 to 22 weeks after injections. As indicated in
Hindlimb clasping (Guyenet et al., 2010) was recorded once a week from 4 to 10 weeks old and once every 3 weeks from 10 to 22 weeks old. Mice were suspended by their tail and the position of the hindlimbs was observed for 10 s. If the hindlimbs were consistently splayed outward, away from the abdomen, it was assigned a score of 0. If one hindlimb was retracted toward the abdomen for more than 50% of the time suspended, it received a score of 1. If both hindlimbs were partially retracted toward the abdomen for more than 50% of the time suspended, it received a score of 2. If its hindlimbs were entirely retracted and touching the abdomen for more than 50% of the time suspended, it received a score of 3. Each mouse was observed three times and the average score value was used for statistical analysis.
Eight weeks after AAV treatment mice were subjected to the four-limb wire hanging test (Klein et al., 2012) to evaluate the muscle strength. Mice were placed on a wire mesh, which was then inverted and waved gently, so that the mouse gripped the wire. Latency to fall was recorded, with a 90 s cut-off time. As shown in the
Ten weeks following AVV treatment a Pavlovian fear conditioning paradigm (Curzon et al., 2009) was used to evaluate associative learning and memory, in which a mouse learns to associate a specific environment (i.e. the context) and a sound (i.e. the cue) with electric foot shocks. The fear memory is manifested by the mouse freezing, then it is subsequently exposed to this specific context or cue without electric shocks. The fear conditioning test was conducted in a chamber that has a grid floor for delivering electrical shocks (Ugo Basile). A camera above the chamber was used to monitor the mouse. During a 6 min training phase, a mouse was placed in the chamber (114-116 lux light intensity, one grey wall, grid floor visible) for 2 min habituation period to evaluate baseline freezing, and then a sound (78-80 dB, 4 kHz) was turned on for 30 s immediately followed by a mild foot shock (2 s, 0.5 mA). The same sound-foot shock association were repeated two more times after the first one with an interval time of 1 min. After the training phase, the mouse returned to its home cage. After 24 h, the mouse was tested for the contextual fear memory. For that, the mouse was placed in the same training chamber and its freezing behavior was monitored for 5 min without any sound or foot shock stimuli. The mouse was then returned to its home cage. One hour later, the mouse was transferred to the chamber after it had been altered with 3 checkered walls, no metal grid visible, white ground floor and 14-16 lux light intensity to create a new context for the cued fear memory test. After 2 min habituation period in the chamber to measure baseline freezing, the same sound cue that was used in the training phase was turned on four times for 30 s without foot shocks while the freezing behavior was monitored during a trial time of 7.5 min. The freezing time was determined using an automated video-based system using Ethovision software (Noldus).
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/EP2022/080020 | 10/26/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63263175 | Oct 2021 | US |
