Patent Application
20240150761
In some embodiments, genome editing tools are provided comprising guide RNA (gRNA) comprising an internal linker as described herein. The present application stems from the findings that a non-nucleic acid linker can replace certain inner portions of the guide RNAs that have non-essential contacts with Cas nuclease. The substitutions described herein may facilitate synthesis of the gRNA with greater yield or homogeneity; or may improve the stability of the gRNA and its corresponding nuclease, e.g., the gRNA/Cas complex and improve the activity of a Cas9 (e.g., SauCas9, SpyCas9, CdiCas9, St1Cas9, SthCas9, AceCas9, CjeCas9, RpaCas9, RruCas9, AnaCas9, NmeCas9), Cas12 (e.g., AsCas12a, LbCpf1), or Cas13 (e.g., EsCas13d) to modify target DNA.
In some embodiments, a single-guide RNA (sgRNA) with one or more substitutions to include one or more internal linkers as described herein are provided.
In some embodiments, crisprRNA (crRNA) or tracrRNA (trRNA) with one or more substitutions to include one or more internal linkers as described herein are provided. In some embodiments, the modified crRNA or modified trRNA comprise a dual guide RNA (dgRNA). In some embodiments, the modified crRNA or modified trRNA comprise a single guide RNA (sgRNA). The substitutions with one or more internal linkers as described herein may facilitate synthesis of the gRNA with greater yield or homogeneity; or may improve the stability of the gRNA and its corresponding nuclease, e.g., the gRNA/Cas complex, e.g., the gRNA/Cas9 complex and improve the activity of the nuclease, e.g., a Cas9 nuclease (e.g., SauCas9, SpyCas9) e.g., to cleave or nick the target DNA. Compared to guides comprised of all nucleotides, e.g., 100mer Spy Cas 9 sgRNAs or other short guide Spy Cas9 RNAs, synthesis of the presently disclosed guide RNAs may increase crude yield of a guide RNA. Similarly, gRNA sample purity as measured by the proportion of full-length product, e.g. crude purity, can be increased. gRNA can be obtained in greater yield, or compositions comprising the gRNA can have greater homogeneity or fewer incomplete or erroneous products. Guide RNA purity may be assessed using ion-pair reversed-phase high performance liquid chromatography (IP-RP-HPLC) and ion exchange HPLC methods, e.g. as in Kanavarioti et al, Sci Rep 9, 1019 (2019) (doi:10.1038/s41598-018-37642-z). Using UV spectroscopy at a wavelength of 260 nm, crude purity and final purity can be determined by the ratio of absorbance of the main peak to the cumulative absorbance of all peaks in the chromatogram. Synthetic yield is determined as the ratio of the absorbance at 260 nm of the final sample compared to the theoretical absorbance of input materials.
The Following Embodiments are Encompassed.
In some embodiments, a guide RNA (gRNA) comprising an internal linker is provided. In some embodiments, the internal linker substitutes for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 3-30, optionally 12-21 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 6-18 atoms, optionally about 6-12 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker substitutes for 2-12 nucleotides.
In some embodiments, the internal linker is in a repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for at least 4 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for up to 28 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the repeat-anti-repeat region of the gRNA.
In some embodiments, the internal linker is in a hairpin region of the gRNA. In some embodiments, the internal linker substitutes for at least 2 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for up to 22 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 1, 2, 3, 4, 5, 6, 7, 8, or 9 base pairs of the hairpin region of the gRNA.
In some embodiments, the internal linker is in a nexus region of the gRNA. In some embodiments, the internal linker substitutes for 1 or 2 nucleotides of the nexus region of the gRNA.
In some embodiments, the internal linker is in a hairpin between a first portion of the gRNA and a second portion of the gRNA, wherein the first portion and the second portion together form a duplex portion. In some embodiments, the internal linker bridges a first portion of a duplex and a second portion of a duplex, wherein the duplex comprises 2-10 base pairs.
In some embodiments, the gRNA comprises two internal linkers. In some embodiments, the gRNA comprises three internal linkers.
In some embodiments, a single-guide RNA (sgRNA) is provided, the sgRNA comprising a guide region and a conserved portion at 3′ to the guide region, wherein the conserved portion comprises a repeat-anti-repeat region, a nexus region, a hairpin 1 region, and a hairpin 2 region, and comprises at least one of
In some embodiments, a single-guide RNA (sgRNA) is provided, the sgRNA comprising a guide region and a conserved portion at the 3′ to the guide region, wherein conserved portion comprises a repeat-anti-repeat region, a hairpin 1 region, and a hairpin 2 region, and further comprises at least one of:
In some embodiments, a guide RNA (gRNA) is provided, the gRNA comprising a guide region and a conserved portion 3′ to the guide region, wherein the conserved portion comprises a repeat-anti-repeat region, a hairpin 1 region, and a hairpin 2 region, and comprises a first internal linker substituting for at least 2 nucleotides of the repeat-anti-repeat region and a second internal linker substituting for at least 2 nucleotides of the hairpin 2.
In some embodiments, a guide RNA (gRNA) is provided, the gRNA comprising a guide region and a conserved portion 3′ to the guide region, wherein the conserved portion comprises a repeat-anti-repeat region and a hairpin region, and comprises an internal linker substituting for at least 2 nucleotides of the repeat-anti-repeat region.
In some embodiments, a guide RNA (gRNA) is provided, the gRNA comprising a repeat-anti-repeat region, and an internal linker substituting for at least 2 nucleotides of the repeat-anti-repeat region.
In some embodiments, the internal linker comprises at least two ethylene glycol subunits covalently linked to each other.
The following is a non-exhaustive listing of embodiments provided herein.
˜-L0-L1-L2-# (I)
Provided herein are guide RNAs (gRNAs) comprising an internal linker for use in gene editing methods. Examples of sequences of engineered and tested gRNAs are shown in Tables 2A-2B.
Certain of the gRNAs provided herein are dual guide RNAs (dgRNAs) comprising an internal linker for use in gene editing methods.
Certain of the gRNAs provided herein are single guide RNAs (sgRNAs) comprising an internal linker for use in gene editing methods.
This disclosure further provides uses of these gRNAs (e.g., sgRNA, dgRNA, or crRNA) to alter the genome of a target nucleic acid in vitro (e.g., cells cultured in vitro for use in ex vivo therapy or other uses of genetically edited cells) or in a cell in a subject such as a human (e.g., for use in in vivo therapy).
sgRNA designations are sometimes provided with one or more leading zeroes immediately following the G. This does not affect the meaning of the designation. Thus, for example, G000282, G0282, G00282, and G282 refer to the same sgRNA. Similarly, crRNA and or trRNA designations are sometimes provided with one or more leading zeroes immediately following the CR or TR, respectively, which does not affect the meaning of the designation. Thus, for example, CR000100, CR00100, CR0100, and CR100 refer to the same crRNA, and TR000200, TR00200, TR0200, and TR200 refer to the same trRNA.
The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.
The term “including” is used herein to mean, and is used interchangeably with, the phrase “including but not limited to”.
The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise. For example, “sense strand or antisense strand” is understood as “sense strand or antisense strand or sense strand and antisense strand.”
The term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%, +2%, or +1%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 17 nucleotides of a 20 nucleotide nucleic acid molecule” means that 17, 18, 19, or 20 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.
As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex region of “no more than 2 nucleotide base pairs” has a 2, 1, or 0 nucleotide base pairs. When “no more than” or “less than” is present before a series of numbers or a range, it is understood that each of the numbers in the series or range is modified.
As used herein, ranges include both the upper and lower limit.
As used herein, it is understood that when the maximum amount of a value is represented by 100% (e.g., 100% inhibition) that the value is limited by the method of detection. For example, 100% inhibition is understood as inhibition to a level below the level of detection of the assay.
“Editing efficiency” or “editing percentage” or “percent editing” as used herein is the total number of sequence reads with insertions, deletions, or base changes of nucleotides into the target region of interest over the total number of sequence reads following cleavage or nicking by a Cas RNP.
“Regions” as used herein describes portions of nucleic acids. Regions may also be referred to as “modules” or “domains.” Regions of an sgRNA may perform particular functions, e.g., in directing endonuclease activity of the RNP, for example as described in Briner A E et al., Molecular Cell 56:333-339 (2014), or have predicted structures. Exemplary regions of an sgRNA are described in Table 3.
“Hairpin” or “hairpin structure” as used herein describes a duplex of nucleic acids that is created when a nucleic acid strand folds and forms base pairs with another section of the same strand. A hairpin may form a structure that comprises a loop or a U-shape. In some embodiments, a hairpin may be comprised of an RNA loop. Hairpins can be formed with two complementary sequences in a single nucleic acid molecule bind together, with a folding or wrinkling of the molecule. In some embodiments, hairpins comprise stem or stem loop structures. In some embodiments, a hairpin comprises a loop and a stem. As used herein, when two hairpins are present in a gRNA, a “hairpin region” can refer to hairpin 1 and hairpin 2 and the intervening sequence (e.g., “n”) between hairpin 1 and hairpin 2 of a conserved portion of an sgRNA.
As used herein, “form a duplex portion” is understood as being capable of forming an uninterrupted duplex portion or predicted to form an uninterrupted duplex portion, e.g., by base pairing. A duplex portion may comprise two complementary sequences, e.g., a first hairpin stem region and a second hairpin stem region complementary to the first. As used herein, a duplex portion has a length of at least 2 base pairs. A duplex portion optionally comprises 2-10 base pairs, and the two strands that form the duplex portion may be joined, for example, by a nucleotide loop. Base pairing in a duplex can include Watson-Crick base pairing, optionally in combination with base stacking. As used herein, a duplex portion can include a single nucleotide discontinuity on one strand wherein each contiguous nucleotide on one strand is based paired with a nucleotide on the complementary strand which may have a discontinuity of one non-base paired nucleotide, e.g., as in nucleotide 96 of SEQ ID NO: 500 in hairpin 1, wherein the discontinuity is flanked immediately 5′ and 3′ with Watson-Crick base pairs. This is distinct from non-paired nucleotides 36 and 65 in the repeat-anti-repeat region, and non-paired nucleotides 106-108 and 139 in hairpin 2, which constitute a discontinuity resulting in two duplex portions, as defined herein. RNA structures are well known in the art and tools are available for structural prediction of RNAs (see, e.g., Sato et al., Nature Comm. 12:941 (2021); RNAstructure at ma.urmc.rochester.edu/RNAstructureWeb/Servers/Predict1/Predicti.html and RNAfold WebServer at rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi). Bridging lengths and structural flexibility required to permit a fold and form a loop to allow nucleobases to come into sufficiently close proximity to base pair are well known in the art.
As used herein, an “RNA-guided DNA binding agent” means a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the sequence of the RNA. Exemplary RNA-guided DNA binding agents include Cas cleavases (which have double strand cleaving activity), Cas nickases (which have single strand cleaving activity), and inactivated forms thereof (“dCas DNA binding agents”). “Cas nuclease”, as used herein, encompasses Cas cleavases, Cas nickases, and dCas DNA binding agents. The dCas DNA binding agent may be a dead nuclease comprising non-functional nuclease domains (RuvC or HNH domain). In some embodiments the Cas cleavase or Cas nickase encompasses a dCas DNA binding agent modified to permit DNA cleavage, e.g., via fusion with a FokI domain. In some embodiments, the RNA-guided DNA binding agent has nuclease activity, e.g., cleavase or nickase activity.
“Ribonucleoprotein” (RNP) or “RNP complex” as used herein describes an sgRNA, for example, together with a nuclease, such as a Cas protein. In some embodiments, the RNP comprises Cas9 and gRNA (e.g., sgRNA, dgRNA, or crRNA). In some embodiments, the guide RNA guides the nuclease such as Cas9 to a target sequence, and the guide RNA hybridizes with and the agent binds to the target sequence; in cases where the nuclease or Cas protein is a cleavase or nickase, binding can be followed by cleaving or nicking.
“Stem loop” as used herein describes a secondary structure of nucleotides that form a base-paired “stem” that ends in a loop of unpaired nucleic acids. A stem may be formed when two regions of the same nucleic acid strand are at least partially complementary in sequence when read in opposite directions. “Loop” as used herein describes a region of nucleotides that do not base pair (i.e., are not complementary) that may cap a stem. A “tetraloop” describes a loop of 4 nucleotides. As used herein, the upper stem of an sgRNA may comprise a tetraloop.
“Substituted” or “Substitution” as used herein with respect to a polynucleotide refers to an alteration of a nucleobase, e.g., nucleotide substitution, that changes its preferred base for Watson-Crick pairing. When a certain region of a guide RNA is “unsubstituted” as used herein (e.g., SEQ ID NOs: 200-210 and 500-501 as shown in Table 1A), the sequence of the region can be aligned to that of the corresponding conserved portion of, e.g., a spyCas9 sgRNA (SEQ ID NO: 400) or of any other gRNAs (e.g., part of SEQ ID NO: 200-210 and 500-501) with gaps and matches only (i.e., no mismatches), where bases are considered to match if they have the same preferred standard partner base (A, C, G, or T/U) for Watson-Crick pairing or can form a duplex by base stacking.
As used herein, a “conservative substitution” with respect to a polynucleotide refers to an alteration of a nucleobase means exchanging positions of base paired nucleotides such that base pairings may be maintained. For example, a G-C pair becomes a C-G pair, an A-U pair for a U-A pair, or other natural or modified base pairing.
As used herein, “substituted” and the like, in regard to unpaired nucleotides, e.g., loops of the repeat/anti-repeat, hairpin 1, or hairpin 2 regions, i.e., nucleotides 49-52, 87-90, and 122-125 in SEQ ID NO: 500, respectively, or other unpaired nucleotides, is the replacement of one or more nucleotides, e.g., 1, 2, 3, or 4 nucleotides, of the nucleotide sequence with a different nucleotide that does not interfere with the formation of a structure by the unpaired nucleotides, e.g., a bulge, a loop, to permit formation of the one or more duplex portions, e.g., in the repeat/anti-repeat, hairpin 1, or hairpin 2 regions.
As used herein, “substituted” and the like, in regard to an internal linker, is the replacement of at least 1, preferably at least 2 nucleotides with an internal linker. In certain embodiments, the internal linker has approximately the same predicted bridging length as the number of nucleotides replaced by the linker. In certain embodiments, the internal linker is shorter than the predicted bridging length of the number of nucleotides replaced by the linker. In certain embodiments, the internal linker is longer than the predicted bridging length of the number of nucleotides replaced by the linker. In certain embodiments, the internal linker further substitutes for a portion of the duplex portion of a repeat/anti-repeat portion of a gRNA. In certain embodiments, the internal linker substitutes for a portion of the loop portion of a stem loop in the gRNA. In certain embodiments, the internal linker substitutes for a portion of the duplex portion of a stem loop in the gRNA.
As used herein, an “unlinked portion of a gRNA” with reference to a gRNA comprising an internal linker is a molecule comprising only the nucleotides on one side or the other of the linker and optionally the linker itself or a part thereof. It may also comprise a reactive moiety at the end of the nucleotide sequence, linker or part thereof, or a quenched version of the reactive moiety.
“Guide RNA”, “gRNA”, and “guide” are used herein interchangeably to refer to either a crRNA (also known as CRISPR RNA), or the combination of a crRNA and a trRNA (also known as tracrRNA). The crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA). “Guide RNA” or “gRNA” refers to each type. The trRNA may be a naturally-occurring sequence, or a trRNA sequence with modifications or variations compared to naturally-occurring sequences. Guide RNAs can include modified RNAs as described herein. Unless otherwise clear from context, a guide RNA as used herein includes at least one internal linker.
“Internal linker” as used herein describes a non-nucleotide segment joining two nucleotides within a guide RNA. If the gRNA contains a spacer region, the internal linker is located outside of the spacer region (e.g., in the scaffold or conserved region of the gRNA). For Type V guides, it is understood that the last hairpin is the only hairpin in the structure, i.e., the repeat-anti-repeat region. As used herein, the linker is a non-nucleotide linker.
As used herein the term “aliphatic” refers to nonaromatic hydrocarbon compounds in which the constituent carbon atoms can be straight-chain, cyclic or branched chain; saturated or unsaturated. In certain embodiments, aliphatic also includes heterocyclic hydrocarbons. Cyclic and heterocyclic hydrocarbons refer to ring structures in which constituent carbon atoms, along with any heteratoms in a heterocyclic group form the ring. The cyclic and heterocyclic hydrocarbons may also contain single, double or triple bonds. C1-x aliphatic refers to an aliphatic group having from 1 to x constituent carbon atoms. An aliphatic group may form one or more chemical bonds to other moieties through any of its constituent carbon atoms. Aliphatic groups may be monovalent or divalent as determined by the context in which the term is used.
As used herein the term “alkylene” refers to a saturated bivalent aliphatic chain, which may be straight or branched. Typical alkylene radicals include, but are not limited to: methylene (CH2) 1,2-ethyl (CH2CH2), 1,3-propyl (CH2CH2CH2), 1,4-butyl (CH2CH2CH2CH2), and the like.
As used herein the term “alkenylene” refers to a bivalent aliphatic chain that is at least partially unsaturated (e.g., containing at least one double bond), which may be straight or branched. Typical alkenylene radicals include, but are not limited to: 1,2-ethylene (CH═CH).
As used herein the term “hydrogen-bond acceptor” refers to a substituent comprising a heteroatom capable of forming a hydrogen bond. H-bond acceptors may be monovalent or divalent as determined by the context in which the term is used. H-bond acceptors include substituents comprising oxygen, sulfur, or phosphorus, or substituents comprising hydroxy, alkoxy, thiol, ether, thioether, carbonyl, amides, carbonates, carbamates, phosphate, phosphorothioate, phosphonate, sulfate, or sulfonate or for example, —O—, —OH, —OR, —ROR, —S—, —SH, —SR, —NH—, —NR—, —C(O)—R, —C(O)—O—, —OC(O)O—, —C(O)—OR, —OC(O)—OR, —C(O)—H, —C(O)—OH, —C(O)—NR—, —OC(O)—NR—, —NC(O)—NR—, —OPO3, —PO3, —RPO3, —P(O)2O—, —OP(O)2O—, —OP(R)(O)O—, —OP(O)(S)O—, —S(O)2—R, —S(O)2—OR, —RS(O)2—R, —RS(O)2—OR, —S(O)2—, —SO3.
The “bridging length” of an internal linker as used herein refers to the distance or number of atoms in the shortest chain of atoms on the pathway from the first atom of the linker (bound to a 3′ substituent, such as an oxygen or phosphate, of the preceding nucleotide to the last atom of the linker (bound to a 5′ substituent, such as an oxygen or phosphate) of the following nucleotide) (e.g., from ˜ to #in the structure of Formula (I) described below). Approximate predicted bridging lengths for various linkers are provided in a table below.
In some embodiments, the gRNA (e.g., sgRNA) comprises a “guide region”, which is sometimes referred to as a “spacer” or “spacer region,” for example, in Briner A E et al., Molecular Cell 56:333-339 (2014) for sgRNA (but applicable herein to all guide RNAs). The guide region or spacer region is also sometimes referred to as a “variable region,” “guide domain” or “targeting domain.” In some embodiments, a “guide region” immediately precedes a “conserved portion of an sgRNA” at its 5′ end, and in some embodiments the sgRNA is shortened. An exemplary “conserved portion of an sgRNA” is shown in Tables 3A-B. In some embodiments, a “guide region” comprises a series of nucleotides at the 5′ end of a crRNA
As used herein, “repeat-anti-repeat region” is understood as the portion of the guide corresponding to the duplex or duplexes formed by the crRNA and the trRNA sequences in a guide RNA. In a single guide RNA, the trRNA and crRNA sequences are optionally truncated prior to covalent linkage. The exact position of the truncation can vary. The covalent linkage is routinely a short RNA sequence to allow the formation of a hairpin, typically a stem-loop structure.
A numeric position or range in the guide RNA refers to the position as determined from the 5′ end unless another point of reference is specified; for example, “nucleotide 5” in a guide RNA is the 5th nucleotide from the 5′ end; or “nucleotides 5-8” refers to 4 nucleotides beginning with the 5th nucleotide from the 5′ end and ending with the 8th nucleotide towards the 3′ end.
In some embodiments, a gRNA comprises nucleotides that “match the modification pattern” at corresponding or specified nucleotides of a gRNA described herein. This means that the nucleotides matching the modification pattern have the same modifications (e.g., phosphorothioate, 2′-fluoro, 2′-OMe, etc.) as the nucleotides at the corresponding positions of the gRNA described herein, regardless of whether the nucleobases at those positions match. For example, if in a first gRNA, nucleotides 5 and 6, respectively, have 2′-OMe and phosphorothioate modifications, then this gRNA has the same modification pattern at nucleotides 5 and 6 as a second gRNA that also has 2′-OMe and phosphorothioate modifications at nucleotides 5 and 6, respectively, regardless of whether the nucleobases at positions 5 and 6 are the same or different in the first and second gRNAs. However, a 2′-OMe modification at nucleotide 6 but not nucleotide 7 is not the same modification pattern at nucleotides 6 and 7 as a 2′-OMe modification at nucleotide 7 but not nucleotide 6. Similarly, a modification pattern that matches at least 75% of the modification pattern of a gRNA described herein means that at least 75% of the nucleotides have the same modifications as the corresponding positions of the gRNA described herein. Corresponding positions may be determined by pairwise or structural alignment.
A “conserved region” of a S. pyogenes Cas9 (“spyCas9” (also referred to as “spCas9”)) sgRNA” is shown in Tables 3A-B. The first row shows the numbering of the nucleotides; the second row shows the sequence (e.g., SEQ ID NO: 400); and the third row shows the regions.
As used herein, a “shortened” region in a gRNA is a region in a conserved portion of a gRNA that lacks at least 1 nucleotide compared to the corresponding region in a conserved portion of an unmodified gRNA (see, e.g.,
As used herein, a “YA site” refers to a 5′-pyrimidine-adenine-3′ dinucleotide. For clarification, a “YA site” in an original sequence that is altered by modifying a base is still considered a (modified) YA site in the resulting sequence, regardless of the absence of a literal YA dinucleotide. A “conserved region YA site” is present in the conserved region of an sgRNA. A “guide region YA site” is present in the guide region of an sgRNA. An unmodified YA site in an sgRNA may be susceptible to cleavage by RNase-A like endonucleases, e.g., RNase A. In certain embodiments, a YA site is modified to reduce susceptibility to RNAse A by a 2′ sugar modification, e.g., 2′OMe, 2′F, or backbone modification, e.g., phosphorothioate linkage. In certain embodiments, a YA site is modified by modifying the base so a YA sequence is no longer present.
As discussed herein, positions of nucleotides corresponding to those described with respect to spyCas9 gRNA can be identified in another gRNA with sequence or structural similarity by pairwise or structural alignment. Structural alignment is useful where molecules share similar structures despite considerable sequence variation. For example, spyCas9 and Staphylococcus aureus Cas9 (“SauCas9”) have divergent sequences, but significant structural alignment. See, e.g.,
Structural alignment involves identifying corresponding residues across two (or more) sequences by (i) modeling the structure of a first sequence using the known structure of the second sequence or (ii) comparing the structures of the first and second sequences where both are known, and identifying the residue in the first sequence most similarly positioned to a residue of interest in the second sequence. Corresponding residues are identified in some algorithms based on distance minimization given position (e.g., nucleobase position 1 or the 1′ carbon of the pentose ring for polynucleotides, or alpha carbons for polypeptides) in the overlaid structures (e.g., what set of paired positions provides a minimized root-mean-square deviation for the alignment). When identifying positions in a non-spyCas9 gRNA corresponding to positions described with respect to spyCas9 gRNA, spyCas9 gRNA can be the “second” sequence. Where a non-spyCas9 gRNA of interest does not have an available known structure, but is more closely related to another non-spyCas9 gRNA that does have a known structure, it may be most effective to model the non-spyCas9 gRNA of interest using the known structure of the closely related non-spyCas9 gRNA, and then compare that model to the spyCas9 gRNA structure to identify the desired corresponding residue in the non-spyCas9 gRNA of interest. There is an extensive literature on structural modeling and alignment for proteins; representative disclosures include U.S. Pat. Nos. 6,859,736; 8,738,343; and those cited in Aslam et al., Electronic Journal of Biotechnology 20 (2016) 9-13. For discussion of modeling a structure based on a known related structure or structures, see, e.g., Bordoli et al., Nature Protocols 4 (2009) 1-13, and references cited therein. See also
A “target sequence” as used herein refers to a sequence of nucleic acid to which the guide region directs a nuclease for cleavage. In some embodiments, a spyCas9 protein may be directed by a guide region to a target sequence by the nucleotides present in the guide region.
As used herein, the “5′ end” refers to the first nucleotide of the gRNA (including a dgRNA (typically the 5′ end of the crRNA of the dgRNA), sgRNA), in which the 5′ position is not linked to another nucleotide.
As used herein, a “5′ end modification” refers to a gRNA comprising a guide region having modifications in one or more of the one (1) to about seven (7) nucleotides at its 5′ end, optionally wherein the first nucleotide (from the 5′ end) of the gRNA is modified.
As used herein, the “3′ end” refers to the end or terminal nucleotide of a gRNA, in which the 3′ position is not linked to another nucleotide. In some embodiment, the 3′ end is in the 3′ tail. In some embodiments, the 3′ end is in the conserved portion of an gRNA.
As used herein, a “3′ end modification” refers to a gRNA having modifications in one or more of the one (1) to about seven (7) nucleotides at its 3′ end, optionally wherein the last nucleotide (i.e., the 3′ most nucleotide) of the gRNA is modified. If a 3′ tail is present, the 1 to about 7 nucleotides may be within the 3′ tail. If a 3′ tail is not present, the 1 to about 7 nucleotides may be within the conserved portion of a sgRNA.
The “last,” “second to last,” “third to last,” etc., nucleotide refers to the 3′ most, second 3′ most, third 3′ most, etc., nucleotide, respectively in a given sequence. For example, in the sequence 5′-AAACTG-3′, the last, second to last, and third to last nucleotides are G, T, and C, respectively. The phrase “last 3 nucleotides” refers to the last, second to last, and third to last nucleotides; more generally, “last N nucleotides” refers to the last to the Nth to last nucleotides, inclusive. “Third nucleotide from the 3′ end of the 3′ terminus” is equivalent to “third to last nucleotide.” Similarly, “third nucleotide from the 5′ end of the 5′ terminus” is equivalent to “third nucleotide at the 5′ terminus.”
As used herein, a “protective end modification” (such as a protective 5′ end modification or protective 3′ end modification) refers to a modification of one or more nucleotides within seven nucleotides of the end of an sgRNA that reduces degradation of the sgRNA, such as exonucleolytic degradation. In some embodiments, a protective end modification comprises modifications of at least two or at least three nucleotides within seven nucleotides of the end of the sgRNA. In some embodiments, the modifications comprise phosphorothioate linkages, 2′ modifications such as 2′-OMe or 2′-fluoro, 2′-H (DNA), ENA, UNA, or a combination thereof. In some embodiments, the modifications comprise phosphorothioate linkages and 2′-OMe modifications. In some embodiments, at least three terminal nucleotides are modified, e.g., with phosphorothioate linkages or with a combination of phosphorothioate linkages and 2′-OMe modifications. Modifications known to those of skill in the art to reduce exonucleolytic degradation are encompassed.
In some embodiments, a “3′ tail” comprising 1-20 nucleotides, optionaly 1-7 nucleotides, or 1 nucleotide, and follows the conserved portion of a sgRNA at its 3′ end. In certain embodiments, the terminal base is uracil. In certain embodiments, the tail is a one nucleotide and the terminal base is uracil.
“Cas nuclease”, also called “Cas protein”, as used herein, encompasses Cas cleavases, Cas nickases, and dCas DNA binding agents. Cas cleavases/nickases and dCas DNA binding agents include a Csm or Cmr complex of a type III CRISPR system, the Cas10, Csm1, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases; a type V CRISPR system including the Cas12, or a subunit thereof, such as a Cas12a (Cpf1) or a Cas12e (CasX); and a type VI CRISPR system, including Cas13d. As used herein, a “Class 2 Cas nuclease” is a single-chain polypeptide with RNA-guided DNA binding activity, such as a Cas9 nuclease or a Cpf1 nuclease. Class 2 Cas nucleases include Class 2 Cas cleavases and Class 2 Cas nickases (e.g., H840A, D10A, or N863A variants), which further have RNA-guided DNA cleavases or nickase activity, and Class 2 dCas DNA binding agents, in which cleavase/nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2cl, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g, K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpf1 protein, Zetsche et al., Cell, 163: 1-13 (2015), is homologous to Cas9, and contains a RuvC-like nuclease domain. Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables Si and S3. “Cas9” encompasses Spy Cas9, the variants of Cas9 listed herein, and equivalents thereof. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11): 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).
Class 2 CRISPR systems are characterized by having a monomeric endonuclease, rather than a multimeric nuclease. Class 2 CRISPR systems include Type II and Type V systems.
Type II systems include a relatively large Cas9 endonuclease having an RNA recognition domain, two nuclease domains, an HNH domain connected to a RuvC domain by an arginine-rich helix bridge, and a protospacer adjacent motif (PAM) interacting domain. The guide RNAs tend to be relatively long, i.e., single guide RNAs are typically about 100 nucleotides in length, or longer, and have been demonstrated by a number of functional studies to include multiple duplex regions and hairpins 3′ to the spacer (targeting domain region) including the repeat-anti-repeat region and a second hairpin region, typically containing one or two predicted hairpin structures.
Type II Cas9 endonucleases include Type II-A Cas9 endonucleases, e.g., S. pyogenes (Spy Cas9), and Type II-C Cas9 endonucleases, e.g., C. jejuni (Cje), R. palustris (Rpa), R. rubrum (Rru), A. naeslundii (Ana), and C. diphtheriae (Cdi).
Type V systems are characterized by relatively smaller nucleases and guides. The nucleases have a single DNA recognition lobe (REC) and a single nuclease (NUC) lobe. The guides occur naturally as a single RNA of about 40-45 nucleotides in length and include a single hairpin repeat-anti-repeat region about 20 nucleotides in length followed by a 23-25 nucleotide spacer region. Type V systems include Francisella novicida Cpf1 (FnCpf1), Lachnospiraceae bacterium Cpf1 (LbCpf1), and Acidaminococcus sp. Cpf1 (AsCpf1/Cas 12a).
As used herein, a first sequence is considered to “comprise a sequence with at least X % identity to” a second sequence if an alignment of the first sequence to the second sequence shows that X % or more of the positions of the second sequence in its entirety are matched by the first sequence. For example, the sequence AAGA comprises a sequence with 100% identity to the sequence AAG because an alignment would give 100% identity in that there are matches to all three positions of the second sequence. The differences between RNA and DNA (generally the exchange of uridine for thymidine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to differences in identity or complementarity among polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement). Thus, for example, the sequence 5′-AXG where X is any modified uridine, such as pseudouridine, N1-methyl pseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG in that both are perfectly complementary to the same sequence (5′-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well-known in the art. One skilled in the art will understand what choice of algorithm and parameter settings are appropriate for a given pair of sequences to be aligned; for sequences of generally similar length and expected identity >50% for amino acids or >75% for nucleotides, the Needleman-Wunsch algorithm with default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server is generally appropriate.
“mRNA” is used herein to refer to a polynucleotide that is RNA or modified RNA and comprises an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs). mRNA can comprise a phosphate-sugar backbone including ribose residues or analogs thereof, e.g., 2′-methoxy ribose residues. In some embodiments, the sugars of a nucleic acid phosphate-sugar backbone consist essentially of ribose residues, 2′-methoxy ribose residues, or a combination thereof. In general, mRNAs do not contain a substantial quantity of thymidine residues (e.g., 0 residues or fewer than 30, 20, 10, 5, 4, 3, or 2 thymidine residues; or less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1% thymidine content). An mRNA can contain modified uridines at some or all of its uridine positions. In some embodiments, a modified mRNAs comprises at least one nucleotide in which one or more of the phosphate, sugar, or nucleobase differ from that of a standard adenosine, cytidine, guanidine, or uridine nucleotide.
As used herein, a “subject” refers to any member of the animal kingdom. In some embodiments, “subject” refers to humans. In some embodiments, “subject” refers to non-human animals. In some embodiments, “subject” refers to primates. In some embodiment, “subject” refers to non-huamn primates. In some embodiments, subjects include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, or worms. In certain embodiments, the non-human subject is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, or a pig). In some embodiments, a subject may be a transgenic animal, genetically-engineered animal, or a clone. In certain embodiments of the present invention the subject is an adult, an adolescent or an infant. In some embodiments, terms “individual” or “patient” are used and are intended to be interchangeable with “subject” wherein the subject is a human subject.
As used herein, “delivering” and “administering” are used interchangeably, and include ex vivo and in vivo applications.
Co-administration, as used herein, means that a plurality of substances are administered sufficiently close together in time so that the agents act together. Co-administration encompasses administering substances together in a single formulation and administering substances in separate formulations close enough in time so that the agents act together.
As used herein, the phrase “pharmaceutically acceptable” means that which is useful in preparing a pharmaceutical composition that is generally non-toxic and is not biologically undesirable and that are not otherwise unacceptable for pharmaceutical use. Pharmaceutically acceptable generally refers to substances that are non-pyrogenic. Pharmaceutically acceptable can refer to substances that are sterile, especially for pharmaceutical substances that are for injection or infusion.
Provided herein are guide RNAs (gRNAs) comprising an internal linker for use in gene editing methods.
A. Locations/Numbers of Internal Linkers
In some embodiments, the internal linker substitutes for at least 1 nucleotide. In some embodiments, the internal linker substitutes for at least 2 nucleotides. In some embodiments, the internal linker substitutes for at least 3 nucleotides. In some embodiments, the internal linker substitutes for at least 4 nucleotides. In some embodiments, the internal linker substitutes for at least 5 nucleotides. In some embodiments, the internal linker substitutes for at least 6 nucleotides. In some embodiments, the internal linker substitutes for at least 7 nucleotides. In some embodiments, the internal linker substitutes for at least 8 nucleotides. In some embodiments, the internal linker substitutes for at least 9 nucleotides. In some embodiments, the internal linker substitutes for at least 10 nucleotides. In some embodiments, the internal linker substitutes for at least 11 nucleotides. In some embodiments, the internal linker substitutes for at least 12 nucleotides. In some embodiments, the internal linker substitutes for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides of the gRNA. In some embodiments, an internal linker substitutes for at least 28 nucleotides of the gRNA. In some embodiments, an internal linker substitutes for at least 22 nucleotides of the gRNA. In some embodiments, the linker substitutes for at least 2-6 nucleotides. In some embodiments, the linker substitutes for at least 2-4 nucleotides.
In some embodiments, an internal linker substitutes for up to 28 nucleotides of the gRNA. In some embodiments, an internal linker substitutes for up to 22 nucleotides of the gRNA. In some embodiments, an internal linker substitutes for up to 12 nucleotides of the gRNA.
In some embodiments, the internal linker substitutes for 2 nucleotides. In some embodiments, the internal linker substitutes for 3 nucleotides. In some embodiments, the internal linker substitutes for 4 nucleotides. In some embodiments, the internal linker substitutes for 5 nucleotides. In some embodiments, the internal linker substitutes for 6 nucleotides. In some embodiments, the internal linker substitutes for 7 nucleotides. In some embodiments, the internal linker substitutes for 8 nucleotides. In some embodiments, the internal linker substitutes for 9 nucleotides. In some embodiments, the internal linker substitutes for 10 nucleotides. In some embodiments, the internal linker substitutes for 11 nucleotides. In some embodiments, the internal linker substitutes for 12 nucleotides. In some embodiments, the linker substitutes for 2-28 nucleotides. In some embodiments, the linker substitutes for 2-22 nucleotides. In some embodiments, the linker substitutes for 2-12 nucleotides. In some embodiments, the linker substitutes for 2-6 nucleotides. In some embodiments, the linker substitutes for 2-4 nucleotides.
In some embodiments, the internal linker has a bridging length of about 3-30 atoms. In some embodiments, the internal linker has a bridging length of about 6-30 atoms. In some embodiments, the internal linker has a bridging length of about 9-30 atoms. In some embodiments, the internal linker has a bridging length of about 12-30 atoms. In some embodiments, the internal linker has a bridging length of about 15-30 atoms. In some embodiments, the internal linker has a bridging length of about 18-30 atoms. In some embodiments, the internal linker has a bridging length of about 21-30 atoms. In some embodiments, the internal linker has a bridging length of about 12-21 atoms. In some embodiments, the internal linker has a bridging length of about 9-21 atoms. In some embodiments, the internal linker has a bridging length of about 6-12 atoms.
In some embodiments, the internal linker has a bridging length of about 3-30 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 12-30 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 12-24 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 12-21 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 16-20 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 15-18 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA.
In some embodiments, the internal linker has a bridging length of about 15 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 16 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 17 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 18 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 19 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 20 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 21 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 22 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 23 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 24 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 25 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 26 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 27 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 28 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 29 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 30 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA.
In some embodiments, the internal linker has a bridging length of about 21 atoms, and the linker substitutes for 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 21 atoms, and the linker substitutes for 6 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 21 atoms, and the linker substitutes for 8 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 21 atoms, and the linker substitutes for 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 21 atoms, and the linker substitutes for 10 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 21 atoms, and the linker substitutes for 12 nucleotides of the gRNA.
In some embodiments, the internal linker has a bridging length of about 18 atoms, and the linker substitutes for 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 18 atoms, and the linker substitutes for 6 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 18 atoms, and the linker substitutes for 8 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 18 atoms, and the linker substitutes for 4 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 18 atoms, and the linker substitutes for 10 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 18 atoms, and the linker substitutes for 12 nucleotides of the gRNA.
In some embodiments, the internal linker has a bridging length of about 6-18 atoms, optionally about 6-12 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 9-12 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 8-10 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA.
In some embodiments, the internal linker has a bridging length of about 6 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 7 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 8 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 9 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 10 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 11 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. In some embodiments, the internal linker has a bridging length of about 12 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA.
In some embodiments, the internal linker has a bridging length of about 9 atoms, and the linker substitutes for 2 nucleotides of the gRNA.
In some embodiments, the internal linker is in a repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for at least 3 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for at least 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 3 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 4 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 5 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 6 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 7 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 8 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 9 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 10 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 11 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for 12 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the internal linker substitutes for up to 28 nucleotides in the repeat-anti-repeat region. In some embodiments, the internal linker substitutes for up to 20 nucleotides in the repeat-anti-repeat region. In some embodiments, the internal linker is flanked by nucleotides forming a duplex region of at least 2 base pairs in length. In certain embodiments, the internal linker is not present in a bulge in a repeat-anti-repeat region.
In some embodiments, the internal linker is in a hairpin region of the gRNA. In some embodiments, the internal linker substitutes for at least 2 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for up to 22 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for up to 12 nucleotides of the hairpin region of the gRNA.
In some embodiments, the internal linker substitutes for at least 2 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for at least 4 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 6 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 8 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 10 nucleotides of the hairpin of the gRNA. In some embodiments, the internal linker substitutes for 12 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 14 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 16 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 18 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 20 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 22 nucleotides of the hairpin of the gRNA. In some embodiments, the internal linker substitutes for up to 22 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 2-6 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 2-4 nucleotides of the hairpin region of the gRNA. In some embodiments, the internal linker is flanked by nucleotides forming a duplex region of at least 2 base pairs in length. In some embodiments, the internal linker substitutes for all of a hairpin structure in a hairpin region, i.e., a duplex is not formed by the nucleotides flanking the internal linker.
In some embodiments, the internal linker substitutes for 1, 2, 3, 4, 5, or 6 base pairs of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 1 base pair of the hairpin region of the gRNA, i.e., for nucleotides predicted to form a base pair in a hairpin structure such that a 1 base pair deletion results in the deletion of two nucleotides and a reduced number of base pairs in the hairpin structure by one. In some embodiments, the internal linker substitutes for 2 base pairs of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 3 base pairs of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 4 base pairs of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 5 base pairs of the hairpin of the gRNA. In some embodiments, the internal linker substitutes for 6 base pairs of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 1-12 base pairs of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 1-6 base pairs of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for 1-4 base pairs of the hairpin region of the gRNA. In some embodiments, the internal linker substitutes for up to 12 base pairs of the hairpin region of the gRNA.
In some embodiments, the internal linker is in a nexus region of the gRNA. In some embodiments, the internal linker substitutes for at least 2 nucleotides of the nexus region of the gRNA. In some embodiments, the internal linker substitutes for 1 or 2 nucleotides of the nexus region of the gRNA.
In some embodiments, the internal linker is in a hairpin structure between a first portion of the gRNA and a second portion of the gRNA, wherein the first portion and the second portion together form a duplex portion.
In some embodiments, the gRNA comprises three internal linkers. In some embodiments, the gRNA comprises two internal linkers. In some embodiments, the gRNA comprises one internal linker.
Upper Stem of Repeat-Anti-Repeat Region
In some embodiments, the internal linker in the repeat-anti-repeat region is in a hairpin structure between a first portion and a second portion of the repeat-anti-repeat region, wherein the first portion and the second portion together form a duplex portion.
In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides of the hairpin structure. In some embodiments, the internal linker substitutes for up to 28 nucleotides in the repeat-anti-repeat region. In some embodiments, the internal linker substitutes for up to 20 nucleotides in the repeat-anti-repeat region. In some embodiments, the internal linker substitutes for up to 12 nucleotides in the repeat-anti-repeat region. In some embodiments, the internal linker substitutes for at lesat 4 nucleotides in the repeat-anti-repeat region. In some embodiments, the internal linker substitutes for 4-20 nucleotides in the repeat-anti-repeat region. In some embodiments, the internal linker substitutes for 4-14 nucleotides in the repeat-anti-repeat region. In some embodiments, the internal linker substitutes for 4-6 nucleotides in the repeat-anti-repeat region.
In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for a loop, or part thereof, of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop and the stem, or part thereof, of the hairpin structure. In some embodiments, the internal linker does not substitute for a bulge portion of a repeat-anti-repeat region.
In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for 2, 3, or 4 nucleotides of the loop of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for 2 nucleotides of the loop of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for 3 nucleotides of the loop of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for 4 nucleotides of the loop of the hairpin structure.
In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and at least 1 nucleotide of the stem of the hairpin. In some embodiments, wherein the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides of the stem of the hairpin. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin and at least 2 nucleotides of the stem of the hairpin. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin and 2-24 nucleotides of the stem of the hairpin. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin and 2-18 nucleotides of the stem of the hairpin. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin and 2-8 nucleotides of the stem of the hairpin.
In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, or 24 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 2, 4, 6, 8, 10, 12, or 14 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 2, 4, 6, or 8 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 2 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 4 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 6 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 8 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 10 nucleotides of the stem of the hairpin structure.
In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 1, 2, 3, 4, 5, 6, 7, or 8 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 1, 2, 3, or 4 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 1 base pair of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 2 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 3 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 4 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 5 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 6 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin structure and 7 base pairs of the stem of the hairpin structure.
In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for all of the nucleotides constituting the loop of the hairpin structure.
In some embodiments, the internal linker in the repeat-anti-repeat region substitutes for all of the nucleotides constituting the loop and the upper stem of the hairpin structure.
Nexus Region
In some embodiment, the internal linker substitutes for 1 or 2 nucleotides of the loop of the nexus region of the gRNA. In some embodiment, the internal linker has a bridging length of about 6 to 18 atoms. In some embodiment, the internal linker has a bridging length of about 6-12 atoms.
Hairpin Region
In some embodiments, the internal linker substitutes for a hairpin structure in the hairpin region of the gRNA.
In some embodiments, the hairpin region is equivalent to a hairpin region obtainable by substituting an internal linker for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides of a hairpin structure of a gRNA, e.g., any of the gRNAs shown in Table TA or any of SEQ ID NOs: 200-210 and 500-501.
In some embodiments, the internal linker substitutes for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides of the hairpin structure. In some embodiments, the internal linker substitutes for 2-22 nucleotides of the hairpin structure. In some embodiments, the internal linker substitutes for 2-12 nucleotides of the hairpin structure. In some embodiments, the internal linker substitutes for 2-6 nucleotides of the hairpin structure. In some embodiments, the internal linker substitutes for 2-4 nucleotides of the hairpin structure. The gRNA comprising an internal linker in the hairpin region may form a duplex portion in the hairpin region. The internal linker in the hairpin region may substitute for the loop and the gRNA may form a duplex portion in the hairpin region. The internal linker in the hairpin region may substitute for the loop and one or more base pairs in the stem region and the gRNA may form a duplex portion in the hairpin region.
In some embodiments, the internal linker substitutes for a loop, or part thereof, of the hairpin structure in the hairpin region. In some embodiments, the internal linker substitutes for the loop and the stem, or part thereof, of the hairpin structure in the hairpin region.
In some embodiments, the internal linker substitutes for 2, 3, 4, or 5 nucleotides of the loop of the hairpin structure. In some embodiments, the internal linker substitutes for 2 nucleotides of the loop of the hairpin structure. In some embodiments, the internal linker substitutes for 3 nucleotides of the loop of the hairpin structure. In some embodiments, the internal linker substitutes for 4 nucleotides of the loop of the hairpin structure. In some embodiments, the internal linker substitutes for 5 nucleotides of the loop of the hairpin structure. In some embodiments, the internal linker substitutes for 2-5 nucleotides of the loop of the hairpin structure.
In some embodiments, the internal linker substitutes for the loop of the hairpin structure and at least 1 nucleotide of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and at least 2 nucleotides of the stem of the hairpin structure.
In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, or 24 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 2, 4, 6, 8, 10, 12, or 14 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 2, 4, 6, or 8 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin and 2 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 4 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 6 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 8 nucleotides of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and up to 24 nucleotides of the stem of the hairpin structure.
In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 1, 2, 3, 4, 5, or 6 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 1, 2, 3, or 4 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 1 base pair of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 2 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 3 base pairs of the stem of the hairpin structure. In some embodiments, the internal linker substitutes for the loop of the hairpin structure and 4 base pairs of the stem of the hairpin structure.
In some embodiments, the internal linker substitutes for all of the nucleotides constituting the loop of the hairpin structure.
In some embodiments, the internal linker substitutes for all of the nucleotides constituting the loop and the stem of the hairpin structure.
In some embodiments, the hairpin is a hairpin 1, and the internal linker substitutes for the hairpin 1. In some embodiments, the gRNA is a SpyCas9 gRNA and the internal linker substitutes for hairpin 1.
In further embodiments, the gRNA further comprises a hairpin 2 at 3′ to the hairpin 1. In some embodiments, the internal linker substitute for at least 2 nucleotides of a loop of the hairpin 2.
In some embodiments, hairpin 2 does not include any internal linker substitutions. In some embodiments, the gRNA is a Spy Cas9 gRNA and the hairpin 2 does not include any internal linker substitutions.
In some embodiments, the gRNA further comprises a guide region. In further embodiments, the guide region is 17, 18, 19, 20, or 21 nucleotides in length. In some embodiments, the gRNA does not comprise a guide region.
In some embodiments, the gRNA is a single guide RNA (sgRNA).
In some embodiments, the gRNA comprises a tracrRNA (trRNA).
B. Internal Linkers Structures—Physical Properties, Chemical Properties
gRNAs disclosed herein comprise an internal linker. In general, any internal linker compatible with the function of the gRNA may be used. It may be desirable for the linker to have a degree of flexibility. In some embodiments, the internal linker comprises at least two, three, four, five, six, or more on-pathway single bonds. A bond is on-pathway if it is part of the shortest path of bonds between the two nucleotides whose 5′ and 3′ positions are connected to the linker.
In some embodiments, the internal linker has a bridging length of about 6-40 Angstroms. In some embodiments, the internal linker has a bridging length of about 8-25 Angstroms. In some embodiments, the internal linker has a bridging length of about 8-15 Angstroms. In some embodiments, the internal linker has a bridging length of about 10-40 Angstroms. In some embodiments, the internal linker has a bridging length of about 10-35 Angstroms. In some embodiments, the internal linker has a bridging length of about 10-30 Angstroms. In some embodiments, the internal linker has a bridging length of about 10-25 Angstroms. In some embodiments, the internal linker has a bridging length of about 15-40 Angstroms. In some embodiments, the internal linker has a bridging length of about 15-35 Angstroms. In some embodiments, the internal linker has a bridging length of about 15-25 Angstroms. The length of the linker may in some embodiments be chosen based at least in part on the number of nucleotides for which the linker substitutes relative to a counterpart gRNA not containing an internal linker. For example, if the linker takes the place of two nucleotides, a linker having a length of about 8-15 Angstroms may be used, such as any of the embodiments described elsewhere herein encompassed within the range of about 8-15 Angstroms. If the linker takes the place of more than two nucleotides, a linker having a length of about 10-25 Angstroms may be used, such as any of the embodiments described elsewhere herein encompassed within the range of about 10-25 Angstroms.
Exemplary predicted linker lengths by number of atoms, number of ethylene glycol units, approximate linker length in Angstroms on the assumption that an ethylene glycol monomer is about 3.7 Angstroms, and suitable location for substitution of at least the entire loop portion of a hairpin structure are provided in the table below. Substitution of two nucleotides requires a linker length of at least about 11 Angstroms. Substitution of at least 3 nucleotides requires a linker length of at least about 16 Angstroms.
In some embodiments, the internal linker comprises a structure of formula (I):
˜-L0-L1-L2-# (I)
In some embodiments, L1 comprises one or more —CH2CH2O—, —CH2OCH2—, or —OCH2CH2— units (“ethylene glycol subunits”). In some embodiments, the number of —CH2CH2O—, —CH2OCH2—, or —OCH2CH2— units is in the range of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.
In some embodiments, m is 1, 2, 3, 4 or 5. In some embodiments, m is 1, 2, or 3. In some embodiments, m is 6, 7, 8, 9, or 10.
In some embodiments, L0 is null. In some embodiments, L0 is —CH2— or —CH2CH2—.
In some embodiments, L2 is null. In some embodiments, L2 is —O—, —S—, or C1-3 aliphatic. In some embodiments, L2 is —O—. In some embodiments, L2 is —S—. In some embodiments, L2 is —CH2— or —CH2CH2—.
The identities and values of the moieties and variables in Formula I may be chosen to provide an internal linker having any of the bridging lengths described herein. In some embodiments, the number of atoms in the shortest chain of atoms on the pathway from ˜ to #in the structure of Formula (I) is 30 or less, or 27 or less, or 24 or less, or 21 or less, or is 18 or less, or is 15 or less, or is 12 or less, or is 10 or less.
In some embodiments, the number of atoms in the shortest chain of atoms on the pathway from ˜ to #in the structure of Formula (I) is from 6 to 30, or is from 9 to 30, or is from 9 to 21. In some embodiments, the number of atoms in the shortest chain of atoms on the pathway from ˜ to #in the structure of Formula (I) is 9. In some embodiments, the number of atoms in the shortest chain of atoms on the pathway from ˜ to #in the structure of Formula (I) is 18.
In some embodiments, each C1-3 aliphatic group and C1-5 aliphatic group is saturated. In some embodiments, at least one C1-5 aliphatic group is a C1-4 alkylene, or wherein at least two C1-5 aliphatic groups are a C1-4 alkylene, or wherein at least three C1-5 aliphatic groups are a C1-4 alkylene. In some embodiments, at least one R1 is selected from —CH2—, —CH2CH2—, —CH2CH2CH2—, or —CH2CH2CH2CH2—. In some embodiments, each R1 is independently selected from —CH2—, —CH2CH2—, —CH2CH2CH2—, or —CH2CH2CH2CH2—. In some embodiments, each R1 is —CH2CH2—.
In some embodiments, at least one C1-5 aliphatic group is a C1-4 alkenylene, or wherein at least two C1-5 aliphatic groups are a C1-4 alkenylene, or wherein at least three C1-5 aliphatic groups are a C1-4 alkenylene. In some embodiments, at least one R1 is selected from —CHCH—, —CHCHCH2—, or —CH2CHCHCH2—.
In some embodiments, each E1 is independently chosen from —O—, —S—, —NH—, —NR—, —C(O)—O—, —OC(O)O—, —C(O)—NR—, —OC(O)—NR—, —NC(O)—NR—, —P(O)2O—, —OP(O)2O—, —OP(R)(O)O—, —OP(O)(S)O—, —S(O)2— and cyclic hydrocarbons, and heterocyclic hydrocarbons. In some embodiments, each E1 is independently chosen from —O—, —S—, —NH—, —NR—, —C(O)—O—, —OC(O)O—, —P(O)2O—, —OP(O)2O—, and —OP(R)(O)O.
In some embodiments, each E1 is —O—.
In some embodiments, each E1 is —S—.
In some embodiments, at least one C1-5 aliphatic group in R1 is optionally substituted with one E2.
In some embodiments, each E2 is independently chosen from —OH, —OR, —ROR, —SH, —SR, —C(O)—R, —C(O)—OR, —OC(O)—OR, —C(O)—H, —C(O)—OH, —OPO3, —PO3, —RPO3, —S(O)2—R, —S(O)2—OR, —RS(O)2—R, —RS(O)2—OR, —SO3, and cyclic hydrocarbons, and heterocyclic hydrocarbons. In some embodiments, each E2 is independently chosen from —OH, —OR, —SH, —SR, —C(O)—R, —C(O)—OR, —OC(O)—OR, —OPO3, —PO3, —RPO3, and —SO3.
In some embodiments, each E2 is —OH or —OR.
In some embodiments, each E2 is —SH or —SR.
In some embodiments, the internal linker comprises at least two, three, four, five, or six ethylene glycol subunits covalently linked to each other. In some embodiments, the internal linker comprises a linker having from 1 to 10 ethylene glycol units. In some embodiments, the internal linker comprises a linker having from 2 to 7 ethylene glycol units. In some embodiments, the internal linker comprises a linker having from 3 to 6 ethylene glycol units. In some embodiments, the internal linker comprises a linker having 3 ethylene glycol units. In some embodiments, the internal linker comprises a linker having 6 ethylene glycol units.
In some embodiments, the internal linker comprises a PEG-linker. In some embodiments, the internal linker comprises a PEG-linker having from 1 to 9 ethylene glycol units. In some embodiments, the internal linker comprises a PEG-linker having from 3 to 6 ethylene glycol units. In some embodiments, the internal linker comprises a PEG-linker having 3 ethylene glycol units. In some embodiments, the internal linker comprises a PEG-linker having 6 ethylene glycol units.
In some embodiments, the internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms, and the linker substitutes for at least 4 nucleotides of the gRNA. For brevity, an internal linker having a bridging length of about 15-21 atoms is referred to elsewhere herein as a “linker 1.” The internal linker having a bridging length of about 9-30 atoms, optionally about 15-21 atoms may be chosen from any such embodiment described herein. The internal linker having a bridging length of about 9-30 atoms, optionally about 15-21 atoms may have any compatible feature described herein for internal linkers.
In some embodiments, a linker comprises a plurality of polyethylene glycol subunits, such as at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 polyethylene glycol subunits. In some embodiments, a linker comprises at least 5, 6, or 7 polyethylene glycol subunits. In some embodiments, a linker consists of at least 5, 6, or 7 polyethylene glycol subunits.
In some embodiments, the internal linker has a bridging length of about 6-18 atoms, optionally about 6-12 atoms, and the linker substitutes for at least 2 nucleotides of the gRNA. For brevity, an internal linker having a bridging length of about 6-18 atoms, optionally about 6-12 atoms is referred to elsewhere herein as a “linker 2.” The internal linker having a bridging length of about 6-18 atoms, optionally about 6-12 atoms may be chosen from any such embodiment described herein. The internal linker having a bridging length of about 6-12 atoms may have any compatible feature described herein for internal linkers. In some embodiments, a linker 2 comprises a plurality of polyethylene glycol (PEG) subunits, such as at least 2, 3, or 4 polyethylene glycol subunits. In some embodiments, a linker 1 comprises at least 2, 3, or 4 polyethylene glycol subunits. In some embodiments, a linker 1 consists of at least 2, 3, or 4 polyethylene glycol subunits.
Exemplary PEG containing linkers include the following:
Linkers for use in the compositions and methods provided herein are known in the art and commercially available from various sources including, but are not limited to, Biosearch Technologies (e.g., Spacer-CE Phosphoramidite C2, 2-(4,4′-Dimethoxytrityloxy)ethyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and C6 Spacer Amidite (DMT-1,6-Hexandiol)); Glen Research (Spacer Phosphoramidite C3, 3-(4,4′-Dimethoxytrityloxy)propyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite; Spacer Phosphoramidite 9, 9-O-Dimethoxytrityl-triethylene glycol,1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite; Spacer C12 CE Phosphoramidite, 12-(4,4′-Dimethoxytrityloxy)dodecyl-1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite; and Spacer Phosphoramidite 18, 18-O-Dimethoxytritylhexaethyleneglycol,1-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite).
C. Methods of Making
Methods of synthesizing a gRNA comprising an internal linker disclosed herein are provided. Suitable precursors, e.g., linker can be introduced into an sgRNA oligonucleotide by using the corresponding phosphoramidite building block in methods of making sgRNA in a single synthetic process. Such building blocks are commercially available or can be prepared by known methods.
Methods of synthesis include a series of sequential coupling reactions including covalently linking a first nucleotide to a second nucleotide; covalently linking an internal linker to a second nucleotide; and covalently linking a third nucleotide to the internal linker. In certain embodiments, such linkages are performed using phosphoramidite chemistry. In certain embodiments, the method includes covalent linkage of a second linker to the first linker prior to covalent linkage of the third nucleotide.
In some embodiments, a solid support covalently attached to the linker of the gRNA disclosed herein is provided.
The gRNA provided herein with internal linkers are made in a single synthetic process such that a full-length gRNA strand (sgRNA, crRNA, or trRNA) is produced by the synthetic method. In the case of a dgRNA, the crRNA and trRNA are synthesized separately and annealed. That is, when the gRNA is made as a dgRNA, the separately synthesized portions do not require covalent linkage to form a stable gRNA. In certain embodiments, the crRNA and trRNA of a dgRNA containing an internal linker as provided herein, does not include a covalent linkage between the crRNA and the trRNA.
In preferred embodiments, the gRNA is not made using click chemistry.
D. Types of Guide RNAs
In some embodiments, the guide RNA is a single guide RNA.
In some embodiments, the guide RNA comprises a tracrRNA (trRNA).
Sequences of exemplary gRNAs are shown in Table 1A below. In some embodiments, the guide RNA comprises a nucleic acid sequence of any one of SEQ ID NOs: 200-210 and 500-501 wherein an internal linker substitutes for one or more nucleotides. In some embodiments, at least one nucleotide shown in bold in Table 1A is replaced with an internal linker. In some embodiments, at least two consecutive nucleotides shown in bold in Table 1 are replaced with an internal linker. In some embodiments, at least three consecutive nucleotides shown in bold in Table 1A are replaced with an internal linker. In some embodiments, at least four consecutive nucleotides shown in bold in Table 1A are replaced with an internal linker. In some embodiments, at least two nonconsecutive nucleotides shown in bold in Table 1A are replaced with an internal linker. In some embodiments, at least a first two or more consecutive nucleotides and at least a second two or more consecutive nucleotides shown in bold in Table 1A are replaced with an internal linker, wherein the first two or more consecutive nucleotides are not consecutive with the second two or more consecutive nucleotides. In some embodiments, at least a first three or more consecutive nucleotides and at least a second three or more consecutive nucleotides shown in bold in Table 1A are replaced with an internal linker, wherein the first three or more consecutive nucleotides are not consecutive with the second three or more consecutive nucleotides. In some embodiments, at least a first four or more consecutive nucleotides and at least a second two or more consecutive nucleotides shown in bold in Table 1A are replaced with an internal linker, wherein the first four or more consecutive nucleotides are not consecutive with the second two or more consecutive nucleotides. In some embodiments, at least a first four or more consecutive nucleotides and at least a second four or more consecutive nucleotides shown in bold in Table 1A are replaced with an internal linker, wherein the first four or more consecutive nucleotides are not consecutive with the second four or more consecutive nucleotides.
UAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU
UAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC
AAUGAGAACCGUUGCUACAAUAAGGCCGUCUGAAAAGAUGUGCCGCAACGCUCUGC
In some embodiments, the guide RNA comprises a nucleic acid sequence of any one of SEQ ID NOs: 200-210 and 500, including modifications disclosed elsewhere herein. Exemplary sgRNAs are shown in
a. SpyCas9 Guide RNAs
In some embodiments, the guide RNA is a S. pyogenes Cas9 (“SpyCas9”) guide RNA. As used herein, a SpyCas9 guide RNA mean that it is functional with SpyCas9. The same applies to other gRNAs for different species of Cas9 disclosed herein.
In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 200 or 201. In some embodiments, the guide RNA is a modified SpyCas9 guide RNA. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 200 or 201, including modifications disclosed elsewhere herein.
In some embodiments, the sgRNA comprises a guide region and a conserved portion 3′ to the guide region, wherein the conserved portion comprises a repeat-anti-repeat region, a nexus region, a hairpin 1 region, and a hairpin 2 region, and comprises at least one of:
An exemplary SpyCas9 sgRNA is shown in
In some embodiments, the sgRNA comprises the first internal linker and the second internal linker. In some embodiments, the sgRNA comprises the first internal linker and the third internal linker. In some embodiments, the sgRNA comprises the second internal linker and the second internal linker. In some embodiments, the sgRNA comprises the first internal linker, the second internal linker, and the third internal linker.
In some embodiments, the first internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms.
In some embodiments, the first internal linker substitutes for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the upper stem region. In some embodiments, the first internal linker substitutes for a loop, or part thereof, of the upper stem region. In some embodiments, the first internal linker substitutes for the loop and the stem, or part thereof, of the upper stem region.
In some embodiments, the first internal linker substitutes for 2, 3, or 4 nucleotides of the loop of the upper stem region. In some embodiments, the first internal linker substitutes for 4 nucleotides of the loop of the upper stem region.
In some embodiments, the first internal linker substitutes for the loop of the upper stem region and at least 2, 4, 6, or 8 nucleotides of the stem of the upper stem region. In some embodiments, the first internal linker substitutes for the loop of the upper stem region and 1, 2, 3, or 4 base pairs of the stem of the upper stem region. In some embodiments, the first internal linker substitutes for the loop of the upper stem region and 1 base pair of the stem of the upper stem region. In some embodiments, the first internal linker substitutes for the loop of the upper stem region and 2 base pairs of the stem of the upper stem region. In some embodiments, the first internal linker substitutes for the loop of the upper stem region and 3 base pairs of the stem of the upper stem region. In some embodiments, the first internal linker substitutes for the loop of the upper stem region and 4 base pairs of the stem of the upper stem region.
In some embodiments, the first internal linker substitutes for all of the nucleotides constituting the loop of the upper stem region (i.e., the portion of the stem above the bulge). In some embodiments, the first internal linker substitutes for all of the nucleotides constituting the loop and the stem of the upper stem region.
In some embodiments, the bulge in the repeat-anti-repeat region does not contain a linker. In some embodiments, the lower stem portion of the repeat-anti-repeat region does not contain a linker.
In some embodiments, the second internal linker has a bridging length of about 6-18 atoms, optionally 9-18 atoms. In some embodiments, the second internal linker substitutes for 2 nucleotides of the nexus region of the sgRNA.
In some embodiments, the third internal linker has a bridging length of about 9-30 atoms, optionally 15-21 atoms.
In some embodiments, the third internal linker substitutes for 2, 4, 6, 8, or 10 nucleotides of the hairpin 1 of the gRNA. In some embodiments, the third linker substitutes for 1, 2, 3, 4, or 5 base pairs of the hairpin 1 of the gRNA. In some embodiments, the third linker substitutes for 1 base pair of the hairpin 1 of the gRNA. In some embodiments, the third linker substitutes for 2 base pairs of the hairpin 1 of the gRNA. In some embodiments, the third linker substitutes for 3 base pairs of the hairpin 1 of the gRNA. In some embodiments, the third linker substitutes for 4 base pairs of the hairpin 1 of the gRNA. In some embodiments, the third linker substitutes for 5 base pairs of the hairpin 1 of the gRNA.
In some embodiments, the third internal linker substitutes for a loop, or part thereof, of the hairpin 1. In some embodiments, the third internal linker substitutes for the loop and the stem, or part thereof, of the hairpin 1.
In some embodiments, the third internal linker substitutes for 2, 3, or 4 nucleotides of the loop of the hairpin 1. In some embodiments, the first internal linker substitutes for 2 nucleotides of the loop of the hairpin 1. In some embodiments, the first internal linker substitutes for 3 nucleotides of the loop of the hairpin 1. In some embodiments, the first internal linker substitutes for 4 nucleotides of the loop of the hairpin 1.
In some embodiments, the third internal linker substitutes for the loop of the hairpin and at least 1 nucleotide of the stem of the hairpin. In some embodiments, the third internal linker substitutes for the loop of the hairpin and 2, 4, or 6 nucleotides of the stem of the hairpin. In some embodiments, the third internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin and 1, 2, or 3 base pairs of the stem of the hairpin.
In some embodiments, the third internal linker substitutes for all of the nucleotides constituting the loop of the hairpin. In some embodiments, the third internal linker substitutes for all of the nucleotides constituting the loop and the stem of the hairpin.
In some embodiments, a hairpin 2 region of the sgRNA does not contain any internal linker.
In some embodiments, the second internal linker substitutes for 2 nucleotides of a loop of the nexus region of the sgRNA.
In some embodiments, the sgRNA comprises a conserved portion comprising a sequence of SEQ ID NO: 200. In some embodiments, 2, 3 or 4 of nucleotides 33-36 are substituted for the first internal linker relative SEQ ID NO: 200. In some embodiments, nucleotides 32-37 are substituted for the first internal linker relative SEQ ID NO: 200. In some embodiments, nucleotides 31-38 are substituted for the first internal linker relative SEQ ID NO: 200. In some embodiments, nucleotides 30-39 are substituted for the first internal linker relative SEQ ID NO: 200. In some embodiments, nucleotides 29-40 are substituted for the first internal linker relative SEQ ID NO: 200. In some embodiments, nucleotide 55-56 are substituted for the second internal linker relative SEQ ID NO: 200. In some embodiments, 2, 3, or 4 of nucleotides 73-76 are substituted for the third internal linker relative SEQ ID NO: 200. In some embodiments, nucleotides 72-77 are substituted for the third internal linker relative SEQ ID NO: 200. In some embodiments, nucleotides 71-78 are substituted for the third internal linker relative SEQ ID NO: 200. In some embodiments, nucleotides 70-79 are substituted for the third internal linker relative SEQ ID NO: 200. In some embodiments, nucleotides 97-100 are deleted relative SEQ ID NO: 200.
In some embodiments, the sgRNA comprises a sequence of SEQ ID NO: 201. In some embodiments, 2, 3 or 4 of nucleotides 33-36 are substituted for the first internal linker relative SEQ ID NO: 201. In some embodiments, nucleotides 32-37 are substituted for the first internal linker relative SEQ ID NO: 201. In some embodiments, nucleotides 31-38 are substituted for the first internal linker relative SEQ ID NO: 201. In some embodiments, nucleotides 30-39 are substituted for the first internal linker relative SEQ ID NO: 201. In some embodiments, nucleotides 29-40 are substituted for the first internal linker relative SEQ ID NO: 201. In some embodiments, nucleotide 55-56 are substituted for the second internal linker relative SEQ ID NO: 201. In some embodiments, 2, 3, or 4 of nucleotides 50-53 are substituted for the third internal linker relative SEQ ID NO: 201. In some embodiments, nucleotides 49-54 are substituted for the third internal linker relative SEQ ID NO: 201. In some embodiments, nucleotides 77-80 are deleted relative SEQ ID NO: 201.
b. Additional Guide RNAs
In some embodiments, the sgRNA is not from S. pyogenes Cas9 (“non-spyCas9”).
In some embodiments, the guide RNA is a Staphylococcus aureus Cas9 (“SauCas9”) guide RNA. An exemplary SauCas9 sgRNA is shown in
In some embodiments, a sgRNA comprises a guide region and a conserved portion 3′ to the guide region, wherein conserved portion comprises a repeat-anti-repeat region, a hairpin 1 region, and a hairpin 2 region, and further comprises at least one of:
In some embodiments, the sgRNA comprises the first internal linker and the second internal linker. In some embodiments, the sgRNA comprises the first internal linker and the third internal linker. In some embodiments, the sgRNA comprises the second internal linker and the third internal linker. In some embodiments, the sgRNA comprises the first internal linker, the second internal linker, and the third internal linker.
In some embodiments, the first internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms. In some embodiments, the first internal linker is in a hairpin between a first portion of the sgRNA and a second portion of the sgRNA, wherein the first portion and the second portion together form a duplex portion. In some embodiments, the first internal linker substitutes for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the upper stem region. In some embodiments, the first internal linker substitutes for a loop, or part thereof, of the upper stem region. In some embodiments, the first internal linker substitutes for the loop and the stem, or part thereof, of the upper stem region. In some embodiments, the first internal linker substitutes for 2, 3, or 4 nucleotides of the loop of the upper stem region.
In some embodiments, the first internal linker substitutes for the loop of the upper stem region and at least 2, 4, 6, or 8 nucleotides of the stem of the upper stem region. In some embodiments, the first internal linker substitutes for the loop of the upper stem region and 1, 2, 3, or 4 base pairs of the stem of the upper stem region. In some embodiments, the first internal linker substitutes for all of the nucleotides constituting the loop of the upper stem region.
In some embodiments, the second internal linker has a bridging length of about 9-18 atoms. In some embodiments, the second internal linker substitutes for 2 nucleotides of the hairpin 1 of the sgRNA. In some embodiments, the second internal linker substitutes for 2 nucleotides of a stem region of the nexus region of the sgRNA.
In some embodiments, the third internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms. In some embodiments, the third internal linker substitutes for 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the hairpin 2 of the gRNA. In some embodiments, the third linker substitutes for 1, 2, 3, 4, or 5 base pairs of the hairpin 2 of the gRNA. In some embodiments, the internal linker substitutes for 2-6 nucleotides of hairpin 2. In some embodiments, the internal linker substitutes for 2-4 nucleotides of hairpin 2.
In some embodiments, the third internal linker substitutes for a loop, or part thereof, of the hairpin 2. In some embodiments, the third internal linker substitutes for the loop and the stem, or part thereof, of the hairpin 2.
In some embodiments, the third internal linker substitutes for 2, 3, or 4 nucleotides of the loop of the hairpin 2. In some embodiments, the third internal linker substitutes for the loop of the hairpin and at least 1 nucleotide of the stem of the hairpin 2. In some embodiments, the third internal linker substitutes for the loop of the hairpin and 2, 3, 4, 5, or 6 nucleotides of the stem of the hairpin 2. In some embodiments, the third internal linker in the repeat-anti-repeat region substitutes for the loop of the hairpin and 1, 2, or 3 base pairs of the stem of the hairpin 2. In some embodiments, the third internal linker substitutes for all of the nucleotides constituting the loop of the hairpin 2. In some embodiments, the third internal linker is in a hairpin between a first portion of the sgRNA and a second portion of the sgRNA, wherein the first portion and the second portion together form a duplex portion.
In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 202. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 202, including modifications disclosed elsewhere herein.
In some embodiments, 2, 3, or 4 of nucleotides 35-38 are substituted for the first internal linker relative SEQ ID NO: 202. In some embodiments, nucleotides 34-39 are substituted for the first internal linker relative SEQ ID NO: 202. In some embodiments, nucleotides 33-40 are substituted for the first internal linker relative SEQ ID NO: 202. In some embodiments, nucleotides 32-41 are substituted for the first internal linker relative SEQ ID NO: 202. In some embodiments, nucleotides 31-42 are substituted for the first internal linker relative SEQ ID NO: 202. In some embodiments, nucleotide 61-62 are substituted for the second internal linker relative SEQ ID NO: 202. In some embodiments, 2, 3, or 4 of nucleotides 84-87 are substituted for the third internal linker relative SEQ ID NO: 202. In some embodiments, nucleotides 83-88 are substituted for the third internal linker relative SEQ ID NO: 202. In some embodiments, nucleotides 82-89 are substituted for the third internal linker relative SEQ ID NO: 202. In some embodiments, nucleotides 81-90 are substituted for the third internal linker relative SEQ ID NO: 202. In some embodiments, nucleotides 97-100 are deleted relative SEQ ID NO: 202.
In some embodiments, wherein the gRNA is a SauCas9 guide RNA, and does not include the third internal linker.
In some embodiments, the guide RNA is a Corynebacterium diphtheriae Cas9 (“CdiCas9”) guide RNA. In some embodiments, the guide RNA is a modified CdiCas9 guide RNA. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 203. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 203, including modifications disclosed elsewhere herein.
In some embodiments, the gRNA is a C. diphtheriae Cas9 (CdiCas9) guide RNA, an S. thermophilus Cas9 (SthCas9) guide RNA, or an Acidothermus cellulolyticus Cas9 (AceCas9) guide RNA.
In some embodiments, the guide RNA is a Streptococcus thermophilus Cas9 (“St1Cas9” or “SthCas9”) guide RNA. In some embodiments, the guide RNA is a modified St1Cas9 guide RNA. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 204 or 205. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 204 or 205, including modifications disclosed elsewhere herein.
In some embodiments, a sgRNA comprises a guide region and a conserved portion 3′ to the guide region, wherein the conserved portion comprises a repeat-anti-repeat region, a hairpin 1 region, and a hairpin 2 region, and comprises a first internal linker substituting for at least 4 nucleotides of the repeat-anti-repeat region and a second internal linker substituting for at least 3 nucleotides of the hairpin 2.
In some embodiments, the first internal linker has a bridging length of about 15-21 atoms. In some embodiments, the first internal linker substitutes for 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the first internal linker is in a hairpin between a first portion of the sgRNA and a second portion of the repeat-anti-repeat region, wherein the first portion and the second portion together form a duplex portion.
In some embodiments, the first internal linker substitutes for a loop, or part thereof, of the hairpin of the repeat-anti-repeat region. In some embodiments, the first internal linker substitutes for the loop and the stem, or part thereof, of the hairpin of the repeat-anti-repeat region.
In some embodiments, the first internal linker substitutes for 2, 3, or 4 nucleotides of the loop of the hairpin structure of the repeat-anti-repeat region. In some embodiments, the first internal linker substitutes for the loop of the hairpin structure and at least 2, 4, 6, 8, 10, or 12 nucleotides of the stem of the hairpin structure of the repeat-anti-repeat region. In some embodiments, the first internal linker substitutes for the loop of the hairpin structure and 1, 2, 3, 4, 5, or 6 base pairs of the stem of the hairpin structure of the repeat-anti-repeat region. In some embodiments, the first internal linker substitutes for all of the nucleotides constituting the loop of the hairpin structure of the repeat-anti-repeat region. In some embodiments, the first internal linker substitutes for all of the nucleotides constituting the loop and the stem of the hairpin structure of the upper stem region repeat-anti-repeat region (i.e., the portion of the repeat-anti-repeat region above the bulge). In some embodiments, the second internal linker has a bridging length of about 9-30, optionally about 15-21 atoms. In some embodiments, the second internal linker substitutes for 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides of the hairpin 2 of the gRNA. In some embodiments, the second internal linker substitutes for a loop region of the hairpin 2. In some embodiments, the second internal linker substitutes for a loop region and part of a stem region of the hairpin 2. In some embodiments, the second internal linker substitutes for a loop, or part thereof, of the hairpin 2. In some embodiments, the second internal linker substitutes for the loop and the stem, or part thereof, of the hairpin 2. In some embodiments, the second internal linker substitutes for 2, 3, or 4 nucleotides of the loop of the hairpin 2. In some embodiments, the second internal linker substitutes for all of the nucleotides constituting the loop of the hairpin 2. In some embodiments, the second internal linker substitutes for the loop of the hairpin 2 and at least 1, 2, 3, 4, 5, or 6 nucleotides of the stem of the hairpin 2. In some embodiments, the second internal linker substitutes for the loop of the hairpin and 1, 2, or 3 base pairs of the stem of the hairpin 2.
In some embodiments, the sgRNA comprises a sequence of SEQ ID NO: 204. In some embodiments, nucleotides 41-44 are substituted for the first internal linker relative SEQ ID NO: 204. In some embodiments, nucleotides 101-103 are substituted for the second internal linker relative SEQ ID NO: 204. In some embodiments, 2-18 nucleotides within nucleotides 94-111 are substituted relative to SEQ ID NO: 204.
In some embodiments, the guide RNA is a A. cellulolyticus Cas9 (“AceCas9”) guide RNA. In some embodiments, the guide RNA is a modified AceCas9 guide RNA. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 206. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 206, including modifications disclosed elsewhere herein.
In some embodiments, the guide RNA is a Campylobacter jejuni Cas9 (“CjeCas9”) guide RNA. In some embodiments, the guide RNA is a modified CjeCas9 guide RNA.
In some embodiments, a gRNA comprises a guide region and a conserved portion 3′ to the guide region, wherein the conserved portion comprises a repeat-anti-repeat region and a hairpin region, and comprises an internal linker substituting for at least 4 nucleotides of the repeat-anti-repeat region. In some embodiments, the first internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms. In some embodiments, the first internal linker substitutes for 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the repeat-anti-repeat region of the gRNA. In some embodiments, the first internal linker is in a hairpin structure between a first portion of the sgRNA and a second portion of the repeat-anti-repeat region, wherein the first portion and the second portion together form a duplex portion.
In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 207. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 207, including modifications disclosed elsewhere herein. In some embodiments, wherein nucleotides 33-36 are substituted for the internal linker relative to SEQ ID NO: 207. In some embodiments, 1, 2, 3, 4, 5, or 6 base pairs of nucleotides 27-32 and 37-42 are substituted for the internal linker relative to SEQ ID NO: 207.
In some embodiments, the Cpf1 guide RNA is a Francisella novicida Cas9 (“FnoCas9”) guide RNA. In some embodiments, the guide RNA is a modified FnoCas9guide RNA.
In some embodiments, a gRNA comprises a repeat-anti-repeat region, and an internal linker substituting for at least 4 nucleotides of the repeat-anti-repeat region. In some embodiments, the internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms. In some embodiments, the internal linker substitutes for 3, 4, 5, or 6 nucleotides of the repeat-anti-repeat region of the gRNA.
In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 208. In some embodiments, the guide RNA comprises a nucleic acid sequence of SEQ ID NO: 208, including modifications disclosed elsewhere herein. In some embodiments, 2, 3, or 4 of nucleotides 40-43 are substituted for the internal linker relative SEQ ID NO: 208. In some embodiments, wherein nucleotides 39-44 are substituted for the internal linker relative SEQ ID NO: 208.
Type VI, Cpf1 Guide RNAs
In some embodiments, the gRNA is a Cpf1 guide RNA. In some embodiments, the guide RNA is a AsCpf1/Cas12a guide RNA. An exemplary AsCpf1/Cas12a sgRNA is shown in
In some embodiments, the guide RNA is a Eubacterium siraeum (Es) Cas13d (EsCas13d) guide RNA. An exemplary EsCas13d sgRNA is shown in
An exemplary Nme sgRNA is shown in
Various exemplary sgRNAs comprising at least one internal linker are provided in Tables 2A-2B. Nucleotide modifications are indicated in Tables 2A-2B as follows: m: 2′-OMe; *: PS linkage. Thus, for example, mA represents 2′-O-methyl adenosine.
When unmodified nucleotide sequences are provided, A, C, G, and U are independently unmodified or modified RNA nucleotides. When modified nucleotide sequences are provided, in certain embodiments, A, C, G, and U unmodified RNA nucleotides. When modified nucleotide sequences are provided, in certain embodiments, A, C, G, and U are independently unmodified or modified RNA nucleotides.
In the tables herein, L1 and L2, are optionally, C9 and C18, respectively as follows:
sgRNA designations are sometimes provided with one or more leading zeroes immediately following the G. This does not affect the meaning of the designation. Thus, for example, G000282, G0282, G00282, and G282 refer to the same sgRNA. Similarly, crRNA and or trRNA designations are sometimes provided with one or more leading zeroes immediately following the CR or TR, respectively, which does not affect the meaning of the designation. Thus, for example, CR000100, CR00100, CR0100, and CR100 refer to the same crRNA, and TR000200, TR00200, TR0200, and TR200 refer to the same trRNA.
Exemplary SpyCas9 guide RNAs comprising internal linkers are provided in Tables 2A-2C. As used herein, “Linker 1” or “L1” refers to an internal linker having a bridging length of about 15-21 atoms. As used herein, “Linker 2” or “L2” refers to an internal linker having a bridging length of about 6-12 atoms (e.g., about 9 atoms); “Linker 3” or “L3” refers to an internal linker has a bridging length of about 6 atoms; “Linker 4” or “L4” refers to an internal linker has a bridging length of about 3 atoms; “dS” refers to an abasic nucleoside
Nucleotide modifications are indicated in Tables 2A-2C as follows: m: 2′-OMe; and *: PS linkage. As used herein, “N” may be any natural or non-natural nucleotide. For example, encompassed herein is SEQ ID NO: 230 in Table 2C, where the N's are replaced with any of the guide sequences disclosed herein. The modifications remain as shown in SEQ ID NO: 230 despite the substitution of N's for the nucleotides of a guide. That is, although the nucleotides of the guide replace the “N's”, the first three nucleotides are 2′-O-Me modified and there are phosphorothioate linkages between the first and second nucleotides, the second and third nucleotides and the third and fourth nucleotides.
E. Types of Chemical Modifications Described Herein
Guide RNAs (e.g., sgRNAs, dgRNAs, and crRNAs) comprising modifications at various positions are disclosed herein. In some embodiments, a position of a gRNA that comprises a modification is modified with any one or more of the following types of modifications.
2′-O-Methyl Modifications
Modified sugars are believed to control the puckering of nucleotide sugar rings, a physical property that influences oligonucleotide binding affinity for complementary strands, duplex formation, and interaction with nucleases. Substitutions on sugar rings can therefore alter the conformation and puckering of these sugars. For example, 2′-O-methyl (2′-OMe) modifications can increase binding affinity and nuclease stability of oligonucleotides, though as shown in the Examples, the effect of any modification at a given position in an oligonucleotide needs to be empirically determined.
The terms “mA,” “mC,” “mU,” or “mG” may be used to denote a nucleotide that has been modified with 2′-OMe.
A ribonucleotide and a modified 2′-O-methyl ribonucleotide can be depicted as follows:
2′-O-(2-Methoxyethyl) Modifications
In some embodiments, the modification may be 2′-O-(2-methoxyethyl) (2′-O-moe). A modified 2′-O-moe ribonucleotide can be depicted as follows:
The terms “moeA,” “moeC,” “moeU,” or “moeG” may be used to denote a nucleotide that has been modified with 2′-O-moe.
2′-Fluoro Modifications
Another chemical modification that has been shown to influence nucleotide sugar rings is halogen substitution. For example, 2′-fluoro (2′-F) substitution on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability.
In this application, the terms “fA,” “fC,” “fJ,” or “fG” may be used to denote a nucleotide that has been substituted with 2′-F.
A ribonucleotide without and with a 2′-F substitution can be depicted as follows:
Phosphorothioate Modifications
A phosphorothioate (PS) linkage or bond refers to a bond where a sulfur is substituted for one nonbridging phosphate oxygen in a phosphodiester linkage, for example between nucleotides. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.
A “*” may be used to depict a PS modification. In this application, the terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (e.g., 3′) nucleotide with a PS bond. Throughout this application, PS modifications are grouped with the nucleotide whose 3′ carbon is bonded to the phosphorothioate; thus, indicating that a PS modification is at position 1 means that the phosphorothioate is bonded to the 3′ carbon of nucleotide 1 and the 5′ carbon of nucleotide 2. Thus, where a YA site is indicated as being “PS modified” or the like, the PS linkage is between the Y and A or between the A and the next nucleotide.
In this application, the terms “mA*,” “mC*,” “mU*,” or “mG*” may be used to denote a nucleotide that has been substituted with 2′-OMe and that is linked to the next (e.g., 3′) nucleotide with a PS linkage, which may sometimes be referred to as a “PS bond.” Similarly, the terms “fA*,” “fC*,” “fU*,” or “fG*” may be used to denote a nucleotide that has been substituted with 2′-F and that is linked to the next (e.g., 3′) nucleotide with a PS linkage. Equivalents of a PS linkage or bond are encompassed by embodiments described herein.
The diagram below shows the substitution of S— for a nonbridging phosphate oxygen, generating a PS linkage in lieu of a phosphodiester linkage:
Inverted Abasic Modifications
Abasic nucleotides refer to those which lack nitrogenous bases. As abasic nucleotides cannot form a base pair, they do not disrupt formation of a structure by the unpaired nucleotides, e.g., a bulge, a loop. The figure below depicts an oligonucleotide with an abasic (in this case, shown as apurinic; an abasic site could also be an apyrimidinic site, wherein the description of the abasic site is typically in reference to Watson-Crick base pairing—e.g., an apurinic site refers to a site that lacks a nitrogenous base and would typically base pair with a pyrimidinic site) site that lacks a base, wherein the base may be substituted by another moiety at the 1′ position of the furan ring (e.g., a hydroxyl group, as shown below, to form a ribose or deoxyribose site, as shown below, or a hydrogen):
Inverted bases refer to those with linkages that are inverted from the normal 5′ to 3′ linkage (i.e., either a 5′ to 5′ linkage or a 3′ to 3′ linkage). For example:
An abasic nucleotide can be attached with an inverted linkage. For example, an abasic nucleotide may be attached to the terminal 5′ nucleotide via a 5′ to 5′ linkage, or an abasic nucleotide may be attached to the terminal 3′ nucleotide via a 3′ to 3′ linkage. An inverted abasic nucleotide at either the terminal 5′ or 3′ nucleotide may also be called an inverted abasic end cap. In this application, the terms “invd” indicates an inverted abasic nucleotide linkage.
Deoxyribonucleotides
A deoxyribonucleotide (in which the sugar comprises a 2′-deoxy position) is considered a modification in the context of a gRNA, in that the nucleotide is modified relative to standard RNA by the substitution of a proton for a hydroxyl at the 2′ position. Unless otherwise indicated, a deoxyribonucleotide modification at a position that is U in an unmodified RNA can also comprise replacement of the U nucleobase with a T.
Bicyclic Ribose Analog
Exemplary bicyclic ribose analogs include locked nucleic acid (LNA), ENA, bridged nucleic acid (BNA), or another LNA-like modifications. In some instances, a bicyclic ribose analog has 2′ and 4′ positions connected through a linker. The linker can be of the formula —X—(CH2)n— where n is 1 or 2; X is O, NR, or S; and R is H or C1-3 alkyl, e.g., methyl. Examples of bicyclic ribose analogs include LNAs comprising a 2′-O—CH2-4′ bicyclic structure (oxy-LNA) (see WO 98/39352 and WO 99/14226); 2′-NH—CH2-4′ or 2′-N(CH3)—CH2-4′ (amino-LNAs) (Singh et al., J. Org. Chem. 63:10035-10039 (1998); Singh et al., J. Org. Chem. 63:6078-6079 (1998)); and 2′-S—CH2-4′ (thio-LNA) (Singh et al., J. Org. Chem. 63:6078-6079 (1998); Kumar et al., Biorg. Med. Chem. Lett. 8:2219-2222 (1998)). ENA
An ENA modification refers to a nucleotide comprising a 2′-O,4′-C-ethylene modification. An exemplary structure of an ENA nucleotide is shown below, in which wavy lines indicate connections to the adjacent nucleotides (or terminal positions as the case may be, with the understanding that if the 3′ terminal nucleotide is an ENA nucleotide, the 3′ position may comprise a hydroxyl rather than phosphate). For further discussion of ENA nucleotides, see, e.g., Koizumi et al., Nucleic Acids Res. 31: 3267-3273 (2003).
A UNA or unlocked nucleic acid modification refers to a nucleotide comprising a 2′,3′-seco-RNA modification, in which the 2′ and 3′ carbons are not bonded directly to each other. An exemplary structure of a UNA nucleotide is shown below, in which wavy lines indicate connections to the adjacent phosphates or modifications replacing phosphates (or terminal positions as the case may be). For further discussion of UNA nucleotides, see, e.g., Snead et al., Molecular Therapy 2: e103, doi:10.1038/mtna.2013.36 (2013).
A base modification is any modification that alters the structure of a nucleobase or its bond to the backbone, including isomerization (as in pseudouridine). In some embodiments, a base modification includes inosine. In some embodiments, a modification comprises a base modification that reduces RNA endonuclease activity, e.g., by interfering with recognition of a cleavage site by an RNase or by stabilizing an RNA structure (e.g., secondary structure) that decreases accessibility of a cleavage site to an RNase. Exemplary base modifications that can stabilize RNA structures are pseudouridine and 5-methylcytosine. See Peacock et al., J Org Chem. 76: 7295-7300 (2011). In some embodiments, a base modification can increase or decrease the melting temperature (Tm) of a nucleic acid, e.g., by increasing the hydrogen bonding in a Watson-Crick base pair, forming non-canonical base pair, or creating a mismatched base pair.
The above modifications and their equivalents are included within the scope of the embodiments described herein.
A modification at a YA site (also referred to as a YA modification) can be a modification of the internucleoside linkage, a modification of the base (pyrimidine or adenine), e.g. by chemical modification, substitution, or otherwise, or a modification of the sugar (e.g. at the 2′ position, such as 2′-O-alkyl, 2′-F, 2′-moe, 2′-F arabinose, 2′-H (deoxyribose), and the like). In some embodiments, a “YA modification” is any modification that alters the structure of the dinucleotide motif to reduce RNA endonuclease activity, e.g., by interfering with recognition or cleavage of a YA site by an RNase or by stabilizing an RNA structure (e.g., secondary structure) that decreases accessibility of a cleavage site to an RNase. See Peacock et al., J Org Chem. 76: 7295-7300 (2011); Behlke, Oligonucleotides 18:305-320 (2008); Ku et al., Adv. Drug Delivery Reviews 104: 16-28 (2016); Ghidini et al., Chem. Commun., 2013, 49, 9036. Peacock et al., Belhke, Ku, and Ghidini provide exemplary modifications suitable as YA modifications. Modifications known to those of skill in the art to reduce endonucleolytic degradation are encompassed. Exemplary 2′ ribose modifications that affect the 2′ hydroxyl group involved in RNase cleavage are 2′-H and 2′-O-alkyl, including 2′-O-Me. Modifications such as bicyclic ribose analogs, UNA, and modified internucleoside linkages of the residues at the YA site can be YA modifications. Exemplary base modifications that can stabilize RNA structures are pseudouridine and 5-methylcytosine. In some embodiments, at least one nucleotide of the YA site is modified. In some embodiments, the pyrimidine (also called “pyrimidine position”) of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the pyrimidine, a modification of the pyrimidine base, and a modification of the ribose, e.g. at its 2′ position). In some embodiments, the adenine (also called “adenine position”) of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the pyrimidine, a modification of the pyrimidine base, and a modification of the ribose, e.g. at its 2′ position). In some embodiments, the pyrimidine and the adenine of the YA site comprise modifications. In some embodiments, the YA modification reduces RNA endonuclease activity.
The above modifications and their equivalents are included within the scope of the embodiments described herein.
Modifications of Guide Regions or YA Sites
In some embodiments, a gRNA comprises modifications at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more YA sites. In some embodiments, the pyrimidine of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the pyrimidine). In some embodiments, the adenine of the YA site comprises a modification (which includes a modification altering the internucleoside linkage immediately 3′ of the sugar of the adenine). In some embodiments, the pyrimidine and the adenine of the YA site comprise modifications, such as sugar, base, or internucleoside linkage modifications. The YA modifications can be any of the types of modifications set forth herein. In some embodiments, the YA modifications comprise one or more of phosphorothioate, 2′-OMe, or 2′-fluoro. In some embodiments, the YA modifications comprise pyrimidine modifications comprising one or more of phosphorothioate, 2′-OMe, 2′-H, inosine, or 2′-fluoro. In some embodiments, the YA modification comprises a bicyclic ribose analog (e.g., an LNA, BNA, or ENA) within an RNA duplex region that contains one or more YA sites. In some embodiments, the YA modification comprises a bicyclic ribose analog (e.g., an LNA, BNA, or ENA) within an RNA duplex region that contains a YA site, wherein the YA modification is distal to the YA site.
The guide region of a gRNA may be modified according to any embodiment comprising a modified guide region set forth herein. In some embodiments, the guide region comprises 1, 2, 3, 4, 5, or more YA sites (“guide region YA sites”) that may comprise YA modifications. In some embodiments, the modified guide region YA sites comprise modifications as described for YA sites above. Additional embodiments of guide region modifications, including guide region YA site modifications, are set forth elsewhere herein. Any embodiments set forth elsewhere in this disclosure may be combined to the extent feasible with any of the foregoing embodiments.
Modifications to Terminal Nucleotides
In some embodiments, the 5′ or 3′ terminus regions of a gRNA are modified.
3′ Terminus Region Modifications
In some embodiments, the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in the 3′ terminus region are modified. Throughout, this modification may be referred to as a “3′ end modification”. In some embodiments, the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in the 3′ terminus region comprise more than one modification. In some embodiments, at least one of the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in the 3′ terminus region are modified. In some embodiments, at least two of the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in the 3′ terminus region are modified. In some embodiments, at least three of the terminal (i.e., last) 1, 2, 3, 4, 5, 6, or 7 nucleotides in the 3′ terminus region are modified. In some embodiments, the modification comprises a PS linkage. In some embodiments, the modification to the 3′ terminus region is a 3′ protective end modification. In some embodiments, the 3′ end modification comprises a 3′ protective end modification.
In some embodiments, the 3′ end modification comprises a modified nucleotide selected from 2′-O-methyl (2′-O-Me) modified nucleotide, 2′-O-(2-methoxyethyl) (2′-O-moe) modified nucleotide, a 2′-fluoro (2′-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or combinations thereof.
In some embodiments, the 3′ end modification comprises or further comprises a 2′-O-methyl (2′-O-Me) modified nucleotide.
In some embodiments, the 3′ end modification comprises or further comprises a 2′-fluoro (2′-F) modified nucleotide.
In some embodiments, the 3′ end modification comprises or further comprises a phosphorothioate (PS) linkage between nucleotides.
In some embodiments, the 3′ end modification comprises or further comprises an inverted abasic modified nucleotide.
In some embodiments, the 3′ end modification comprises or further comprises a modification of any one or more of the last 7, 6, 5, 4, 3, 2, or 1 nucleotides. In some embodiments, the 3′ end modification comprises or further comprises one modified nucleotide. In some embodiments, the 3′ end modification comprises or further comprises two modified nucleotides. In some embodiments, the 3′ end modification comprises or further comprises three modified nucleotides. In some embodiments, the 3′ end modification comprises or further comprises four modified nucleotides. In some embodiments, the 3′ end modification comprises or further comprises five modified nucleotides. In some embodiments, the 3′ end modification comprises or further comprises six modified nucleotides. In some embodiments, the 3′ end modification comprises or further comprises seven modified nucleotides.
In some embodiments, the 3′ end modification comprises or further comprises a modification of between 1 and 7 or between 1 and 5 nucleotides.
In some embodiments, the 3′ end modification comprises or further comprises modifications of 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 3′ end of the gRNA.
In some embodiments, the 3′ end modification comprises or further comprises modifications of about 1-3, 1-5, 1-6, or 1-7 nucleotides at the 3′ end of the gRNA.
In some embodiments, the 3′ end modification comprises or further comprises any one or more of the following: a phosphorothioate (PS) linkage between nucleotides, a 2′-O-Me modified nucleotide, a 2′-O-moe modified nucleotide, a 2′-F modified nucleotide, an inverted abasic modified nucleotide, and a combination thereof.
In some embodiments, the 3′ end modification comprises or further comprises 1, 2, 3, 4, 5, 6, or 7 PS linkages between nucleotides.
In some embodiments, the 3′ end modification comprises or further comprises at least one 2′-O-Me, 2′-O-moe, inverted abasic, or 2′-F modified nucleotide. In some embodiments, the 3′ end modification comprises or further comprises one PS linkage, wherein the linkage is between the last and second to last nucleotide. In some embodiments, the 3′ end modification comprises or further comprises two PS linkages between the last three nucleotides. In some embodiments, the 3′ end modification comprises or further comprises four PS linkages between the last four nucleotides.
In some embodiments, the 3′ end modification comprises or further comprises PS linkages between any one or more of the last four nucleotides. In some embodiments, the 3′ end modification comprises or further comprises PS linkages between any one or more of the last five nucleotides. In some embodiments, the 3′ end modification comprises or further comprises PS linkages between any one or more of the last 2, 3, 4, 5, 6, or 7 nucleotides.
In some embodiments, the 3′ end modification comprises or further comprises a modification of one or more of the last 1-7 nucleotides, wherein the modification is a PS linkage, inverted abasic nucleotide, 2′-OMe, 2′-O-moe, 2′-F, or combinations thereof.
In some embodiments, the 3′ end modification comprises or further comprises a modification to the last nucleotide with 2′-OMe, 2′-O-moe, 2′-F, or combinations thereof, and an optionally one or two PS linkages to the next nucleotide or the first nucleotide of the 3′ tail.
In some embodiments, the 3′ end modification comprises or further comprises a modification to the last or second to last nucleotide with 2′-OMe, 2′-O-moe, 2′-F, or combinations thereof, and optionally one or more PS linkages.
In some embodiments, the 3′ end modification comprises or further comprises a modification to the last, second to last, or third to last nucleotides with 2′-OMe, 2′-O-moe, 2′-F, or combinations thereof, and optionally one or more PS linkages.
In some embodiments, the 3′ end modification comprises or further comprises a modification to the last, second to last, third to last, or fourth to last nucleotides with 2′-OMe, 2′-O-moe, 2′-F, or combinations thereof, and optionally one or more PS linkages.
In some embodiments, the 3′ end modification comprises or further comprises a modification to the last, second to last, third to last, fourth to last, or fifth to last nucleotides with 2′-OMe, 2′-O-moe, 2′-F, or combinations thereof, and optionally one or more PS linkages.
In certain embodiments, the 3′ end modification comprises 2′-O-Me modifications and PS modifications. In some embodiments, the 3′ end modification comprises the same number of 2′-O-Me modifications and PS modifications. In some embodiments, the 3′ end modification comprises one more 2′-O-Me modification than PS modification. In some embodiments, the 3′ end modification comprises one fewer 2′-O-Me modification than PS modification. In certain embodiments, the 3′ end modification comprises 4 2′-O-Me modifications. In certain embodiments, the 3′ end modification comprises 3 2′-O-Me modifications.
In some embodiments, the gRNA comprising a 3′ end modification comprises or further comprises a 3′ tail, wherein the 3′ tail comprises a modification of any one or more of the nucleotides present in the 3′ tail. In some embodiments, the 3′ tail is fully modified. In some embodiments, the 3′ tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 nucleotides, optionally where any one or more of these nucleotides are modified.
3′ Tail
In some embodiments, the gRNA comprises a 3′ terminus comprising a 3′ tail, which follows and is 3′ of the conserved portion of a gRNA. In some embodiments, the 3′ tail comprises between 1 and about 20 nucleotides, between 1 and about 15 nucleotides, between 1 and about 10 nucleotides, between 1 and about 5 nucleotides, between 1 and about 4 nucleotides, between 1 and about 3 nucleotides, and between 1 and about 2 nucleotides. In some embodiments, the 3′ tail comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the 3′ tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the 3′ tail comprises 1 nucleotide. In some embodiments, the 3′ tail comprises 2 nucleotides. In some embodiments, the 3′ tail comprises 3 nucleotides. In some embodiments, the 3′ tail comprises 4 nucleotides. In some embodiments, the 3′ tail comprises about 1-2, 1-3, 1-4, 1-5, 1-7, 1-10, at least 1-5, at least 1-3, at least 1-4, at least 1-5, at least 1-5, at least 1-7, or at least 1-10 nucleotides. In some embodiments, the tail terminates with a nucleotide comprising a uracil or a modified uracil. In some embodiments, the 3′ tail is 1 nucleotide in length and is a nucleotide comprising a uracil or a modified uracil. In some embodiments, the 3′ nucleotide of the gRNA is a nucleotide comprising a uracil or a modified uracil.
In some embodiments, the 3′ tail comprising 1-20 nucleotides and follows the 3′ end of the conserved portion of a gRNA.
In some embodiments, the 3′ tail comprises or further comprises one or more of a protective end modification, a phosphorothioate (PS) linkage between nucleotides, a 2′-OMe modified nucleotide, a 2′-O-moe modified nucleotide, a 2′-F modified nucleotide, an inverted abasic modified nucleotide, and a combination thereof.
In some embodiments, the 3′ tail comprises or further comprises one or more phosphorothioate (PS) linkages between nucleotides. In some embodiments, the 3′ tail comprises or further comprises one or more 2′-OMe modified nucleotides. In some embodiments, the 3′ tail comprises or further comprises one or more 2′-O-moe modified nucleotides. In some embodiments, the 3′ tail comprises or further comprises one or more 2′-F modified nucleotide. In some embodiments, the 3′ tail comprises or further comprises one or more an inverted abasic modified nucleotides. In some embodiments, the 3′ tail comprises or further comprises one or more protective end modifications. In some embodiments, the 3′ tail comprises or further comprises a combination of one or more of a phosphorothioate (PS) linkage between nucleotides, a 2′-OMe modified nucleotide, a 2′-O-moe modified nucleotide, a 2′-F modified nucleotide, and an inverted abasic modified nucleotide.
In some embodiments, the gRNA does not comprise a 3′ tail.
5′ Terminus Region Modifications
In some embodiments, the 5′ terminus region is modified, for example, the first 1, 2, 3, 4, 5, 6, or 7 nucleotides of the gRNA are modified. Throughout, this modification may be referred to as a “5′ end modification”. In some embodiments, the first 1, 2, 3, 4, 5, 6, or 7 nucleotides of the 5′ terminus region comprise more than one modification. In some embodiments, at least one of the terminal (i.e., first) 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5′ end are modified. In some embodiments, at least two of the terminal 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5′ terminus region are modified. In some embodiments, at least three of the terminal 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5′ terminus region are modified. In some embodiments, the 5′ end modification is a 5′ protective end modification.
In some embodiments, both the 5′ and 3′ terminus regions (e.g., ends) of the gRNA are modified. In some embodiments, only the 5′ terminus region of the gRNA is modified. In some embodiments, only the 3′ terminus region (plus or minus a 3′ tail) of the conserved portion of a gRNA is modified.
In some embodiments, the gRNA comprises modifications at 1, 2, 3, 4, 5, 6, or 7 of the first 7 nucleotides at a 5′ terminus region of the gRNA. In some embodiments, the gRNA comprises modifications at 1, 2, 3, 4, 5, 6, or 7 of the 7 terminal nucleotides at a 3′ terminus region. In some embodiments, 2, 3, or 4 of the first 4 nucleotides at the 5′ terminus region, or 2, 3, or 4 of the terminal 4 nucleotides at the 3′ terminus region are modified. In some embodiments, 2, 3, or 4 of the first 4 nucleotides at the 5′ terminus region are linked with phosphorothioate (PS) bonds.
In some embodiments, the modification to the 5′ terminus or 3′ terminus comprises a 2′-O-methyl (2′-O-Me) or 2′-O-(2-methoxyethyl) (2′-O-moe) modification. In some embodiments, the modification comprises a 2′-fluoro (2′-F) modification to a nucleotide. In some embodiments, the modification comprises a phosphorothioate (PS) linkage between nucleotides. In some embodiments, the modification comprises an inverted abasic nucleotide. In some embodiments, the modification comprises a protective end modification. In some embodiments, the modification comprises a more than one modification selected from protective end modification, 2′-O-Me, 2′-O-moe, 2′-fluoro (2′-F), a phosphorothioate (PS) linkage between nucleotides, and an inverted abasic nucleotide. In some embodiments, an equivalent modification is encompassed.
In some embodiments, the gRNA comprises one or more phosphorothioate (PS) linkages between the first one, two, three, four, five, six, or seven nucleotides at the 5′ terminus. In some embodiments, the gRNA comprises one or more PS linkages between the last one, two, three, four, five, six, or seven nucleotides at the 3′ terminus. In some embodiments, the gRNA comprises one or more PS linkages between both the last one, two, three, four, five, six, or seven nucleotides at the 3′ terminus and the first one, two, three, four, five, six, or seven nucleotides from the 5′ end of the 5′ terminus. In some embodiments, in addition to PS linkages, the 5′ and 3′ terminal nucleotides may comprise 2′-O-Me, 2′-O-moe, or 2′-F modified nucleotides.
In some embodiments, the gRNA comprises a 5′ end modification, e.g., wherein the first nucleotide of the guide region is modified. In some embodiments, the gRNA comprises a 5′ end modification, wherein the first nucleotide of the guide region comprises a 5′ protective end modification.
In some embodiments, the 5′ end modification comprises a modified nucleotide selected from 2′-O-methyl (2′-O-Me) modified nucleotide, 2′-O-(2-methoxyethyl) (2′-O-moe) modified nucleotide, a 2′-fluoro (2′-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, an inverted abasic modified nucleotide, or combinations thereof.
In some embodiments, the 5′ end modification comprises or further comprises a 2′-O-methyl (2′-O-Me) modified nucleotide.
In some embodiments, the 5′ end modification comprises or further comprises a 2′-fluoro (2′-F) modified nucleotide.
In some embodiments, the 5′ end modification comprises or further comprises a phosphorothioate (PS) linkage between nucleotides.
In some embodiments, the 5′ end modification comprises or further comprises an inverted abasic modified nucleotide.
In some embodiments, the 5′ end modification comprises or further comprises a modification of any one or more of nucleotides 1-7 of the guide region of a gRNA. In some embodiments, the 5′ end modification comprises or further comprises one modified nucleotide. In some embodiments, the 5′ end modification comprises or further comprises two modified nucleotides. In some embodiments, the 5′ end modification comprises or further comprises three modified nucleotides. In some embodiments, the 5′ end modification comprises or further comprises four modified nucleotides. In some embodiments, the 5′ end modification comprises or further comprises five modified nucleotides. In some embodiments, the 5′ end modification comprises or further comprises six modified nucleotides. In some embodiments, the 5′ end modification comprises or further comprises seven modified nucleotides.
In some embodiments, the 5′ end modification comprises or further comprises a modification of between 1 and 7, between 1 and 5, between 1 and 4, between 1 and 3, or between 1 and 2 nucleotides.
In some embodiments, the 5′ end modification comprises or further comprises modifications of 1, 2, 3, 4, 5, 6, or 7 nucleotides from the 5′ end. In some embodiments, the 5′ end modification comprises or further comprises modifications of about 1-3, 1-4, 1-5, 1-6, or 1-7 nucleotides from the 5′ end.
In some embodiments, the 5′ end modification comprises or further comprises modifications at the first nucleotide at the 5′ end of the gRNA. In some embodiments, the 5′ end modification comprises or further comprises modifications at the first and second nucleotide from the 5′ end of the gRNA. In some embodiments, the 5′ end modification comprises or further comprises modifications at the first, second, and third nucleotide from the 5′ end of the gRNA. In some embodiments, the 5′ end modification comprises or further comprises modifications at the first, second, third, and fourth nucleotide from the 5′ end of the gRNA. In some embodiments, the 5′ end modification comprises or further comprises modifications at the first, second, third, fourth, and fifth nucleotide from the 5′ end of the gRNA. In some embodiments, the 5′ end modification comprises or further comprises modifications at the first, second, third, fourth, fifth, and sixth nucleotide from the 5′ end of the gRNA. In some embodiments, the 5′ end modification comprises or further comprises modifications at the first, second, third, fourth, fifth, sixth, and seventh nucleotide from the 5′ end of the gRNA.
In some embodiments, the 5′ end modification comprises or further comprises a phosphorothioate (PS) linkage between nucleotides, or a 2′-O-Me modified nucleotide, or a 2′-O-moe modified nucleotide, or a 2′-F modified nucleotide, or an inverted abasic modified nucleotide, or combinations thereof.
In some embodiments, the 5′ end modification comprises or further comprises 1, 2, 3, 4, 5, 6, or 7 PS linkages between nucleotides. In some embodiments, the 5′ end modification comprises or further comprises about 1-2, 1-3, 1-4, 1-5, 1-6, or 1-7 PS linkages between nucleotides.
In some embodiments, the 5′ end modification comprises or further comprises at least one PS linkage, wherein if there is one PS linkage, the linkage is between nucleotides 1 and 2 of the guide region.
In some embodiments, the 5′ end modification comprises or further comprises at least two PS linkages, and the linkages are between nucleotides 1 and 2, and 2 and 3 of the guide region.
In some embodiments, the 5′ end modification comprises or further comprises PS linkages between any one or more of nucleotides 1 and 2, 2 and 3, and 3 and 4 of the guide region.
In some embodiments, the 5′ end modification comprises or further comprises PS linkages between any one or more of nucleotides 1 and 2, 2 and 3, 3 and 4, and 4 and 5 of the guide region.
In some embodiments, the 5′ end modification comprises or further comprises PS linkages between any one or more of nucleotides 1 and 2, 2 and 3, 3 and 4, 4 and 5, and 5 and 6 of the guide region.
In some embodiments, the 5′ end modification comprises or further comprises PS linkages between any one or more of nucleotides 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, and 7 and 8 of the guide region.
In some embodiments, the 5′ end modification comprises or further comprises a modification of one or more of nucleotides 1-7 of the guide region, wherein the modification is a PS linkage, inverted abasic nucleotide, 2′-O-Me, 2′-O-moe, 2′-F, or combinations thereof.
In some embodiments, the 5′ end modification comprises or further comprises a modification to the first nucleotide of the guide region with 2′-O-Me, 2′-O-moe, 2′-F, or combinations thereof, and an optional PS linkage to the next nucleotide;
In some embodiments, the 5′ end modification comprises or further comprises a modification to the first or second nucleotide of the guide region with 2′-O-Me, 2′-O-moe, 2′-F, or combinations thereof, and optionally one or more PS linkages between the first and second nucleotide or between the second and third nucleotide.
In some embodiments, the 5′ end modification comprises or further comprises a modification to the first, second, or third nucleotides of the variable region with 2′-O-Me, 2′-O-moe, 2′-F, or combinations thereof, and optionally one or more PS linkages between the first and second nucleotide, between the second and third nucleotide, or between the third and the fourth nucleotide.
In some embodiments, the 5′ end modification comprises or further comprises a modification to the first, second, third, or fourth nucleotides of the variable region with 2′-O-Me, 2′-O-moe, 2′-F, or combinations thereof, and optionally one or more PS linkages between the first and second nucleotide, between the second and third nucleotide, between the third and the fourth nucleotide, or between the fourth and the fifth nucleotide.
In some embodiments, the 5′ end modification comprises or further comprises a modification to the first, second, third, fourth, or fifth nucleotides of the variable region with 2′-O-Me, 2′-O-moe, 2′-F, or combinations thereof, and optionally one or more PS linkages between the first and second nucleotide, between the second and third nucleotide, between the third and the fourth nucleotide, between the fourth and the fifth nucleotide, or between the fifth and the sixth nucleotide.
Repeat-Anti-Repeat Region Modifications
In some embodiments, a gRNA is provided comprising a repeat-anti-repeat region modification, wherein the repeat-anti-repeat region modification comprises a modification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all 12 nucleotides in the repeat-anti-repeat region.
In some embodiments, a gRNA is provided comprising a repeat-anti-repeat region modification, wherein the repeat-anti-repeat region modification comprises a modification of about 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, or 1-12 nucleotides in the repeat-anti-repeat region region.
In some embodiments, a gRNA is provided comprising a repeat-anti-repeat region modification, wherein the upper stem modification comprises a 2′-OMe modified nucleotide. In some embodiments, a gRNA is provided comprising a repeat-anti-repeat region modification, wherein the upper stem modification comprises a 2′-O-moe modified nucleotide. In some embodiments, a gRNA is provided comprising a repeat-anti-repeat region modification, wherein the upper stem modification comprises a 2′-F modified nucleotide.
In some embodiments, a gRNA is provided comprising a repeat-anti-repeat region modification, wherein the repeat-anti-repeat region modification comprises a 2′-OMe modified nucleotide, a 2′-O-moe modified nucleotide, a 2′-F modified nucleotide, or combinations thereof.
In some embodiments, the gRNA comprises a 5′ end modification and a repeat-anti-repeat region modification. In some embodiments, the gRNA comprises a 3′ end modification and a repeat-anti-repeat region modification. In some embodiments, the gRNA comprises a 5′ end modification, a 3′ end modification and an upper stem modification.
Hairpin Modifications
In some embodiments, the gRNA comprises a modification in the hairpin region. In some embodiments, the hairpin region modification comprises at least one modified nucleotide selected from a 2′-O-methyl (2′-OMe) modified nucleotide, a 2′-fluoro (2′-F) modified nucleotide, or combinations thereof.
In some embodiments, the hairpin region modification is in the hairpin 1 region. In some embodiments, the hairpin region modification is in the hairpin 2 region. In some embodiments, modifications are within the hairpin 1 and hairpin 2 regions, optionally wherein the “n” between hairpin 1 and 2 is also modified.
In some embodiments, the hairpin modification comprises or further comprises a 2′-O-methyl (2′-OMe) modified nucleotide.
In some embodiments, the hairpin modification comprises or further comprises a 2′-fluoro (2′-F) modified nucleotide.
In some embodiments, the hairpin region modification comprises at least one modified nucleotide selected from a 2′H modified nucleotide (DNA), PS modified nucleotide, a YA modification, a 2′-O-methyl (2′-O-Me) modified nucleotide, a 2′-fluoro (2′-F) modified nucleotide, or combinations thereof.
In some embodiments, the gRNA comprises a 3′ end modification, and a modification in the hairpin region.
In some embodiments, the gRNA comprises a 5′ end modification, and a modification in the hairpin region.
In some embodiments, the gRNA comprises an upper stem modification, and a modification in the hairpin region.
In some embodiments, the gRNA comprises a 3′ end modification, a modification in the hairpin region, an upper stem modification, and a 5′ end modification.
F. Exemplary Modified Guide RNAS
Modified gRNAs comprising combinations of 5′ end modifications, 3′ end modifications, upper stem modifications, hairpin modifications, and 3′ terminus modifications, as described above, are encompassed. Exemplary modified gRNAs are described below.
sgRNAs; Domains/Regions Thereof
In some embodiments, a gRNA provided herein is an sgRNA. Briner A E et al., Molecular Cell 56:333-339 (2014) describes functional domains of sgRNAs, referred to herein as “domains”, including the “spacer” domain responsible for targeting, the “lower stem”, the “bulge”, “upper stem” (which may include a tetraloop), the “nexus”, and the “hairpin 1” and “hairpin 2” domains. See Briner et al. at page 334,
In some embodiments, the sgRNA comprises a guide region and a conserved portion 3′ to the guide region, wherein the conserved portion comprises a repeat-anti-repeat region, a nexus region, a hairpin 1 region, and a hairpin 2 region. The repeat-anti-repeat region comprises an upper stem region and a lower stem region. Table 3B provides a schematic of the domains of an sgRNA as used herein. In Table 3B, the “n” between regions represents a variable number of nucleotides, for example, from 0 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some embodiments, n equals 0. In some embodiments, n equals 1.
In some embodiments, the sgRNA comprises at least one of: a first internal linker substituting for at least 4 nucleotides of the upper stem region; a second internal linker substituting for 2 nucleotides of the nexus region; and a third internal linker substituting for at least 2 nucleotides of the hairpin 1.
In some embodiments, the sgRNA comprises the first internal linker and the second internal linker. In some embodiments, the sgRNA comprises the first internal linker and the third internal linker. In some embodiments, the sgRNA comprises the second internal linker and the second internal linker. In some embodiments, the sgRNA comprise the first internal linker, the second internal linker, and the second internal linker.
In some embodiments, the first internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms. In some embodiments, the first internal linker substitutes for 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides of the repeat-anti-repeat region of the gRNA.
In some embodiments, the second internal linker has a bridging length of about 9-15 atoms. In some embodiments, the second internal linker substitutes for a hairpin region of the nexus region of the sgRNA. In some embodiments, the second internal linker substitutes for 2 nucleotides of a stem region of the nexus region of the sgRNA.
In some embodiments, the third internal linker has a bridging length of about 9-30 atoms, optionally about 15-21 atoms. In some embodiments, the third internal linker substitutes for 4, 5, 6, 7, 8, 9. 10, 11, or 12 nucleotides of the hairpin 1 of the gRNA.
In some embodiments, the first internal linker is in a hairpin between a first portion and a second portion, and the first portion and the second portion together form a duplex portion.
In some embodiments, the third internal linker is in a hairpin between a first portion of the sgRNA and second portion of the sgRNA, and the first portion and the second portion together form a duplex portion.
In some embodiments, a hairpin 2 region of the sgRNA does not contain any internal linker. In some embodiments, the hairpin 2 region is in a SpyCas9 gRNA.
5′ Terminus Region
In some embodiments, the sgRNA comprises nucleotides at the 5′ end as shown in Table 3A-B. In some embodiments, the 5′ terminus of the sgRNA comprises a spacer or guide region that functions to direct a Cas protein, e.g., a Cas9 protein, to a target nucleotide sequence. In some embodiments, the 5′ terminus does not comprise a guide region. In some embodiments, the 5′ terminus comprises a spacer and additional nucleotides that do not function to direct a Cas protein to a target nucleotide region.
Lower Stem
In some embodiments, the sgRNA comprises a lower stem (LS) region that when viewed linearly, is separated by a bulge and upper stem regions. See Table 3A-B.
In some embodiments, the lower stem regions comprise 1-12 nucleotides, e.g. in one embodiment the lower stem regions comprise LS1-LS12. In some embodiments, the lower stem region comprises fewer nucleotides than shown in Table 3. In some embodiments, the lower stem region comprises more nucleotides than shown in Table 3A-B. When the lower stem region comprises fewer or more nucleotides than shown in the schematic of Table 3, the modification pattern, as will be apparent to the skilled artisan, should be maintained.
In some embodiments, the lower stem region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity in nucleic acid sequence of lower stem leads to a secondary structure of a stem in the sgRNA (e.g., the regions may base pair with one another). In some embodiments, the lower stem regions may not be perfectly complimentary to each other when read in opposite directions.
Bulge
In some embodiments, the sgRNA comprises a bulge region comprising six nucleotides, B1-B6. When viewed linearly, the bulge region is separated into two regions. See Table 3. In some embodiments, the bulge region comprises six nucleotides, wherein the first two nucleotides are followed by an upper stem region, followed by the last four nucleotides of the bulge. In some embodiments, the bulge region comprises fewer nucleotides than shown in Table 3A-B. In some embodiments, the bulge region comprises more nucleotides than shown in Table 3A-B. When the bulge region comprises fewer or more nucleotides than shown in the schematic of Table 3A-B, the modification pattern, as will be apparent to the skilled artisan, should be maintained.
In some embodiments, the presence of a bulge results in a directional kink between the upper and lower stem modules in an sgRNA.
Upper Stem
In some embodiments, the upper stem region is a shortened upper stem region, such as any of the shortened upper stem regions described elsewhere herein.
In other embodiments, the sgRNA comprises an upper stem region comprising 12 nucleotides. In some embodiments, the upper stem region comprises a loop sequence. In some instances, the loop is a tetraloop (loop consisting of four nucleotides). In some embodiments, the upper stem region comprises more nucleotides than shown in Table 3B.
When the upper stem region comprises fewer or more nucleotides than shown in the schematic of Table 3A-B, the modification pattern, as will be apparent to the skilled artisan, should be maintained.
In some embodiments, the upper stem region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity in nucleic acid sequence of upper stem leads to a secondary structure of a stem in the sgRNA (e.g., the regions may base pair with one another). In some embodiments, the upper stem regions may not be perfectly complimentary to each other when read in opposite directions.
In some embodiments, the upper stem region comprises fewer nucleotides than shown in
Nexus
In some embodiments, the sgRNA comprises a nexus region that is located between the lower stem region and the hairpin 1 region. In some embodiments, the nexus comprises 18 nucleotides. In some embodiments, the nexus region comprises nucleotides N1 through N18 as shown in Table 3A-B. In some embodiments, the nexus region comprises a substitution (e.g., at position N18) or lacks a nucleotide, such as any of the nexus regions with a substitution or lacking a nucleotide described in detail elsewhere herein.
In some embodiments, the nexus region comprises fewer nucleotides than shown in Table 3A-B. In some embodiments, the nexus region comprises more nucleotides than shown in Table 3A-B. When the nexus region comprises fewer or more nucleotides than shown in the schematic of Table 3A-B, the modification pattern, as will be apparent to the skilled artisan, should be maintained.
In some embodiments, the nexus region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the complementarity in nucleic acid sequence leads to a secondary structure of a stem or stem loop in the sgRNA (e.g., certain nucleotides in the nexus region may base pair with one another). In some embodiments, the nexus regions may not be perfectly complimentary to each other when read in opposite directions.
Hairpin
In some embodiments, the sgRNA comprises one or more hairpin structures within the hairpin region. The hairpin region is downstream of (i.e., 3′ to) the repeat-anti-repeat region. In some embodiments, the hairpin region is downstream of the nexus region, when present. In some embodiments, the region of nucleotides immediately downstream of the nexus region is termed “hairpin 1” or “H1”. In some embodiments, the region of nucleotides 3′ to hairpin 1 is termed “hairpin 2” or “H2”. In some embodiments, the hairpin region comprises both hairpin 1 and hairpin 2. In some embodiments, the sgRNA comprises hairpin 1 or hairpin 2.
In some embodiments, the hairpin 1 region is a shortened hairpin 1 region, such as any of the shortened hairpin 1 regions described elsewhere herein.
In other embodiments, the hairpin 1 region comprises 12 nucleotides immediately downstream of the nexus region. In some embodiments, the hairpin 1 region comprises nucleotides H1-1 through H1-12 as shown in Table 3B.
In some embodiments, the hairpin 2 region comprises 15 nucleotides downstream of the hairpin 1 region. In some embodiments, the hairpin 2 region comprises nucleotides H2-1 through H2-15 as shown in Table 3B.
In some embodiments, one or more nucleotides is present between the hairpin 1 and the hairpin 2 regions. The one or more nucleotides between the hairpin 1 and hairpin 2 region may be modified or unmodified. In some embodiments, hairpin 1 and hairpin 2 are separated by one nucleotide. In some embodiments, the hairpin regions comprise fewer nucleotides than shown in Table 3B. In some embodiments, the hairpin regions comprise more nucleotides than shown in Table 3B. When a hairpin region comprises fewer or more nucleotides than shown in the schematic of Table 3B, the modification pattern, as will be apparent to the skilled artisan, should be maintained.
In some embodiments, a hairpin region has nucleotides that are complementary in nucleic acid sequence when read in opposite directions. In some embodiments, the hairpin regions may not be perfectly complimentary to each other when read in opposite directions (e.g., the top or loop of the hairpin comprises unpaired nucleotides).
3′ Terminus
The sgRNA has a 3′ end, which is the last nucleotide of the sgRNA. The 3′ terminus region includes the last 1-7 nucleotides from the 3′ end. In some embodiments, the 3′ end is the end of hairpin 2. In some embodiments, the sgRNA comprises nucleotides after the hairpin region(s). In some embodiments, the sgRNA includes a 3′ tail region, in which case the last nucleotide of the 3′ tail is the 3′ terminus. In some embodiments, the 3′ tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides, e.g. that are not associated with the secondary structure of a hairpin. In some embodiments, the 3′ tail region comprises 1, 2, 3, or 4 nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3′ tail region comprises 4 nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3′ tail region comprises 1, 2, or 3 nucleotides that are not associated with the secondary structure of a hairpin.
In some embodiments, the spacer or targeting region of the gRNA is present at the 3′ end of the gRNA.
In some embodiments, the sgRNA comprises a conserved portion comprising a sequence of SEQ ID NO: 400.
In some embodiments, 2, 3 or 4 of nucleotides 13-16 (US5-US8 of the upper stem region) are substituted for the first internal linker relative SEQ ID NO: 400. In some embodiments, nucleotides 12-17 (US4-US9 of the upper stem region) are substituted for the first internal linker relative SEQ ID NO: 400. In some embodiments, nucleotides 11-18 (US3-US10 of the upper stem region) are substituted for the first internal linker relative SEQ ID NO: 400. In some embodiments, nucleotides 10-19 (US2-US11 of the upper stem region) are substituted for the first internal linker relative SEQ ID NO: 400. In some embodiments, nucleotides 9-20 (US1-US10 of the upper stem region) are substituted for the first internal linker relative SEQ ID NO: 400. In some embodiments, nucleotide 36-37 (N6-N7 of the nexus region) are substituted for the second internal linker relative SEQ ID NO: 400. In some embodiments, 2, 3, or 4 of nucleotides 53-56 (H1-5-H1-8 of the hairpin 1) are substituted for the third internal linker relative SEQ ID NO: 400. In some embodiments, nucleotides 52-57 (H1-4-H1-9 of the hairpin 1) are substituted for the third internal linker relative SEQ ID NO: 400. In some embodiments, nucleotides 51-58 (H1-3-H1-10 of the hairpin 1) are substituted for the third internal linker relative SEQ ID NO: 400. In some embodiments, nucleotides 50-59 (H1-1-H1-12 of the hairpin 1) are substituted for the third internal linker relative SEQ ID NO: 400. In some embodiments, nucleotides 77-80 are deleted relative SEQ ID NO: 400. In some embodiments, all of the nucleotides of the upper stem (US1-US12) are substituted for the first internal linker relative to SEQ ID NO: 400. In some embodiments, all of the nucleotides of the upper stem (US1-US12) are substituted with an abasic nucleoside relative to SEQ ID NO: 400 in a sgRNA wherein nucleotides in another portion of the sgRNA is substituted for an internal linker, e.g., in the nexus region or preferably in the hairpin 1 region as provided above.
G. NmeCas9 Guide RNAs with One or More Shortened Regions Comprising Internal Linker(s)
Provided herein are guide RNAs (gRNAs) comprising one or more shortened regions and one or more internal linker.
In some embodiments, a gRNA (e.g., sgRNA, dgRNA, or crRNA) provided herein comprises a conserved region comprising a repeat/anti-repeat region, a hairpin 1 region, and a hairpin 2 region, wherein one or more of the repeat/anti-repeat region, the hairpin 1 region, and the hairpin 2 region are shortened. In some embodiments, the gRNA is an N. meningitidis Cas9 (NmeCas9) gRNA.
In some embodiments, the conserved region of a gRNA comprises:
a shortened repeat/anti-repeat region, wherein the shortened repeat/anti-repeat region lacks 2-24 nucleotides, wherein
In some embodiments, the conserved region of a gRNA comprises:
In some embodiments, the conserved region of a gRNA comprises:
In some embodiments, the conserved region of a gRNA comprises:
In some embodiments, the conserved region of a gRNA comprises:
In some embodiments, the conserved region of a gRNA comprises:
In some embodiments, the conserved region of a gRNA comprises:
Nucleotide positions in this section, including subsections A-E below, are numbered according to
In some embodiments, one or both nucleotides 144-145 are optionally deleted as compared to SEQ ID NO: 500.
In some embodiments, the gRNA comprises at least one of the first internal linker, the second internal linker, and the third internal linker.
In some embodiments, the gRNA comprises at least two of the first internal linker, the second internal linker, and the third internal linker.
In some embodiments, the gRNA comprises the first internal linker, the second internal linker, and the third internal linker.
In some embodiments, the guide region has (i) an insertion of one nucleotide or a deletion of 1-4 nucleotides within positions 1-24 relative to SEQ ID NO: 500, or (ii) a length of 24 nucleotides.
In some embodiments, the guide region has a length of 25, 24, 23, 22, 21, or 20 nucleotides, optionally wherein the guide region has a length of 25, 24, 23, or 22 nucleotides at positions 1-24 of SEQ ID NO: 500.
In some embodiments, the guide region has a length of 23 or 24 nucleotides at positions 1-24 of SEQ ID NO: 500.
In some embodiments, at least 10 nucleotides of the conserved portion are modified nucleotides.
In some embodiments, a substitution in a duplex portion is a conservative substitution.
Within each the repeat/anti-repeat region, the hairpin 1 region, and the hairpin 2 region, the strands of each of the duplex portions are joined by an internal linker that alone or in combination with nucleotides substitutes for 4 nucleotides, or at least 4 nucleotides. Provided herein are internal linkers having various bridging lengths to permit one of skill in the art to join the strands of the duplex portion with internal linkers or nucleotides or a combination thereof.
In some embodiments, a repeat/anti-repeat region of a gRNA is a shortened repeat/anti-repeat region lacking 2-24 nucleotides, e.g., any of the repeat/anti-repeat regions indicated in the numbered embodiments above or Tables 1-2 or described elsewhere herein, which may be combined with any of the shortened hairpin 1 region or hairpin 2 region described herein, including but not limited to combinations indicated in the numbered embodiments above and represented in the sequences of Tables 1-2 or described elsewhere herein.
In some embodiments, the first linker substitutes positions 49-52 and the second internal linker substitutes positions 87-90.
In some embodiments, the second internal linker substitutes positions 87-90 and the third internal linker substitutes positions 122-125.
In some embodiments, the first linker substitutes positions 49-52, and the third internal linker substitutes positions 122-125.
In some embodiments, the first linker substitutes 49-52, the second internal linker substitutes positions 87-90, and the third internal linker substitutes positions 122-125.
Shortened Repeat/Anti-Repeat Region
In some embodiments, a conserved portion of a gRNA described herein comprises a shortened repeat/anti-repeat region. In some embodiments, the repeat-anti-repeat region comprises a hairpin structure between a first portion and a second portion of the repeat-anti-repeat region, wherein the first portion and the second portion together form a duplex portion.
In some embodiments, a conserved portion of a gRNA described herein comprises a shortened upper stem region of the repeat/anti-repeat region. In some embodiments, the repeat/anti-repeat region comprises a loop (e.g., a tetraloop).
In some embodiments, the shortened repeat/anti-repeat region lacks 2-28 nucleotides. In some embodiments, (i) one or more of nucleotides 37-64 is deleted and optionally substituted relative to SEQ ID NO: 1; and (ii) nucleotide 36 is linked to nucleotide 65 by a first internal linker.
In some embodiments, the shortened repeat/anti-repeat region lacks 2-28 nucleotides.
In some embodiments, the shortened repeat/anti-repeat region has a length of 24, 25, 26 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides.
In some embodiments, the shortened repeat/anti-repeat region lacks 12-28, optionally 18-24 nucleotides. In some embodiments, the shortened repeat/anti-repeat region has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. In some embodiments, the shortened repeat/anti-repeat region has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 nucleotides. In some embodiments, the shortened repeat/anti-repeat region has a length of 34 nucleotides. In some embodiments, the shortened repeat/anti-repeat region has a length of 35 nucleotides. In some embodiments, the shortened repeat/anti-repeat region has a length of 36 nucleotides. In some embodiments, the shortened repeat/anti-repeat region has a length of 37 nucleotides. In some embodiments, the shortened repeat/anti-repeat region has a length of 38 nucleotides.
In some embodiments, one or more base pairs of the upper stem of the shortened repeat/anti-repeat region are deleted. In some embodiments, the upper stem of the shortened repeat/anti-repeat region comprises no more than one, two, three, or four base pairs. As used herein, “base pairs” or “base paired nucleotides” or “Watson-Crick pairing nucleotides” include any pair capable of forming a Watson-Crick base pair, including A-T, A-U, T-A, U-A, C-G, and G-C pairs, and pairs including modified versions of any of the foregoing nucleotides that have the same base pairing preference. In some embodiments, base pairs or base paired nucleotides also include base pairs generated by base stacking, e.g. nucleotides 25 and 76, 33 and 68, 34 and 67, and 37 and 64 in the repeat/anti-repeat region; and nucleotides 78 and 100, and 83 and 94 in the hairpin 1 region.
In some embodiments, the first internal linker substitutes nucleotides 38-63 of the upper stem of the shortened repeat/anti-repeat region and links nucleotide 37 to nucleotide 64. In some embodiments, the first internal linker substitutes nucleotides 37-64 of the upper stem of the shortened repeat/anti-repeat region and links nucleotide 36 to nucleotide 65.
In some embodiments, the shortened repeat/anti-repeat region has a duplex portion 11 base paired nucleotides in length. In some embodiments, the shortened repeat/anti-repeat region has a single duplex portion. In some embodiments, positions 25 and 76, positions 33 nad 68, positions 34 and 67, and positions 48 and 53 have base stacking interactions and do not constitute a discontinuity in the duplex portion.
In some embodiments, one or more of base paired nucleotides in the repeat/anti-repeat region is deleted. In some embodiments, one or more of based paired nucleotides chosen from positions 37 and 53, positions 38 and 54, position 39 and 55, positions 40 and 56, positions 41 and 57, positions 43 and 58, positions 43 and 59, positions 44 and 60, positions 45 and 61, positions 46 and 62, positions 47 and 63, and positions 48 and 64.
In some embodiments, the upper stem region of the repeat/anti-repeat region comprises 1-5 base pairs.
In some embodiments, the upper stem of the shortened repeat/anti-repeat region includes one or more substitution relative to SEQ ID NO: 500.
In some embodiments, one or more substitutions are considered conservative substitutions by exchanging positions of base paired nucleotides such that base pairings may be maintained. For example, a G-C pair becomes a C-G pair, an A-U pair becomes a U-A pair, or other natural or modified base pairing.
In some embodiments, the first internal linker substitutes nucleotides 49-52 is substituted relative to SEQ ID NO: 500.
In some embodiments, the shortened repeat/anti-repeat region has 8-22 modified nucleotides.
Shortened Hairpin 1 Region
In some embodiments, a conserved portion of a gRNA described herein comprises a shortened hairpin 1 region. In some embodiments, the hairpin 1 region comprises a hairpin structure between a first portion and a second portion of the hairpin 1 region, wherein the first portion and the second portion together form a duplex portion.
In some embodiments, a conserved portion of a gRNA described herein comprises a shortened upper stem region of the hairpin 1 region. In some embodiments, the hairpin 1 comprises a loop (e.g., a tetraloop).
In some embodiments, the shortened hairpin 1 lacks 2-10 nucleotides. In some embodiments, (i) one or more of nucleotides 82-95 is deleted and optionally substituted relative to SEQ ID NO: 500; and (ii) nucleotide 81 is linked to nucleotide 96 by a second internal linker.
In some embodiments, wherein the shortened hairpin 1 region lacks 2-10 nucleotides. In some embodiments, wherein the shortened hairpin 1 region has a length of 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides. In some embodiments, wherein the shortened hairpin 1 region has duplex portion 4-8 base paired nucleotides in length. In some embodiments, wherein the shortened hairpin 1 region has duplex portion 7-8 base paired nucleotides in length.
In some embodiments, wherein the shortened hairpin 1 region has a single duplex portion. In some embodiments, in the shortened hairpin 1 region, positions 78 and 100, and positions 83 and 94 have base stacking interactions and do not constitute a discontinuity in the duplex portion.
In some embodiments, one or two base pairs of the shortened hairpin 1 region are deleted. In some embodiments, the stem of the shortened hairpin 1 region comprises one, two, three, four, five, six, seven or eight base pairs. In some embodiments, the stem of the shortened hairpin 1 region is seven or eight base paired nucleotides in length.
In some embodiments, one or more of positions 85-86 and one or more of nucleotides 91-92 of the shortened hairpin 1 region are deleted. In some embodiments, nucleotides 86 and 91 of the shortened hairpin 1 region are deleted. In some embodiments, one or more of nucleotides 82-95 of the shortened hairpin 1 region is substituted relative to SEQ ID NO: 500.
In some embodiments, the second internal linker substitutes nucleotides 87-91 relative to SEQ ID NO: 500.
In some embodiments, wherein the shortened hairpin 1 region has 2-15 modified nucleotides.
Shortened Hairpin 2 Region
In some embodiments, a conserved portion of a gRNA described herein comprises a shortened hairpin 2 region. In some embodiments, the shortened hairpin 2 region comprises a hairpin structure between a first portion and a second portion of the hairpin 2 region, wherein the first portion and the second portion together form a duplex portion.
In some embodiments, the shortened hairpin 2 region lacks 2-18 nucleotides. In some embodiments, the shortened hairpin 2 region lacks 2-16 nucleotides. In some embodiments, (i) one or more of nucleotides 113-121 and 126-134 is deleted and optionally substituted relative to SEQ ID NO: 500; and (ii) nucleotide 112 is linked to nucleotide 135 by a third internal linker.
In some embodiments, a conserved portion of a gRNA described herein comprises a shortened upper stem region of the hairpin 2 region. In some embodiments, the hairpin 1 comprises a loop (e.g., a tetraloop). In some embodiments, the shortened hairpin 2 region lacks 2-16 nucleotides. In some embodiments, the shortened hairpin 2 region has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. In some embodiments, the shortened hairpin 2 region has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, 33 or 34, nucleotides. In some embodiments, one or more of nucleotides 113-121 and one or more of nucleotides 126-134 of the shortened hairpin 2 region are deleted.
In some embodiments, the shortened hairpin 2 region comprises an unpaired region.
In some embodiments, the shortened hairpin 2 region has two duplex portions. In some embodiments, the shortened hairpin 2 region has a duplex portion of 4 base paired nucleotides in length. In some embodiments, the shortened hairpin 2 region has a duplex portion of 4-8 base paired nucleotides in length. In some embodiments, the shortened hairpin 2 region has a duplex portion of 4-6 base paired nucleotides in length. In some embodiments, the upper stem of the shortened hairpin 2 region comprises one, two, three, or four base pairs. In some embodiments, at least one pair of nucleotides 113 and 134, nucleotides 114 and 133, nucleotides 115 and 132, nucleotides 116 and 131, nucleotides 117 and 130, nucleotides 118 and 129, nucleotides 119 and 128, nucleotides 120 and 127, and nucleotides 121 and 126 are deleted. In some embodiments, all of positions 113-121 and 126-134 of the shortened hairpin 2 region are deleted.
In some embodiments wherein one or more of nucleotides 113-134 of the shortened hairpin 2 region is substituted relative to SEQ ID NO: 500. In some embodiments, the third internal linker substitutes nucleotides 122-125 relative to SEQ ID NO: 500.
In some embodiments the shortened hairpin 2 region has 2-15 modified nucleotides.
3′ Tail
In some embodiments, the gRNA comprises a 3′ tail. In some embodiments, the 3′ tail is 1-20 nucleotides in length and is linked by a phosphodiester or a phosphorothioate linkage, to the 3′ end of the conserved region of a gRNA. In some embodiments, the 3′ tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the 3′ tail comprises 1, 2, 3, 4, or 5 nucleotides. In some embodiments, the 3′ tail comprises 1 or 2 nucleotides.
In some embodiments, the 3′ tail has a length of 1-10 nucleotides, 1-5 nucleotides, 1-4 nucleotides, 1-3 nucleotides, and 1-2 nucleotides. In some embodiments, the 3′ tail comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the 3′ tail has a length of 1 nucleotide. In some embodiments, the 3′ tail has a length of 2 nucleotides. In some embodiments, the 3′ tail has a length of 3 nucleotides. In some embodiments, the 3′ tail has a length of 4 nucleotides. In some embodiments, the 3′ tail has a length of 1-2, nucleotides.
In some embodiments, the 3′ tail terminates with a nucleotide comprising a uracil or modified uracil. In some embodiments, the 3′ tail is 1 nucleotide in length. In some embodiments, the 3′ tail consists of a nucleotide comprising a uracil or a modified uracil. In some embodiments, wherein the 3′ tail comprises a modification of any one or more of the nucleotides present in the 3′ tail. In further embodiments, wherein the modification of the 3′ tail is one or more of 2′-O-methyl (2′-OMe) modified nucleotide and a phosphorothioate (PS) linkage between nucleotides.
In some embodiments, wherein the 3′ tail is fully modified.
In some embodiments, wherein the 3′ nucleotide of the gRNA is a nucleotide comprising a uracil or a modified uracil.
In some embodiments, one or more of nucleotides 144 and 145 are deleted relative to SEQ ID NO: 500. In some embodiments, both nucleotides 144 and 145 are deleted relative to SEQ ID NO: 500.
In some embodiments, the gRNA does not comprise a 3′ tail.
In some embodiments, the 3′ end of the guide, that does not comprise a 3′ tail, terminates with a nucleotide comprising a uracil or modified uracil. In some embodiments, the 3′ tail consists of a nucleotide comprising a uracil or modified uracil. In some embodiments, the 3′ terminal nucleotide is a modified nucleotide. In some embodiments, the modification of the 3′ end is one or more of 2′-O-methyl (2′-OMe) modified nucleotide and a phosphorothioate (PS) linkage between nucleotide the terminal nucleotide and the penultimate nucleotide.
In some embodiments, the 3′ end, i.e., the end of hairpin 2 with no further tail or the end of the 3′ tail, comprises or further comprises one or more modifications, e.g., a phosphorothioate (PS) linkage between nucleotides, a 2′-OMe modified nucleotide, a 2′-O-moe modified nucleotide, a 2′-F modified nucleotide, or an inverted abasic modified nucleotide, optionally wherein the 3′ end comprises at least two modifications independently selected from a phosphorothioate (PS) linkage between nucleotides, a 2′-OMe modified nucleotide, a 2′-O-moe modified nucleotide, a 2′-F modified nucleotide, and an inverted abasic modified nucleotide. In some embodiments, the 3′ end comprises or further comprises one or more modifications, e.g., a phosphorothioate (PS) linkage between nucleotides, a 2′-OMe modified nucleotide, a 2′-F modified nucleotide, optionally wherein the 3′ end comprises at least two modifications independently selected from a phosphorothioate (PS) linkage between nucleotides, a 2′-OMe modified nucleotide, and a 2′-F modified nucleotide. In some embodiments, the 3′ end comprises phosphorothioate (PS) linkage between nucleotides 141 and 142, and 142 and 143; a 2′-OMe modified nucleotide at each of positions 142 and 143.
In some embodiments, the 3′ end, i.e., the end of hairpin 2 with no further tail or the end of the 3′ tail, comprises or further comprises one or more phosphorothioate (PS) linkages between nucleotides. In some embodiments, the 3′ end comprises or further comprises one or more 2′-OMe modified nucleotides. In some embodiments, the 3′ end comprises or further comprises one or more 2′-O-moe modified nucleotides. In some embodiments, the 3′ end comprises or further comprises one or more 2′-F modified nucleotide. In some embodiments, the 3′ end comprises or further comprises one or more an inverted abasic modified nucleotides. In some embodiments, the 3′ end comprises or further comprises one or more protective end modifications. In some embodiments, the 3′ end comprises or further comprises a combination of one or more of a phosphorothioate (PS) linkage between nucleotides, a 2′-OMe modified nucleotide, a 2′-O-moe modified nucleotide, a 2′-F modified nucleotide, and an inverted abasic modified nucleotide.
Guide Region
In some embodiments, the gRNA further comprises a guide sequence. In some embodiments, the guide sequence comprises 20, 21, 22, 23, 24, or 25 nucleotides, optionally 22, 23, 24, or 25 nucleotides 5′ to the most 5′ nucleotide of the repeat/anti-repeat region. In some embodiments, the guide sequence comprises 22, 23, 24, 25, or more nucleotides. In some embodiments, the guide sequence has a has a length of 24 nucleotides. In some embodiments, the guide sequence has a length of 23 nucleotides. In some embodiments, the guide sequence has a length of 22 nucleotides. In some embodiments, the guide sequence has a length of 21 nucleotides. In some embodiments, the guide sequence has a length of 20 nucleotides.
In some embodiments, the guide region has (i) an insertion of one nucleotide or a deletion of 1-4 nucleotides within positions 1-24 relative to SEQ ID NO: 500, or (ii) a length of 24 nucleotides.
In some embodiments, the selection of the guide sequence is determined based on target sequences within the gene of interest for editing. For example, in some embodiments, the gRNA comprises a guide sequence that is complementary to target sequences of a gene of interest.
In some embodiments, the target sequence in the gene of interest may be complementary to the guide sequence of the gRNA. In some embodiments, the degree of complementarity or identity between a guide sequence of a gRNA and its corresponding target sequence in the gene of interest may be about 90%, 95%, or 100%. In some embodiments, the guide region of a gRNA and the target region of a gene of interest may be 100% complementary or identical. In other embodiments, the guide sequence of a gRNA and the target sequence of a gene of interest may contain at least one mismatch. For example, the guide sequence of a gRNA and the target sequence of a gene of interest may contain 1, optionally 2, or 3mismatches, where the total length of the target sequence is at least about 22, 23, 24, or more nucleotides. In some embodiments, the guide sequence of a gRNA and the target region of a gene of interest may contain 1, optionally 2, or 3 mismatches where the guide sequence comprises about 24 nucleotides. In certain embodiments, the guide sequence contains no mismatches, i.e., is fully complementary, to the target sequence. The 5′ terminus may comprise nucleotides that are not considered guide regions (i.e., do not function to direct a Cas9 protein to a target nucleic acid).
In some embodiments, the guide region of the shortened guide RNA comprises at least one modified nucleotide.
Exemplary shortened guide RNAs comprising internal linkers are provided in Tables 4A-4B. As used herein, “Linker 1” or “L1” refers to an internal linker having a bridging length of about 15-21 atoms. As used herein, “Linker 2” or “L2” refers to an internal linker having a bridging length of about 6-12 atoms.
Nucleotide modifications are indicated in Tables 4A-4B as follows: m: 2′-OMe; *: PS linkage; f 2′-fluoro; (invd): inverted abasic; moe: 2′-moe; e: ENA; d: deoxyribonucleotide (also note that T is always a deoxyribonucleotide); x: UNA. In the sgRNA modified sequences, in certain embodiments, each A, C, G, U, and N is independently a ribose sugar (2′-OH). In certain embodiments, each A, C, G, U, and N is a ribose sugar (2′-OH). Thus, for example, mA represents 2′-O-methyl adenosine; xA represents a UNA nucleotide with an adenine nucleobase; eA represents an ENA nucleotide with an adenine nucleobase; and dA represents an adenosine deoxyribonucleotide.
As used herein, “N” may be any natural or non-natural nucleotide. For example, encompassed herein is SEQ ID NO: 1001 in Table 4A, where the N's are replaced with any of the guide sequences disclosed herein. The modifications remain as shown in SEQ ID NO: 1001 despite the substitution of N's for the nucleotides of a guide. That is, although the nucleotides of the guide replace the “N's”, the first three nucleotides are 2′-O-Me modified and there are phosphorothioate linkages between the first and second nucleotides, the second and third nucleotides and the third and fourth nucleotides.
sgRNA designations are sometimes provided with one or more leading zeroes immediately following the G. This does not affect the meaning of the designation. Thus, for example, G000282, G0282, G00282, and G282 refer to the same sgRNA.
Compositions comprising any of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs) described herein and a carrier, excipient, diluent, or the like are encompassed. In some instances, the excipient or diluent is inert. In some instances, the excipient or diluent is not inert. In some embodiments, a pharmaceutical formulation is provided comprising any of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs) described herein and a pharmaceutically acceptable carrier, excipient, diluent, or the like. In some embodiments, the pharmaceutical formulation further comprises an LNP. In some embodiments, the pharmaceutical formulation further comprises a Cas9 protein or an mRNA encoding a Cas9 protein. In some embodiments, the pharmaceutical formulation comprises any one or more of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs), an LNP, and a Cas protein or mRNA encoding a Cas protein. In some embodiments, the Cas protein is a monomeric Cas protein, e.g., a Cas9 protein. In some embodiments, the Cas protein includes multiplel subunits.
Also provided are kits comprising one or more gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs), compositions, or pharmaceutical formulations described herein. In some embodiments, a kit further comprises one or more of a solvent, solution, buffer, each separate from the composition or pharmaceutical formulation, instructions, or desiccant.
Compositions Comprising an RNA-Guided DNA Binding Agent or Nucleic Acid Encoding RNA-Guided DNA Binding Agent
In some embodiments, compositions or pharmaceutical formulations are provided comprising at least one gRNA (e.g., sgRNA, dgRNA, or crRNA) described herein and an RNA-guided DNA binding agent or a nucleic acid (e.g., an mRNA) encoding an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is a Cas protein. In some embodiments, the gRNA together with a Cas protein or nucleic acid (e.g., mRNA) encoding Cas protein is called a Cas RNP. In some embodiments, the RNA-guided DNA binding agent is one that functions with the gRNA to direct an RNA-guided DNA binding agent to a target nucleic acid sequence. In some embodiments, the RNA-guided DNA binding agent is a Cas protein from the Type-II CRISPR/Cas system. In some embodiments, the Cas protein is Cas9. In some embodiments, the Cas9 protein is a wild type Cas9. In some embodiments, the Cas9 protein is derived from the Streptococcus pyogenes Cas9 protein, e.g., a S. pyogenes Cas9 (SpyCas9). In some embodiments, compositions are provided comprising at least one gRNA and a nuclease or an mRNA encoding a spyCas9. In some embodiments, the Cas9 protein is not derived from S. pyogenes, but functions in the same way as S. pyogenes Cas9 such that gRNA that is specific to S. pyogenes Cas9 will direct the non-S. pyogenes Cas9 to its target site. In some embodiments, the Cas9 protein is derived from the Staphylococcus aureus Cas9 protein, e.g., a SauCas9. In some embodiments, compositions are provided comprising at least one gRNA and a nuclease or an mRNA encoding a SauCas9. In some embodiments, the Cas9 protein is derived from the Neisseria meningitidis Cas9 (NmeCas9). In some embodiments, compositions are provided comprising at least one gRNA and a nuclease or an mRNA encoding an NmeCas9. In some embodiments, the Cas9 protein is not derived from N. meningitidis. In some embodiments, compositions are provided comprising at least one gRNA and a nuclease or an mRNA encoding an NmeCas9. In some embodiments, the Cas induces a double strand break in target DNA. Equivalents of SpyCas9, SauCas9, NmeCas9, and other Cas proteins disclosed herein are encompassed by the embodiments described herein.
RNA-guided DNA binding agents, including Cas9, encompass modified and variants thereof. Modified versions having one catalytic domain, either RuvC or HNH, that is inactive are termed “nickases.” Nickases cut only one strand on the target DNA, thus creating a single-strand break. A single-strand break may also be known as a “nick.” In some embodiments, the compositions and methods comprise nickases. In some embodiments, the compositions and methods comprise a nickase RNA-guided DNA binding agent, such as a nickase Cas, e.g., a nickase Cas9, that induces a nick rather than a double strand break in the target DNA.
In some embodiments, the nuclease, e.g. the RNA-guided DNA binding agent, may be modified to contain only one functional nuclease domain. For example, the RNA-guided DNA binding agent may be modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, a nickase Cas is used having a RuvC domain with reduced activity. In some embodiments, a nickase Cas is used having an inactive RuvC domain. In some embodiments, a nickase Cas is used having an HNH domain with reduced activity. In some embodiments, a nickase Cas is used having an inactive HNH domain.
In some embodiments, a conserved amino acid within an RNA-guided DNA binding agent nuclease domain is substituted to reduce or alter nuclease activity. In some embodiments, a Cas protein may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein) or H588A (based on the N. meningitidis Cas9 protein). In some embodiments, the Cas protein may comprise an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the SpyCas9 protein) or D16A (based on the NmeCas9 protein).
In some embodiments, the RNP complex described herein comprises a nickase or an mRNA encoding a nickase and a pair of gRNAs (one or both of which may be sgRNAs) that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the gRNAs (e.g., sgRNAs) direct the nickase to a target sequence and introduce a double stranded break (DSB) by generating a nick on opposite strands of the target sequence (i.e., double nicking). In some embodiments, use of double nicking may improve specificity and reduce off-target effects. In some embodiments, a nickase RNA-guided DNA binding agent is used together with two separate gRNAs (e.g., sgRNAs) that are selected to be in close proximity to produce a double nick in the target DNA.
In some embodiments, chimeric Cas proteins are used, where one domain or region of the protein is replaced by a portion of a different protein. In some embodiments, a Cas nuclease domain may be replaced with a domain from a different nuclease such as Fok1. In some embodiments, a Cas protein may be a modified nuclease.
In some embodiments, the nuclease, e.g., the RNA-guided DNA binding agent, may be modified to induce a point mutation or base change, e.g., a deamination.
In some embodiments, the Cas protein comprises a fusion protein comprising a Cas nuclease (e.g., Cas9), which is a nickase or is catalytically inactive, linked to a heterologous functional domain. In some embodiments, the Cas protein comprises a fusion protein comprising a catalytically inactive Cas nuclease (e.g., Cas9) linked to a heterologous functional domain (see, e.g., WO2014152432). In some embodiments, the catalytically inactive Cas9 is from S. pyogenes. In some embodiments, the catalytically inactive Cas9 is from N. meningitidis. In some embodiments, the catalytically inactive Cas comprises mutations that inactivate the Cas. In some embodiments, the heterologous functional domain is a domain that modifies gene expression, histones, or DNA. In some embodiments, the heterologous functional domain is a transcriptional activation domain or a transcriptional repressor domain. In some embodiments, the nuclease is a catalytically inactive Cas nuclease, such as dCas9.
In some embodiments, the heterologous functional domain is a deaminase, such as a cytidine deaminase or an adenine deaminase. In certain embodiments, the heterologous functional domain is a C to T base converter (cytidine deaminase), such as an apolipoprotein B mRNA editing enzyme (APOBEC) deaminase. A heterologous functional domain such as a deaminase may be part of a fusion protein with a Cas nuclease having nickase activity or a Cas nuclease that is catalytically inactive.
In some embodiments, the target sequence may be adjacent to a PAM. In some embodiments, the PAM may be adjacent to or within 1, 2, 3, or 4, nucleotides of the 3′ end of the target sequence. The length and the sequence of the PAM may depend on the Cas protein used. For example, the PAM may be selected from a consensus or a particular PAM sequence for a specific Cas9 protein or Cas9 ortholog, including those disclosed in
For example, the PAM may be selected from a consensus or a particular PAM sequence for a specific Nine Cas9 protein or Nine Cas9 ortholog (Edraki et al., Mol. Cell 73:714-726, 2019). In some embodiments, the PAM may comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. Non-limiting exemplary PAM sequences include NCC, N4GAYW, N4GYTT, N4GTCT, NNNNCC(a), NNNNCAAA, (wherein N is defined as any nucleotide, W is defined as either A or T, and R is defined as either A or G; and (a) is a preferred, but not required, A after the second C)). In some embodiments, the PAM sequence may be NCC.
In some embodiments, the heterologous functional domain may facilitate transport of the RNA-guided DNA-binding agent into the nucleus of a cell. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA-binding agent may be fused with 1-10 NLS(s). In some embodiments, the RNA-guided DNA-binding agent may be fused with 1-5 NLS(s). In some embodiments, the RNA-guided DNA-binding agent may be fused with one NLS. Where one NLS is used, the NLS may be fused at the N-terminus or the C-terminus of the RNA-guided DNA-binding agent sequence. It may also be inserted within the RNA-guided DNA binding agent sequence. In other embodiments, the RNA-guided DNA-binding agent may be fused with more than one NLS. In some embodiments, the RNA-guided DNA-binding agent may be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs. In some embodiments, the NLSs may be fused to the N-terminus of the RNA-guided DNA binding agent sequence. In some embodiments, the NLSs may be fused to only the N-terminus of the RNA-guided DNA binding agent sequence. In some embodiments, the RNA-guided DNA binding agent may have no NLS inserted within the RNA-guided DNA-binding agent sequence. In certain embodiments, may have no NLS C-terminal to the RNA-guided DNA-binding agent sequence.
In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA-binding agent is fused to two NLS sequences (e.g., SV40) at the carboxy terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with two NLSs, one at the N-terminus and one at the C-terminus. In some embodiments, the RNA-guided DNA-binding agent may be fused with 3 NLSs. In some embodiments, the RNA-guided DNA-binding agent may be fused with no NLS. In some embodiments, the NLS may be a monopartite sequence, such as, e.g., the SV40 NLS, PKKKRKV (SEQ ID NO: 16) or PKKKRRV (SEQ ID NO: 17). In some embodiments, the NLS may be a bipartite sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 18). In a specific embodiment, a single PKKKRKV (SEQ ID NO: 19) NLS may be fused at the C-terminus of the RNA-guided DNA-binding agent. One or more linkers are optionally included at the fusion site.
In some embodiments, the RNA-guided DNA binding agent comprises an amino acid sequence with at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to any one of SEQ ID NOs:301-313 (as shown in Table 5). In some embodiments, the RNA-guided DNA binding agent comprises a sequence with at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 301-313, 350, and 352-360. In some embodiments, any of the foregoing levels of identity is at least 95%, at least 98%, at least 99%, or 100%.
In some embodiments, the mRNA encoding the RNA-guided DNA binding agent comprises a sequence with at least 90%, 93%, 95%, 96%, 97%, 98%, 99%, or 100% identity to any one of SEQ ID NOs: 321-323, 361, 363-372, and 374-382 as shown in Table 5.
In some embodiments, any one or more of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs), compositions, or pharmaceutical formulations described herein is for use in preparing a medicament for treating or preventing a disease or disorder in a subject.
In some embodiments, the invention comprises a method of treating or preventing a disease or disorder in subject comprising administering any one or more of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs), compositions, or pharmaceutical formulations described herein.
In some embodiments, the invention comprises a method or use of modifying a target DNA comprising, administering or delivering any one or more of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs), compositions, or pharmaceutical formulations described herein.
In some embodiments, the invention comprises a method or use for modulation of a target gene comprising, administering or delivering any one or more of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs), compositions, or pharmaceutical formulations described herein. In some embodiments, the modulation is editing of the target gene. In some embodiments, the modulation is a change in expression of the protein encoded by the target gene. As used herein, a “gene editing” or “genetic modification” is a change at the DNA level, e.g., induced by a gRNA/Cas complex. A gene editing or genetic modification may comprise an insertion, deletion, or substitution (base substitution, e.g., C-to-T, or point mutation), typically within a defined sequence or genomic locus. A genetic modification changes the nucleic acid sequence of the DNA. A genetic modification may be at a single nucleotide position. A genetic modification may be at multiple nucleotides, e.g., 2, 3, 4, 5 or more nucleotides, typically in close proximity to each other, e.g, contiguous nucleotides.
In some embodiments, the method or use results in gene editing. In some embodiments, the method or use results in a double-stranded break within the target gene. In some embodiments, the method or use results in formation of indel mutations during non-homologous end joining of the DSB. In some embodiments, the method or use results in an insertion or deletion of nucleotides in a target gene. In some embodiments, the insertion or deletion of nucleotides in a target gene leads to a frameshift mutation or premature stop codon that results in a non-functional protein. In some embodiments, the insertion or deletion of nucleotides in a target gene leads to a knockdown or elimination of target gene expression. In some embodiments, the method or use comprises homology directed repair of a DSB. In some embodiments, the method or use further comprises delivering to the cell a template, wherein at least a part of the template incorporates into a target DNA at or near a double strand break site induced by the nuclease. In some embodiments, the method or use results in a single strand break within the target gene. In some embodiments, the method or use results in a base change, e.g., by deamination, within the target gene. The gene editing typically occurs within or adjacent to the portion of the target gene with which the spacer sequence forms a duplex.
In some embodiments, the method or use results in gene modulation. In some embodiments, the gene modulation is an increase or decrease in gene expression, a change in methylation state of DNA, or modification of a histone subunit. In some embodiments, the method or use results in increased or decreased expression of the protein encoded by the target gene.
The efficacy of gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs) can be tested in vitro and in vivo. In some embodiments, the invention comprises one or more of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs), compositions, or pharmaceutical formulations described herein, wherein the gRNA results in gene modulation when provided to a cell together with a Cas nuclease, e.g., Cas9 or mRNA encoding Cas9. In some embodiments, the efficacy of gRNA can be measured in vitro or in vivo.
In some embodiments, the activity of a Cas RNP comprising a gRNA is compared to the activity of a Cas RNP comprising an unmodified sgRNA or a reference sgRNA lacking modifications present in the sgRNA, such as one or more internal linkers, shortened regions, or YA site substitutions.
In some embodiments, the efficiency of a gRNA in increasing or decreasing target protein expression is determined by measuring the amount of target protein.
In some embodiments, the efficiency of editing with specific gRNAs is determined by the editing present at the target location in the genome following delivery of a Cas nuclease and the gRNA. In some embodiments, the efficiency of editing with specific gRNAs is measured by next-generation sequencing. In some embodiments, the editing percentage of the target region of interest is determined. In some embodiments, the total number of sequence reads with sequence alterations, e.g., insertions or deletions (indels), or base changes with no insertion or deletion, of nucleotides into the target region of interest over the total number of sequence reads is measured following delivery of a gRNA and a Cas nuclease.
In some embodiments, the efficiency of editing with specific gRNAs is measured by the presence of sequence alterations, e.g., insertions or deletions, or base substituition, or point mutation of nucleotides introduced by successful gene editing. In some embodiments, activity of a Cas nuclease and gRNAs is tested in biochemical assays. In some embodiments, activity of a Cas nuclease and gRNAs is tested in a cell-free cleavage assay. In some embodiments, activity of a Cas nuclease and gRNAs is tested in Neuro2A cells. In some embodiments, activity of a Cas nuclease and gRNAs is tested in primary cells, e.g., primary hepatocytes.
In some embodiments, the activity of modified gRNAs is measured after in vivo dosing of LNPs comprising modified gRNAs and Cas protein or mRNA encoding Cas protein.
In some embodiments, in vivo efficacy of a gRNA or composition provided herein is determined by editing efficacy measured in DNA extracted from tissue (e.g., liver tissue) after administration of gRNA and a Cas nuclease.
In some embodiments, activation of the subject's immune response is measured by serum concentrations of cytokine(s) following in vivo dosing of sgRNA together with Cas nuclease mRNA or protein (e.g., formulated in an LNP). In some embodiments, the cytokine is interferon-alpha (IFN-alpha), interleukin 6 (IL-6), monocyte chemotactic protein 1 (MCP-1), or tumor necrosis factor alpha (TNF-alpha).
In some embodiments, administration of Cas RNP or Cas nuclease mRNA together with the modified gRNA (e.g., sgRNA, or dgRNA) produces lower serum concentration(s) of immune cytokines compared to administration of unmodified sgRNA. In some embodiments, the invention comprises methods comprising administering any one of the gRNAs disclosed herein to a subject, wherein the gRNA elicits a lower concentration of immune cytokines in the subject's serum as compared to a control gRNA that is not similarly modified.
In some embodiments, the gRNA compositions, compositions, or pharmaceutical formulations disclosed herein, alone or encoded on one or more vectors, are formulated in or administered via a lipid nanoparticle; see e.g., WO2017/173054, the contents of which are hereby incorporated by reference in their entirety.
Lipids; Formulation; Delivery
Disclosed herein are various embodiments using lipid nucleic acid assembly compositions comprising nucleic acids(s), or composition(s) described herein. In some embodiments, the lipid nucleic acid assembly composition comprises a nucleic acid described herein (e.g., a gRNA comprising an internal linker).
As used herein, a “lipid nucleic acid assembly composition” refers to lipid-based delivery compositions, including lipid nanoparticles (LNPs) and lipoplexes. LNP refers to lipid nanoparticles <100 nm. LNPs are formed by precise mixing a lipid component (e.g., in ethanol) with an aqueous nucleic acid component and LNPs are uniform in size. Lipoplexes are particles formed by bulk mixing the lipid and nucleic acid components and are between about 100 nm and 1 micron in size. In certain embodiments the lipid nucleic acid assemblies are LNPs. As used herein, a “lipid nucleic acid assembly” comprises a plurality of (i.e. more than one) lipid molecules physically associated with each other by intermolecular forces. A lipid nucleic acid assembly may comprise a bioavailable lipid having a pKa value of <7.5 or <7. The lipid nucleic acid assemblies are formed by mixing an aqueous nucleic acid-containing solution with an organic solvent-based lipid solution, e.g., 100% ethanol. Suitable solutions or solvents include or may contain: water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, diethylether, cyclohexane, tetrahydrofuran, methanol, isopropanol. A pharmaceutically acceptable buffer may optionally be comprised in a pharmaceutical formulation comprising the lipid nucleic acid assemblies, e.g., for an ex vivo therapy. In some embodiments, the aqueous solution comprises a gRNA described herein. In some embodiments, the aqueous solution further comprises an mRNA encoding an RNA-guided DNA binding agent, such as Cas9.
As used herein, lipid nanoparticle (LNP) refers to a particle that comprises a plurality of (i.e., more than one) lipid molecules physically associated with each other by intermolecular forces. The LNPs may be, e.g., microspheres (including unilamellar and multilamellar vesicles, e.g., “liposomes”-lamellar phase lipid bilayers that, in some embodiments, are substantially spherical—and, in more particular embodiments, can comprise an aqueous core, e.g., comprising a substantial portion of RNA molecules), a dispersed phase in an emulsion, micelles, or an internal phase in a suspension. Emulsions, micelles, and suspensions may be suitable compositions for local and/or topical delivery. See also, e.g., WO2017173054A1, the contents of which are hereby incorporated by reference in their entirety. Any LNP known to those of skill in the art to be capable of delivering nucleotides to subjects may be utilized with the guide RNAs described herein.
In some embodiments, the aqueous solution comprises a gRNA described herein. A pharmaceutical formulation comprising the lipid nucleic acid assembly composition may optionally comprise a pharmaceutically acceptable buffer.
In some embodiments, the lipid nucleic acid assembly compositions include an “amine lipid” (sometimes herein or elsewhere described as an “ionizable lipid” or a “biodegradable lipid”), together with an optional “helper lipid”, a “neutral lipid”, and a stealth lipid such as a PEG lipid. In some embodiments, the amine lipids or ionizable lipids are cationic depending on the pH.
In some embodiments, lipid nucleic acid assembly compositions comprise an “amine lipid”, which is, for example an ionizable lipid such as Lipid A or its equivalents, including acetal analogs of Lipid A.
In some embodiments, the amine lipid is Lipid A, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate. Lipid A can be depicted as:
Lipid A may be synthesized according to WO2015/095340 (e.g., pp. 84-86). In some embodiments, the amine lipid is an equivalent to Lipid A.
In some embodiments, an amine lipid is an analog of Lipid A. In some embodiments, a Lipid A analog is an acetal analog of Lipid A. In particular lipid nucleic acid assembly compositions, the acetal analog is a C4-C12 acetal analog. In some embodiments, the acetal analog is a C5-C12 acetal analog. In additional embodiments, the acetal analog is a C5-C10 acetal analog. In further embodiments, the acetal analog is chosen from a C4, C5, C6, C7, C9, C10, C11, and C12 acetal analog.
Amine lipids and other “biodegradable lipids” suitable for use in the lipid nucleic acid assemblies described herein are biodegradable in vivo or ex vivo. The amine lipids have low toxicity (e.g., are tolerated in animal models without adverse effect in amounts of greater than or equal to 10 mg/kg). In some embodiments, lipid nucleic acid assemblies comprising an amine lipid include those where at least 75% of the amine lipid is cleared from the plasma or the engineered cell within 8, 10, 12, 24, or 48 hours, or 3, 4, 5, 6, 7, or 10 days. In some embodiments, lipid nucleic acid assemblies comprising an amine lipid include those where at least 50% of the nucleic acid, e.g., mRNA or gRNA, is cleared from the plasma within 8, 10, 12, 24, or 48 hours, or 3, 4, 5, 6, 7, or 10 days. In some embodiments, lipid nucleic acid assemblies comprising an amine lipid include those where at least 50% of the lipid nucleic acid assembly is cleared from the plasma within 8, 10, 12, 24, or 48 hours, or 3, 4, 5, 6, 7, or 10 days, for example by measuring a lipid (e.g. an amine lipid), nucleic acid, e.g., RNA/mRNA, or other component. In some embodiments, lipid-encapsulated versus free lipid, RNA, or nucleic acid component of the lipid nucleic acid assembly is measured.
Biodegradable lipids include, for example the biodegradable lipids of WO/2020/219876, WO/2020/118041, WO/2020/072605, WO/2019/067992, WO/2017/173054, WO2015/095340, and WO2014/136086, and LNPs include LNP compositions described therein, the lipids and compositions of which are hereby incorporated by reference.
Lipid clearance may be measured as described in literature. See Maier, M. A., et al. Biodegradable Lipids Enabling Rapidly Eliminated Lipid Nanoparticles for Systemic Delivery of RNAi Therapeutics. Mol. Ther. 2013, 21(8), 1570-78 (“Maier”). For example, in Maier, LNP-siRNA systems containing luciferases-targeting siRNA were administered to six- to eight-week old male C57Bl/6 mice at 0.3 mg/kg by intravenous bolus injection via the lateral tail vein. Blood, liver, and spleen samples were collected at 0.083, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 96, and 168 hours post-dose. Mice were perfused with saline before tissue collection and blood samples were processed to obtain plasma. All samples were processed and analyzed by LC-MS. Further, Maier describes a procedure for assessing toxicity after administration of LNP-siRNA formulations. For example, a luciferase-targeting siRNA was administered at 0, 1, 3, 5, and 10 mg/kg (5 animals/group) via single intravenous bolus injection at a dose volume of 5 mL/kg to male Sprague-Dawley rats. After 24 hours, about 1 mL of blood was obtained from the jugular vein of conscious animals and the serum was isolated. At 72 hours post-dose, all animals were euthanized for necropsy. Assessments of clinical signs, body weight, serum chemistry, organ weights and histopathology were performed. Although Maier describes methods for assessing siRNA-LNP formulations, these methods may be applied to assess clearance, pharmacokinetics, and toxicity of administration of lipid nucleic acid assembly compositions of the present disclosure.
Ionizable and bioavailable lipids for LNP delivery of nucleic acids known in the art are suitable. Lipids may be ionizable depending upon the pH of the medium they are in. For example, in a slightly acidic medium, the lipid, such as an amine lipid, may be protonated and thus bear a positive charge. Conversely, in a slightly basic medium, such as, for example, blood where pH is approximately 7.35, the lipid, such as an amine lipid, may not be protonated and thus bear no charge.
The ability of a lipid to bear a charge is related to its intrinsic pKa. In some embodiments, the amine lipids of the present disclosure may each, independently, have a pKa in the range of from about 5.1 to about 7.4. In some embodiments, the bioavailable lipids of the present disclosure may each, independently, have a pKa in the range of from about 5.1 to about 7.4, such as from about 5.5 to about 6.6, from about 5.6 to about 6.4, from about 5.8 to about 6.2, or from about 5.8 to about 6.5. For example, the amine lipids of the present disclosure may each, independently, have a pKa in the range of from about 5.8 to about 6.5. Lipids with a pKa ranging from about 5.1 to about 7.4 are effective for delivery of cargo in vivo, e.g. to the liver. Further, it has been found that lipids with a pKa ranging from about 5.3 to about 6.4 are effective for delivery in vivo, e.g. to tumors. See, e.g., WO2014/136086.
Additional Lipids
“Neutral lipids” suitable for use in a lipid nucleic acid assembly composition of the disclosure include, for example, a variety of neutral, uncharged or zwitterionic lipids. Examples of neutral phospholipids suitable for use in the present disclosure include, but are not limited to, 5-heptadecylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), pohsphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoyl phosphatidylcholine (MPPC), 1-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), 1-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoyl phosphatidylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidyl choline, dioleoyl phosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine distearoylphosphatidylethanolamine (DSPE), dimyristoyl phosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine and combinations thereof. In one embodiment, the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoyl phosphatidyl ethanolamine (DMPE). In another embodiment, the neutral phospholipid may be distearoylphosphatidylcholine (DSPC).
“Helper lipids” include steroids, sterols, and alkyl resorcinols. Helper lipids suitable for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In one embodiment, the helper lipid may be cholesterol. In one embodiment, the helper lipid may be cholesterol hemisuccinate.
“Stealth lipids” are lipids that alter the length of time the nanoparticles can exist in vivo (e.g., in the blood). Stealth lipids may assist in the formulation process by, for example, reducing particle aggregation and controlling particle size. Stealth lipids used herein may modulate pharmacokinetic properties of the lipid nucleic acid assembly or aid in stability of the nanoparticle ex vivo. Stealth lipids suitable for use in a lipid nucleic acid assembly composition of the disclosure include, but are not limited to, stealth lipids having a hydrophilic head group linked to a lipid moiety. Stealth lipids suitable for use in a lipid nucleic acid assembly composition of the present disclosure and information about the biochemistry of such lipids can be found in Romberg et al., Pharmaceutical Research, Vol. 25, No. 1, 2008, pg. 55-71 and Hoekstra et al., Biochimica et Biophysica Acta 1660 (2004) 41-52. Additional suitable PEG lipids are disclosed, e.g., in WO 2006/007712.
In one embodiment, the hydrophilic head group of stealth lipid comprises a polymer moiety selected from polymers based on PEG. Stealth lipids may comprise a lipid moiety. In some embodiments, the stealth lipid is a PEG lipid.
In one embodiment, a stealth lipid comprises a polymer moiety selected from polymers based on PEG (sometimes referred to as poly(ethylene oxide)), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N-vinylpyrrolidone), polyaminoacids and poly[N-(2-hydroxypropyl)methacrylamide].
In one embodiment, the PEG lipid comprises a polymer moiety based on PEG (sometimes referred to as poly(ethylene oxide)).
The PEG lipid further comprises a lipid moiety. In some embodiments, the lipid moiety may be derived from diacylglycerol or diacylglycamide, including those comprising a dialkylglycerol or dialkylglycamide group having alkyl chain length independently comprising from about C4 to about C40 saturated or unsaturated carbon atoms, wherein the chain may comprise one or more functional groups such as, for example, an amide or ester. In some embodiments, the alkyl chain length comprises about C10 to C20. The dialkylglycerol or dialkylglycamide group can further comprise one or more substituted alkyl groups. The chain lengths may be symmetrical or asymmetrical.
Unless otherwise indicated, the term “PEG” as used herein means any polyethylene glycol or other polyalkylene ether polymer. In one embodiment, PEG is an optionally substituted linear or branched polymer of ethylene glycol or ethylene oxide. In one embodiment, PEG is unsubstituted. In one embodiment, the PEG is substituted, e.g., by one or more alkyl, alkoxy, acyl, hydroxy, or aryl groups. In one embodiment, the term includes PEG copolymers such as PEG-polyurethane or PEG-polypropylene (see, e.g., J. Milton Harris, Poly(ethylene glycol) chemistry: biotechnical and biomedical applications (1992)); in another embodiment, the term does not include PEG copolymers. In one embodiment, the PEG has a molecular weight of from about 130 to about 50,000, in a sub-embodiment, about 150 to about 30,000, in a sub-embodiment, about 150 to about 20,000, in a sub-embodiment about 150 to about 15,000, in a sub-embodiment, about 150 to about 10,000, in a sub-embodiment, about 150 to about 6,000, in a sub-embodiment, about 150 to about 5,000, in a sub-embodiment, about 150 to about 4,000, in a sub-embodiment, about 150 to about 3,000, in a sub-embodiment, about 300 to about 3,000, in a sub-embodiment, about 1,000 to about 3,000, and in a sub-embodiment, about 1,500 to about 2,500.
In some embodiments, the PEG (e.g., conjugated to a lipid moiety or lipid, such as a stealth lipid), is a “PEG-2K,” also termed “PEG2k” or “PEG 2000,” which has an average molecular weight of about 2,000 daltons. PEG-2K is represented herein by the following formula (I), wherein n is 45, meaning that the number averaged degree of polymerization comprises about 45 subunits
However, other PEG embodiments known in the art may be used, including, e.g., those where the number-averaged degree of polymerization comprises about 23 subunits (n=23), and/or 68 subunits (n=68). In some embodiments, n may range from about 30 to about 60. In some embodiments, n may range from about 35 to about 55. In some embodiments, n may range from about 40 to about 50. In some embodiments, n may range from about 42 to about 48. In some embodiments, n may be 45. In some embodiments, R may be selected from H, substituted alkyl, and unsubstituted alkyl. In some embodiments, R may be unsubstituted alkyl. In some embodiments, R may be methyl.
In any of the embodiments described herein, the PEG lipid may be selected from PEG-dilauroylglycerol, PEG-dimyristoylglycerol (PEG-DMG) (e.g., 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000 (PEG2k-DMG) or PEG-DMG (catalog #GM-020 from NOF, Tokyo, Japan)), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE) (catalog #DSPE-020CN, NOF, Tokyo, Japan), PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, and PEG-distearoylglycamide, PEG-cholesterol (1-[8′-(Cholest-5-en-3[beta]-oxy)carboxamido-3′,6′-dioxaoctanyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4-ditetradecoxylbenzyl-[omega]-methyl-poly(ethylene glycol)ether), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMG) (cat. #880150P from Avanti Polar Lipids, Alabaster, Alabama, USA), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE) (cat. #880120C from Avanti Polar Lipids, Alabaster, Alabama, USA), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG2k-DSG; GS-020, NOF Tokyo, Japan), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DMA), and 1,2-distearyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSA). In one embodiment, the PEG lipid may be 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000 (PEG2k-DMG). In one embodiment, the PEG lipid may be PEG2k-DMG. In some embodiments, the PEG lipid may be PEG2k-DSG. In one embodiment, the PEG lipid may be PEG2k-DSPE. In one embodiment, the PEG lipid may be PEG2k-DMA. In one embodiment, the PEG lipid may be PEG2k-C-DMA. In one embodiment, the PEG lipid may be compound 5027, disclosed in WO2016/010840 (paragraphs [00240] to [00244]). In one embodiment, the PEG lipid may be PEG2k-DSA. In one embodiment, the PEG lipid may be PEG2k-C11. In some embodiments, the PEG lipid may be PEG2k-C14. In some embodiments, the PEG lipid may be PEG2k-C16. In some embodiments, the PEG lipid may be PEG2k-C18.
LNP Delivery of gRNA
Lipid nanoparticles (LNPs) are a well-known means for delivery of nucleotide and protein cargo, and may be used for delivery of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs), compositions, or pharmaceutical formulations disclosed herein. In some embodiments, the LNPs deliver nucleic acid, protein, or nucleic acid together with protein. As used herein, lipid nanoparticle (LNP) refers to a particle that comprises a plurality of (i.e., more than one) lipid molecules physically associated with each other by intermolecular forces. The LNPs may be, e.g., microspheres (including unilamellar and multilamellar vesicles, e.g., “liposomes”-lamellar phase lipid bilayers that, in some embodiments, are substantially spherical and, in more particular embodiments, can comprise an aqueous core, e.g., comprising a substantial portion of RNA molecules), a dispersed phase in an emulsion, micelles, or an internal phase in a suspension (see, e.g., WO2017173054, the contents of which are hereby incorporated by reference in their entirety). Any LNP known to those of skill in the art to be capable of delivering nucleotides to subjects may be utilized.
In some embodiments, the invention comprises a method for delivering any one of the gRNAs (e.g., sgRNAs, dgRNAs, or crRNAs) disclosed herein to a subject, wherein the gRNA is associated with an LNP. In some embodiments, the gRNA/LNP is also associated with a Cas nuclease or a polynucleotide (e.g., mRNA or DNA) encoding a Cas nuclease.
In some embodiments, the invention comprises a composition comprising any one of the gRNAs disclosed and an LNP. In some embodiments, the composition further comprises a Cas9 or a polynucleotide (e.g., mRNA or DNA) encoding Cas9.
In some embodiments, provided herein is a method for delivering any of the guide RNAs described herein to a cell or a population of cells or a subject, including to a cell or population of cells in a subject in vivo, wherein any one or more of the components is associated with an LNP. In some embodiments, the method further comprises an RNA-guided DNA-binding agent (e.g., Cas9 or a polynucleotide (e.g., mRNA or DNA) encoding Cas9).
In some embodiments, provided herein is a composition comprising any of the guide RNAs described herein or donor construct disclosed herein, alone or in combination, with an LNP. In some embodiments, the composition further comprises an RNA-guided DNA-binding agent (e.g., Cas9 or a polynucleotide (e.g., mRNA or DNA) encoding Cas9).
In some embodiments, the LNPs comprise cationic lipids. In some embodiments, the LNPs comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate). In some embodiments, the LNPs comprise molar ratios of a cationic lipid amine to RNA phosphate (N:P) of about 4.5. In some embodiments, the LNPs comprise is nonyl 8-((7,7-bis(octyloxy)heptyl)(2-hydroxyethyl)amino)octanoate. In some embodiments, the LNPs comprise molar ratios of a cationic lipid amine to RNA phosphate (N:P) of about 4.5-6.5. In some embodiments, the LNPs comprise molar ratios of a cationic lipid amine to RNA phosphate (N:P) of about 4.5. In some embodiments, the LNPs comprise molar ratios of a cationic lipid amine to RNA phosphate (N:P) of about 6.0.
In some embodiments, LNPs associated with the gRNAs disclosed herein are for use in preparing a medicament for treating a disease or disorder.
Electroporation is a well-known means for delivery of cargo, and any electroporation methodology may be used for delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation may be used to deliver any one of the gRNAs disclosed herein and Cas9 or a polynucleotide (e.g., mRNA or DNA) encoding Cas9.
In some embodiments, the invention comprises a method for delivering any one of the gRNAs disclosed herein to an ex vivo cell, wherein the gRNA is associated with an LNP or not associated with an LNP. In some embodiments, the gRNA/LNP or gRNA is also associated with a Cas9 or a polynucleotide (e.g., mRNA or DNA) encoding Cas9. See, e.g., WO2021222287, incorporated herein by reference.
In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a an mRNA encoding an RNA-guided DNA nuclease, which can be a Cas nuclease, such as Cas9 or Cpf1. In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, and an mRNA encoding an RNA-guided DNA nuclease, which can be a Cas protein, such as, Cas9. In one embodiment, the Cas9 is from Spy Cas9 or NmeCas9. In some embodiments, the nucleotide sequence encoding the crRNA, trRNA, or crRNA and trRNA (which may be a sgRNA) comprises or consists of a guide sequence flanked by all or a portion of a repeat sequence from a naturally-occurring CRISPR/Cas system. The nucleic acid comprising or consisting of the crRNA, trRNA, or crRNA and trRNA may further comprise a vector sequence wherein the vector sequence comprises or consists of nucleic acids that are not naturally found together with the crRNA, trRNA, or crRNA and trRNA.
In some embodiments, the components can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or they can be delivered by viral vectors (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus). Methods and compositions for non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, LNPs, polycation or lipid:nucleic acid conjugates, naked nucleic acid (e.g., naked DNA/RNA), artificial virions, and agent-enhanced uptake of DNA. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids.
This description and exemplary embodiments should not be taken as limiting. For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing quantities, percentages, or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about,” to the extent they are not already so modified.
The following examples are provided to illustrate certain disclosed embodiments and are not to be construed as limiting the scope of this disclosure in any way.
In Vitro Transcription (“IVT”) of Nuclease mRNA
Capped and polyadenylated mRNA containing N1-methyl pseudo-U was generated by in vitro transcription using routine methods. Typically, a plasmid DNA containing a T7 promoter, a sequence for transcription, and a polyadenylation region was linearized with XbaI per manufacturer's protocol. The XbaI was inactivated by heating. The linearized plasmid was purified from enzyme and buffer salts. The IVT reaction to generate modified mRNA was performed by incubating at 37° C.: 50 ng/μL linearized plasmid; 2-5 mM each of GTP, ATP, CTP, and N1-methyl pseudo-UTP (Trilink); 10-25 mM ARCA (Trilink); 5 U/μL T7 RNA polymerase; 1 U/μL Murine RNase inhibitor (NEB); 0.004 U/μL Inorganic E. coli pyrophosphatase (NEB); and 1× reaction buffer. TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U/μL, and the reaction was incubated at 37° C. to remove the DNA template.
The mRNA was purified using a MegaClear Transcription Clean-up kit (ThermoFisher) or a RNeasy Maxi kit (Qiagen) per the manufacturers' protocols. Alternatively, the mRNA was purified through a precipitation protocol, which in some cases was followed by HPLC-based purification. Briefly, after the DNase digestion, mRNA was purified using LiCl precipitation, ammonium acetate precipitation, and sodium acetate precipitation. For HPLC purified mRNA, after the LiCl precipitation and reconstitution, the mRNA was purified by RP-IP HPLC (see, e.g., Kariko, et al. Nucleic Acids Research, 2011, Vol. 39, No. 21 e142). The fractions chosen for pooling were combined and desalted by sodium acetate/ethanol precipitation as described above. In a further alternative method, mRNA was purified with a LiCl precipitation method followed by further purification by tangential flow filtration. RNA concentrations were determined by measuring the light absorbance at 260 nm (Nanodrop), and transcripts were analyzed by capillary electrophoresis by Bioanlayzer (Agilent).
Streptococcus pyogenes (“Spy”) Cas9 mRNA was generated from plasmid DNA encoding an open reading frame according to SEQ ID Nos: 321-323 (see sequences in Table 5). When the sequences cited in this paragraph are referred to below with respect to RNAs, it is understood that Ts should be replaced with Us (which can be modified nucleosides as described above). Messenger RNAs used in the Examples include a 5′ cap and a 3′ polyadenylation sequence e.g., up to 100 nucleotides. Guide RNAs were chemically synthesized by commercial vendors or using standard in vitro synthesis techniques with modified nucleotides.
Cell Preparation
Short sgRNAs targeting the mouse, rat, human, and cynomolgus (cyno) transthyretin TTR gene were designed and used for lipofection as described below, into primary mouse hepatocytes (PMH), primary rat hepatocytes (PRH), primary human hepatocytes (PHH), and primary cynomolgus hepatocytes (PCH), respectively. PMH, PRH, PHH, or PCH were thawed and resuspended in hepatocyte thawing medium with plating supplements (William's E Medium (Gibco, Cat. A12176-01, Lot 2039733)) with dexamethasone+cocktail supplement (Gibco, Cat. A15563, Lot 2019842) and Plating Supplements with FBS content (Gibco, Cat. A13450, Lot 1970698) followed by centrifugation. The supernatant was discarded and the pelleted cells resuspended in hepatocyte plating medium plus supplement pack (Invitrogen, Cat. A1217601 and Gibco, Cat. CM3000). Cells were counted and plated on Bio-coat collagen I coated 96-well plates (ThermoFisher, Cat. 877272). Plated cells were allowed to settle and adhere for 4-6 hours in a tissue culture incubator at 37° C. and 5% CO2 atmosphere. After incubation, cells were checked for monolayer formation and were washed once with hepatocyte maintenance medium (Invitrogen, Cat. A1217601 and Gibco, Cat. CM4000).
Preparation of LNP Formulation Containing sgRNA and Cas9 mRNA
In general, the lipid nanoparticle components were dissolved in 100% ethanol at various molar ratios. The RNA cargos (e.g., Cas9 mRNA and sgRNA) were dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0, resulting in a concentration of RNA cargo of approximately 0.45 mg/mL. The LNPs used contained ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate), also called herein Lipid A, cholesterol, distearoylphosphatidylcholine (DSPC), and 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000 (PEG2k-DMG) in a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6, and a ratio of gRNA to mRNA of 1:2 by weight. The LNPs used comprise a single RNA species such as Cas9 mRNA or a sgRNA. LNP are similarly prepared with a mixture of Cas9 mRNA and a guide RNA.
The LNPs were prepared using a cross-flow technique utilizing impinging jet mixing of the lipid in ethanol with two volumes of RNA solutions and one volume of water. The lipid in ethanol was mixed through a mixing cross with the two volumes of RNA solution. A fourth stream of water was mixed with the outlet stream of the cross through an inline tee (See WO2016010840
sgRNA and Cas9 mRNA Lipofection
Lipofection of Cas9 mRNA and gRNAs used pre-mixed lipid formulations. The lipofection reagent contained ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate), cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. This mixture was reconstituted in 100% ethanol then mixed with RNA cargos (e.g., Cas9 mRNA and gRNA) at a lipid amine to RNA phosphate (N:P) molar ratio of about 6.0. Guide RNA was chemically synthesized by commercial vendors or using standard in vitro synthesis techniques with modified nucleotides. An mRNA comprising a Cas9 ORF of Table 5 was produced by in vitro transcription (IVT) as described in WO2019/067910, see e.g. ¶354, using a 2 hour IVT reaction time and purifying the mRNA by LiCl precipitation followed by tangential flow filtration.
Lipofections were performed with a ratio of gRNA to mRNA of 1:1 by weight. Briefly, cells were incubated at 37° C., 5% CO2 for 24 hours prior to treatment with LNPs. LNPs were incubated in media containing 6% cynomolgus monkey or 6% fetal bovine serum (FBS) at 37° C. for 10 minutes. Post-incubation, the LNPs were added to the mouse or cynomolgus hepatocytes in an 8 or 12 point 3-fold dose response curve starting at 300 ng Cas9 mRNA. The cells were lysed 72 hours post-treatment for NGS analysis as described in Example 1.
Genomic DNA Isolation
Cells were harvested post-transfection at 72 hours. The gDNA was extracted from each well of a 96-well plate using 50 μL/well QuickExtract DNA Extraction solution (Epicentre, Cat. QE09050) or Quick Extract (Lucigen, Cat. SS000035-D2) according to manufacturer's protocol.
Next-Generation Sequencing (“NGS”) and Analysis for Editing Efficiency
To quantitatively determine the efficiency of editing at the target location in the genome, sequencing was utilized to identify the presence of insertions and deletions introduced by gene editing. PCR primers were designed around the target site within the gene of interest (e.g. TTR), and the genomic area of interest was amplified. Primer sequence design was done as is standard in the field.
Additional PCR was performed according to the manufacturer's protocols (Illumina) to add chemistry for sequencing. The amplicons were sequenced on an Illumina MiSeq instrument. The reads were aligned to the reference genome (e.g., hg38) after eliminating those having low quality scores. The resulting files containing the reads were mapped to the reference genome (BAM files), where reads that overlapped the target region of interest were selected and the number of wild type reads versus the number of reads which contain an insertion or deletion (“indel”) was calculated.
The editing percentage (e.g., the “editing efficiency” or “percent editing”) is defined as the total number of sequence reads with insertions or deletions (“indels”) over the total number of sequence reads, including wild type.
sgRNAs sharing the same targeting sequence, which is cross-reactive to mouse, cynomolgus monkey, and human TTR genes, with various scaffold sequences were designed as shown in Tables 2A-2B and lipofected into primary mouse (PMH), cynomolgus monkey (PCH), and human (PHH) hepatocytes. Cells from In Vitro ADMET Laboratories, Inc. and Gibco™ were prepared, treated by lipofection and analyzed as described above unless otherwise noted. Specifically, PMH (Lot #839), PCH (Lot #10136011), and PHH (Lot #8296) cells were used and plated at densities of 15,000, 30,000, and 33,000 cells/well, respectively. Lipofection reagent was prepared as described in Example 1 using a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. Lipofection samples were prepared using an N:P molar ratio of about 6 and a gRNA:mRNA ratio of 1:1 by weight. Duplicate samples were included in the assay. Mean editing results with standard deviation (SD) are shown in Table 6 and
sgRNAs all having the same targeting sequence which is cross-reactive with mouse, human, cynomolgus monkey TTR genes, were designed with various scaffold sequences as shown in Tables 2A-2B that incorporated PEG linkers into different regions of the sgRNA constant region. Guides and Cas9 mRNA were lipofected into primary mouse hepatoctyes (PMH) as described above. PMH (Lot #839) cells were used and plated at a density of 15,000 cells/well. Cells from Gibco™ were prepared, treated by lipofection and analyzed as described above unless otherwise noted. Guides were assayed in an 8 point 3-fold dilution curve starting at 46.5 nM guide concentration as shown in Table 7. Two sets of guides were tested with control guides G000502 and G012401. Samples were run in triplicate. EC50 values and mean editing results are shown in Table 7. Dose response curves are plotted in
Selected sgRNAs from Table 7 were further evaluated in primary mouse hepatocytes (PMH) and primary cynomolgus hepatocytes (PCH) using the same methods to prepare, treat by LNP, and analyze cells described above. PMH (Lot #839) and PCH (Lot #CY6011) cells from Gibco™ were used and plated at a density of 15,000 and 30,000 cells/well, respectively. LNP formulations were prepared as described in Example 1 at a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG, using an N:P molar ratio of about 6 and a 1:2 ratio of gRNA:mRNA by weight. Guides were assayed in an 8 point 3-fold dilution dose response curve starting at 46.5 nM guide concentration as shown in Table 8. Samples were run in duplicate. EC50 values and mean editing results for PMH and PCH are shown in Table 8. Dose response curves are plotted in
Additional sgRNAs were evaluated in primary mouse hepatocytes (PMH), primary rat hepatocytes (PRH), and primary cynomolgus hepatocytes (PCH) using the same methods to prepare, treat by LNP, and analyze cells described above unless otherwise noted. PMH (Lot #839) cells were used and plated at a density of 15,000 cells/well. PMH (Lot #839 or Lot #mc114), PCH (Lot #10136011), and PRH (Lot #977A) cells were used and plated at densities of 15,000, 33,000, and 30,000 cells/well, respectively. respectively. LNP formulations were prepared as described in Example 1 at a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG, using an N:P molar ratio of about 6 and a 1:2 ratio of gRNA:mRNA by weight. Guides were assayed in a 12 point 3-fold dose response curve starting at 46.5 nM guide concentration as shown in Tables 8 and 9. Controls, G017276 and G000502, for PMH and PCH were run with 6 and 4 replicates and remaining samples with 4 and 2 replicates, respectively. Controls, G017276 and G000502, for PMH and PCH were run with 6 and 3 replicates and test samples with 4 and 2 replicates, respectively. Controls, G018631 and G022500, for PRH were run with 4 replicates and remaining samples with 2 replicates. EC50 values and mean editing results for PMH and PCH are shown in Table 9 and for PRH in Table 10. Dose response curves are plotted for PMH, PCH, and PRH in
The LNPs used in all in vivo studies were formulated as described in Example 1. Deviations from the protocol are noted in the respective Example. Transport and storage solution (TSS) used in LNP preparation was dosed in the experiment as a vehicle-only negative control. The nucleotide sequences of the sgRNA contained in the LNPs all target the same sequence in the TTR gene as indicated in Tables 2A-2B.
Selected guide designs from Tables 2A-2B were tested for editing efficiency in vivo. CD-1 female mice, ranging 6-10 weeks of age were used in each study involving mice. Animals were weighed pre-dose. LNPs were dosed via the lateral tail vein at a volume of 0.2 mL per animal (approximately 10 mL per kilogram body weight). The animals were observed at approximately 6 hours post dose for adverse effects. Body weight was measured at twenty-four hours post-administration, and animals were euthanized at 8 days post dose by exsanguination under isoflurane anesthesia. Blood was collected via cardiac puncture into serum separator tubes or into tubes containing buffered sodium citrate for plasma as described herein. For studies involving in vivo editing, liver tissue was collected from the left medial lobe from each animal for DNA extraction and analysis.
For the in vivo studies, genomic DNA was extracted from 10 mg of tissue using a bead-based extraction kit, e.g. the Zymo Quick-DNA 96 kit (Zymo Research, Cat. #D3010) according to the manufacturer's protocol, which includes homogenizing the tissue in lysis buffer (approximately 400 μL/10 mg tissue). All DNA samples were normalized to 100 ng/μL concentration for PCR and subsequent NGS analysis, as described in Example 1.
Blood was collected, and the serum was isolated as described above. The total TTR serum levels were determined using a Mouse Prealbumin (Transthyretin) ELISA Kit (Aviva Systems Biology, Cat. OKIA00111); rat TTR serum levels were measured using a rat specific ELISA kit (Aviva Systems Biology catalog number OKIA00159). Kit reagents and standards were prepared according to the manufacturer's protocol. Mouse or rat serum was diluted to a final dilution of 10,000-fold with 1× assay diluent. This was done by carrying out two sequential 50-fold dilutions resulting in a 2500-fold dilution. A final 4-fold dilution step was carried out for a total sample dilution of 10,000-fold. Both standard curve dilutions (100 μL each) and diluted serum samples were added to each well of the ELISA plate pre-coated with capture antibody. The plate was incubated at room temperature for 30 minutes before washing. Enzyme-antibody conjugate (100 μL per well) was added for a 20-minute incubation. Unbound antibody conjugate was removed and the plate was washed again before the addition of the chromogenic substrate solution. The plate was incubated for 10 minutes before adding 100 μL of the stop solution, e.g., sulfuric acid (approximately 0.3 M). The plate was read on a SpectraMax M5 or Clariostar plate reader at an absorbance of 450 nm. Serum TTR levels were calculated by SoftMax Pro software ver. 6.4.2 or Mars software ver. 3.31 using a four-parameter logistic curve fit off the standard curve. Final serum values were adjusted for the assay dilution. Percent protein knockdown (% KD) values were determined relative to controls, which generally were animals sham-treated with vehicle (TSS) unless otherwise indicated. Negative % KD values were observed in individual or a group of animals with TTR levels higher than the control group average resulting in a negative knockdown value.
LNPs were generally prepared as described in Example 1. LNP formulations were analyzed for average particle size, polydispersity (pdi), total RNA content and encapsulation efficiency of RNA as described in Example 1 and results shown in Table 11.
LNPs containing sgRNAs indicated in Table 12 were administered to female CD-1 mice (n=5) at a dose of 0.1 mg/kg of total RNA as described above. Guide G017276 served as the control. The editing efficiency, TTR protein levels, and percent TTR knockdown (% KD) for LNPs containing the indicated sgRNAs are shown in Table 12 and editing efficiency and TTR protein levels are illustrated in
Selected guides from Table 12 were administered to female CD-1 mice (n=5) at 0.1 mg/kg and 0.03 mg/kg of total RNA as described above. Guides G0012401 and G001727 served as controls. Table 13 shows the editing efficiency, TTR protein levels, and percent TTR knockdown, respectively, for LNPs containing the indicated sgRNAs and editing efficiency is shown in
Further guides with the same targeting sequence with additional linker modifications were administered to female CD-1 mice (n=5) at 0.1 mg/kg and 0.03 mg/kg of total RNA as described above. Guides G017276 and G000502 served as controls. Table 14 shows the editing efficiency, TTR protein levels, and percent TTR knockdown, respectively, for LNPs containing the indicated sgRNAs and editing efficiency is shown in
Selected guide designs were further tested in rats. Sprague Dawley female rats from Charles River, ranging 6-8 weeks of age, were used in each study involving rats. LNPs were dosed via lateral tail vein injection. LNP formulations were prepared as described in Example 1 at a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG, using an N:P molar ratio of about 6 and a 1:2 ratio of gRNA:mRNA by weight. The animals were observed post dose for adverse effects. Body weight was measured at twenty-four hours post-administration and animals euthanized post dose via exsanguination under CO2 asphyxiation. Blood was collected via cardiac puncture into serum separator tubes (Geriner Bio One, Catalog #450472). For studies involving in vivo editing, liver tissue was collected from each animal. Genomic DNA was isolated and processed as described in Example 5. All DNA samples were prepared for PCR and subsequent NGS analysis as described in Example 5.
Editing efficiency in the liver and TTR serum protein levels were evaluated for each rat sample as described in Example 5. The results shown in each of the following study tables denote the sgRNA contained within each LNP (See Tables 2A-2B for sgRNA nucleotide sequences) which all target the same sequence in the TTR gene. LNPs were prepared as described in Example 5. Deviations from the protocol are noted in the respective Examples below.
LNPs containing sgRNAs indicated in Table 15 were administered to female Sprague Dawley rats (n=5) at a dose of 0.1 mg/kg and 0.03 mg/kg of total RNA as described above. Guides G000534 and G018631 served as the control. Table 15 shows the editing efficiency, serum TTR protein, and percent TSS, respectively. Editing efficiency and serum TTR protein levels are illustrated in
Studies were conducted to evaluate the editing efficiency of sgRNA designs that contain PEG linkers (pgRNA). The study compared two gRNAs targeting TTR with the same guide sequence, one of which included three PEG linkers in the constant region of the guide (pgRNA, G021846) and one of which did not (G021845) as shown in Table 4B. The guides and mRNA were formulated in separate LNPs and mixed to the desired ratios for delivery to primary mouse hepatocytes (PMH) via lipid nanoparticles (LNPs).
PMH cells were prepared, treated, and analyzed as described in Example 1 unless otherwise noted. PMH cells from In Vitro ADMET Laboratories (Lot #MCM114) were plated at a density of 15,000 cells/well. Cells were treated with LNPs as described below. LNPs were generally prepared as described in Example 1. LNPs were prepared with a lipid composition at a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6. LNPs encapsulated a single RNA species, either gRNA G021845, gRNA G021846 or mRNA (mRNA M) as described in Example 1.
PMH cells were treated with varying amounts of LNPs at ratios of gRNA to mRNA of 1:4, 1:2, 1:1, 2:1, 4:1, or 8:1 by weight of RNA cargo. Duplicate samples were included in each assay. Guides were assayed in an 8 point 3-fold dose response curve starting at 1 ng/uL total RNA concentration as shown in Table 16. Mean percent editing results are shown in Table 16.
Modified pgRNA having the same targeting site in the mouse TTR gene were assayed to evaluate the editing efficiency in PMH cells.
PMH cells were prepared, treated, and analyzed as described in Example 1 unless otherwise noted. PMH cells from In Vitro ADMET Laboratories (Lot #MC148) were used and plated at a density of 15,000 cells/well. LNP formulations were prepared as described in Example 1. LNPs were prepared with a lipid composition at a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6 and a gRNA as indicated in Table 17, or an mRNA.
PMH in 100 ul media were treated with LNP for 30 ng total mRNA (mRNA P) by weight and LNP for gRNA in the amounts indicated in Table 17. Samples were run in duplicate. Mean editing results for PMH are shown in Table 17 and in
Pegylated guide RNA (pgRNA) with chemical modifications in the guide sequence were tested for editing efficiency at two distinct mouse TTR regions (Exon 1 and Exon 3) in PMH. PMH (In Vitro ADMET Laboratories) were prepared as described in Example 1 with a plating density of 20,000 cells/well. Lipofection of Nme2 Cas9 mRNA (mRNA 0; SEQ ID NO: 367) and gRNAs targeting two distinct loci in mouse TTR as indicated in Table 18 used pre-mixed lipid compositions as described in Example 1. Lipoplexes were used to treat cells with 100 ng/100 ul Nme2 mRNA and with gRNA at the concentrations indicated in Table 18. Cells were incubated in maintenance media +10% FBS (Corning #35-010-CF) at 37° C. for 72 hours. Post incubation, genomic DNA was isolated and NGS analysis was performed as described in Example 1.
Editing efficiency was determined for various guide modification patterns at three gRNA concentrations (3 nM, 8 nM, or 25 nM). Duplicate samples were included in the assay. Mean editing results are shown in Table 18 and
Messenger mRNAs encoding Nme2Cas9 ORFs with different NLS placements were assayed for editing efficiency in primary mouse hepatocytes (PMH). The assay tested guides targeting the mouse TTR locus and included both sgRNA and pgRNA designs.
PMH were prepared as in Example 1 with a plating density of 20,000 cells/well. LNPs were generally prepared as described in Example 1 with a single RNA species as cargo, as indicated in Table 20. LNPs were prepared with the lipid composition at a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6.
Cells were treated with 60 ng/100 ul LNP containing gRNA by RNA weight and with LNP containing mRNA as indicated in Table 20. Cells were incubated for 72 hours at 37° C. in Williams' E Medium (Gibco, A1217601) with maintenance supplements and 10% fetal bovine serum. After 72 hours incubation at 37° C., cells were harvested and editing was assessed by NGS as described in Example 1. Mean percent editing data is shown in Table 20 and
Messenger mRNAs encoding Nme2Cas9 ORFs with different NLS placements were assayed for editing efficiency in primary mouse hepatocytes (PMH).
PMH (Gibco, MC148) were prepared as described in Example 1 with a plating density of 20,000 cells/well. LNPs were generally prepared as described in Example 1 with a single RNA species as cargo. LNPs were prepared with the lipid composition at a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6.
Cells were treated with 30 ng by RNA weight/100 ul of LNP containing gRNA G021844 and with LNP containing mRNA as indicated in Table 21. Cells were incubated at 37° C. for 24 hours in Williams' E Medium (Gibco, A1217601) with maintenance supplements and 10% fetal bovine serum. After 72 hours incubation at 37° C., cells were harvested and editing was assessed by NGS as described in Example 1. Mean percent editing data is shown in Table 21 and
The editing efficiency of modified pgRNAs was evaluated in vivo. Four nucleotides in each of the loops of the repeat/anti-repeat region, hairpin 1, and hairpin 2 were substituted with Spacer-18 PEG linkers.
LNPs were generally prepared as described in Example 1 with a single RNA species as cargo. The LNPs contained a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6.
LNPs containing gRNAs targeting the TTR gene indicated in Table 22 were administered to female CD-1 mice (n=5) at a dose of 0.1 mg/kg or 0.3 mg/kg of total RNA as described above. LNP containing mRNA (mRNA M; SEQ ID NO: 365) and LNP containing a pgRNA (G021846 or G021844) were delivered simultaneously at a ratio of 1:2 by RNA weight, respectively. Mice were euthanized at 7 days post dose.
The editing efficiency, serum TTR knockdown, and percent TSS for the LNPs containing the indicated pgRNAs are shown in Table 22 and illustrated in
A pgRNA (G021844) from the study described above was evaluated in mice with alternative mRNAs at varied dose levels. LNPs were generally prepared as described in Example 1 with a single RNA species as cargo. LNPs containing pgRNA (G21844) or mRNA (mRNA P or mRNA M) were formulated as described in Example 1. The LNPs used were prepared with a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6. Both G000502 and G021844 target exon 3 of the mouse TTR gene. LNP containing pgRNA and LNP containing mRNA were dosed simultaneously based on combined RNA weight at a ratio of 2:1 guide:mRNA by RNA weight, respectively. An additional LNP was co-formulated with G000502 and SpyCas9 mRNA at a ratio of 1:2 by weight, respectively, a preferred SpyCas9 guide:mRNA ratio.
LNPs with RNA cargo as indicated in Table 23 were administered to female CD-1 mice (n=4) at a dose of 0.1 mg/kg or 0.03 mg/kg of total RNA. The editing efficiency for LNPs containing the indicated gRNAs are shown in Table 23 and illustrated in
The editing efficiency of the modified pgRNAs tested with Nme2Cas9 was tested in a mouse model. All Nine sgRNAs tested comprised the same 24-nucleotide guide sequence targeting mTTR.
LNPs were generally prepared as described in Example 1 with a single RNA species as cargo. The LNPs used were prepared with a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6. The LNPs were mixed at a ratio of 2:1 by weight of gRNA to mRNA cargo. Dose is calculated based on the combined RNA weight of gRNA and mRNA. Transport and storage solution (TSS) used in LNP preparation was dosed in the experiment as a vehicle-only negative control.
CD-1 female mice, ranging 6-10 weeks of age, were used in each study involving mice (n=5 per group, except TSS control n=4). Formulations were administered intravenously via tail vein injection according to the doses listed in Table 24. Animals were periodically observed for adverse effects for at least 24 hours post-dose. Six days after treatment, animals were euthanized by cardiac puncture under isoflurane anesthesia; liver tissue was collected for downstream analysis. Liver punches weighing between 5 and 15 mg were collected for isolation of genomic DNA and total RNA. Genomic DNA samples were analyzed with NGS sequencing as described in Example 1. The editing efficiency for LNPs containing the indicated mRNAs and gRNAs are shown in Table 24 and illustrated in
The editing efficiency of the modified gRNAs with different mRNAs were tested with Nine base editor construct in the mouse model. LNPs were generally prepared as described in Example 1 with a single RNA species as cargo. The LNPs used were prepared with a molar ratio of 50% Lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of about 6. The LNPs used were formulated as described in Example 1, except that each component, guide RNA, or mRNA was formulated individually into an LNP, and the LNP were mixed prior to administration as described in Table 25. For Nme2Cas9 and Nme2Cas9 base editor samples, LNPs were mixed at a ratio of 2:1 by weight of gRNA to editor mRNA cargo. For SpyCas9 base editor samples, LNPs were mixed at a ratio of 1:2 by weight of gRNA to editor mRNA cargo. Dose, as indicated in Table 31 and
CD-1 female mice, ranging 6-10 weeks of age, were used in each study involving mice (n=5 per group, except TSS control n=4). Formulations were administered intravenously via tail vein injection according to the doses listed in Table 25. Animals were periodically observed for adverse effects for at least 24 hours post-dose. Six days after treatment, animals were euthanized by cardiac puncture under isoflurane anesthesia; liver tissues were collected for downstream analysis. Liver punches weighing between 5 and 15 mg were collected for isolation of genomic DNA and total RNA. Genomic DNA was extracted using a DNA isolation kit (ZymoResearch, D3010) and samples were analyzed with NGS sequencing as described in Example 1. The editing efficiency for LNPs containing the indicated gRNAs are shown in Table 25 and illustrated in
Guide RNAs targeting the same target sequence in the HEK3 genomic locus with various scaffold sequences were designed with truncations of the upper stem as shown in Table 2B. The gRNA were lipofected into human hepatoma (Huh7) cells to determine editing efficiency as follows. Cells were plated at a density of 15,000 cells/well. Lipofectamine™ MessengerMAX™ Reagent (Thermofisher) was used and samples were prepared according to the manufacturer's protocol with 50 ng of SpyCas9 mRNA (SEQ ID NO: 323)/reaction and an initial 50 nM guide concentration. Each guide RNA was serially diluted 5-fold for a 6-point dose response. Duplicate samples were included in the assay. Mean editing results with standard deviation (SD) are shown in Table 26 and
The following numbered items provide additional support for and descriptions of the embodiments herein.
Item N212 is a guide RNA (gRNA) comprising a guide region and a conserved region comprising one or more of:
˜-L0-L1-L2-# (I)
This application is a bypass continuation of International Application No. PCT/US2022/032791, filed on Jun. 9, 2022, which claims the benefit of priority to U.S. Provisional Application No. 63/209,273, filed on Jun. 10, 2021, and U.S. Provisional Application No. 63/275,427, filed on Nov. 3, 2021, the contents of each of which are incorporated by reference in its entirety. The instant application contains a Sequence Listing which has been submitted electronically in XMLformat and is hereby incorporated by reference in its entirety. Said XML copy, created on Dec. 4, 2023, is named 01155-0047-00US-ST26.XML and is 816,160 bytes in size. This disclosure relates to the field of gene editing using CRISPR/Cas systems, a part of the prokaryotic immune system that recognizes and cuts exogenous genetic elements. The prokaryotic CRISPR/Cas system relies on nucleases, having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the sequence of the RNA. Such complexes, often referred to as RNA-guided DNA binding agents, include a number of RNA-guided DNA binding agents including Cas cleavases/nickases. Cas cleavases and Cas nickases include a Csm or Cmr complex of a type III CRISPR system, the Cas10, Csm1, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases. Exemplary monomeric nucleases, such as Cas9, termed CRISPR-associated protein 9 (Cas9), induce site-specific breaks in DNA. Guide RNAs are commonly prepared by in vitro oligonucleotide synthesis. Given the cyclic nature and imperfect yield of oligonucleotide synthesis, substituting a non-nucleic acid internal linker for portions of the gRNA while retaining or even improving its activity would be desirable, e.g., so that the gRNA can be obtained in greater yield (e.g., due to fewer cycles of nucleotide addition), or compositions comprising the gRNA have greater homogeneity or fewer incomplete or erroneous products. Additionally, improved methods and compositions for preventing such degradation, improving stability of gRNAs and enhancing gene editing efficiency is desired, especially for therapeutic applications.
| Number | Date | Country | |
|---|---|---|---|
| 63209273 | Jun 2021 | US | |
| 63275427 | Nov 2021 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US22/32791 | Jun 2022 | US |
| Child | 18532127 | US |
