Antisense modulation of p38 mitogen activated protein kinase expression

FIELD OF THE INVENTION

[0002] This invention relates to compositions and methods for modulating expression of p38 mitogen activated protein kinase genes, a family of naturally present cellular genes involved in signal transduction, and inflammatory and apoptotic responses. This invention is also directed to methods for inhibiting inflammation or apoptosis; these methods can be used diagnostically or therapeutically. Furthermore, this invention is directed to treatment of diseases or conditions associated with expression of p38 mitogen activated protein kinase genes.

BACKGROUND OF THE INVENTION

[0003] Cellular responses to external factors, such as growth factors, cytokines, and stress conditions, result in altered gene expression. These signals are transmitted from the cell surface to the nucleus by signal transduction pathways. Beginning with an external factor binding to an appropriate receptor, a cascade of signal transduction events is initiated. These responses are mediated through activation of various enzymes and the subsequent activation of specific transcription factors. These activated transcription factors then modulate the expression of specific genes.

[0004] The phosphorylation of enzymes plays a key role in the transduction of extracellular signals into the cell. Mitogen activated protein kinases (MAPKs), enzymes which effect such phosphorylations are targets for the action of growth factors, hormones, and other agents involved in cellular metabolism, proliferation and differentiation (Cobb et al., J. Biol. Chem., 1995, 270, 14843). Mitogen activated protein kinases were initially discovered due to their ability to be tyrosine phosphorylated in response to exposure to bacterial lipopolysaccharides or hyperosmotic conditons (Han et al, Science, 1994, 265, 808). These conditions activate inflammatory and apoptotic responses mediated by MAPK. In general, MAP kinases are involved in a variety of signal transduction pathways (sometimes overlapping and sometimes parallel) that function to convey extracellular stimuli to protooncogene products to modulate cellular proliferation and/or differentiation (Seger et al., FASEB J., 1995, 9, 726; Cano et al., Trends Biochem. Sci., 1995, 20, 117).

[0005] One of the MAPK signal transduction pathways involves the MAP kinases p38α and p38β (also known as CSaids Binding Proteins, CSBP). These MAP kinases are responsible for the phosphorylation of ATF-2, MEFC2 and a variety of other cellular effectors that may serve as substrates for p38 MAPK proteins (Kummer et al, J. Biol. Chem., 1997, 272, 20490). Phosphorylation of p38 MAPKs potentiates the ability of these factors to activate transcription (Raingeaud et al, Mol. Cell Bio., 1996, 16, 1247; Han et al, Nature, 1997, 386, 296). Among the genes activated by the p38 MAPK signaling pathway is IL-6 (De Cesaris, P., et al., J. Biol. Chem., 1998, 273, 7566-7571).

[0006] Besides p38α and p38β, other p38 MAPK family members have been described, including p38γ (Li et al, Biochem. Biophys. Res. Commun., 1996, 228, 334), and p38δ (Jiang et al, J. Biol. Chem., 1997, 272, 30122). The term “p38” as used herein shall mean a member of the p38 MAPK family, including but not limited to p38α, p38β, p38γ and p38δ, their isoforms (Kumar et al, Biochem. Biophys. Res. Commun., 1997, 235, 533) and other members of the p38 MAPK family of proteins whether they function as p38 MAP kinases per se or not.

[0007] Modulation of the expression of one or more p38 MAPKs is desirable in order to interfere with inflammatory or apoptotic responses associated with disease states and to modulate the transcription of genes stimulated by ATF-2, MEFC2 and other p38 MAPK phosphorylation substrates.

[0008] Inhibitors of p38 MAPKs have been shown to have efficacy in animal models of arthritis (Badger, A. M., et al., J. Pharmacol. Exp. Ther., 1996, 279, 1453-1461) and angiogenesis (Jackson, J. R., et al., J. Pharmacol. Exp. Ther., 1998, 284, 687-692). MacKay, K. and Mochy-Rosen, D. (J. Biol. Chem., 1999, 274, 6272-6279) demonstrate that an inhibitor of p38 MAPKs prevents apoptosis during ischemia in cardiac myocytes, suggesting that p38 MAPK inhibitors can be used for treating ischemic heart disease. p38 MAPK also is required for T-cell HIV-1 replication (Cohen et al, Mol. Med., 1997, 3, 339) and may be a useful target for AIDS therapy. Other diseases believed to be amenable to treatment by inhibitors of p38 MAPKs are disclosed in U.S. Pat. No. 5,559,137, herein incorporated by reference.

[0009] Therapeutic agents designed to target p38 MAPKs include small molecule inhibitors and antisense oligonucleotides. Small molecule inhibitors based on pyridinyl imidazole are described in U.S. Pat. Nos. 5,670,527; 5,658,903; 5,656,644; 5,559,137; 5,593,992; and 5,593,991. WO 98/27098 and WO 99/00357 describe additional small molecule inhibitors, one of which has entered clinical trials. Other small molecule inhibitors are also known.

[0010] Antisense therapy represents a potentially more specific therapy for targeting p38 MAPKs and, in particular, specific p38 MAPK isoforms. Nagata, Y., et al. (Blood, 1998, 6, 1859-1869) disclose an antisense phosphothioester oligonucleotide targeted to the translational start site of mouse p38b (p38β). Aoshiba, K., et al. (J. Immunol., 1999, 162, 1692-1700) and Cohen, P. S., et al. (Mol. Med., 1997, 3, 339-346) disclose a phosphorothioate antisense oligonucleotide targeted to the coding regions of human p38α, human p38β and rat p38.

[0011] There remains a long-felt need for improved compositions and methods for modulating the expression of p38 MAP kinases.

SUMMARY OF THE INVENTION

[0012] The present invention provides antisense compounds which are targeted to nucleic acids encoding a p38 MAPK and are capable of modulating p38 MAPK expression. The present invention also provides oligonucleotides targeted to nucleic acids encoding a p38 MAPK. The present invention also comprises methods of modulating the expression of a p38 MAPK, in cells and tissues, using the oligonucleotides of the invention. Methods of inhibiting p38 MAPK expression are provided; these methods are believed to be useful both therapeutically and diagnostically. These methods are also useful as tools, for example, for detecting and determining the role of p38 MAPKs in various cell functions and physiological processes and conditions and for diagnosing conditions associated with expression of p38 MAPKs.

[0013] The present invention also comprises methods for diagnosing and treating inflammatory diseases, particularly rheumatoid arthritis and asthma. These methods are believed to be useful, for example, in diagnosing p38 MAPK-associated disease progression. These methods employ the oligonucleotides of the invention. These methods are believed to be useful both therapeutically, including prophylactically, and as clinical research and diagnostic tools.

BRIEF DESCRIPTION OF THE DRAWINGS

[0014]
FIGS. 1A-1B are graphs showing the effect of inhaled p38α MAP kinase antisense oligonucleotide ISIS 101757 (ASO, FIG. 1A) and mismatched control oligonucleotide ISIS 101758 (MM ASO, FIG. 1B) on ovalbumin (OVA)-induced airway hyperresponsiveness in a murine asthma model.

[0015]
FIG. 2 is a graph showing that inhaled ISIS 101757 increases the provocation concentration of methacholine required to achieve doubling of airway reactivity (PC200) in OVA-challenged mice.

[0016]
FIGS. 3A-3B are graphs showing the effect of inhaled ISIS 101757 (FIG. 3A) and 101758 (FIG. 3B) on immune cells in broncheolar lavage (BAL) fluid of OVA-challenged mice. EOS=eosinpophils, NEU=neutrophils, MAC=macrophages, LYM=lymphocyes.

[0017]
FIG. 4 is a graph showing aerosolized ISIS 101757 concentration in mouse lung vs. dose.

[0018]
FIG. 5 is a graph showing dose-dependent inhibition of the penh response to methacholine (50 mg/ml) challenge by ISIS 101757. ISIS 101757 doses are in mg/kg α-axis).

[0019]
FIG. 6 is a graph showing ISIS 101757 concentration (μg/g) in the lungs vs. dose (intratracheal administration).

DETAILED DESCRIPTION OF THE INVENTION

[0020] p38 MAPKs play an important role in signal transduction in response to cytokines, growth factors and other cellular stimuli. Specific responses elicited by p38 include inflammatory and apoptotic responses. Modulation of p38 may be useful in the treatment of inflammatory diseases, such as rheumatoid arthritis.

[0021] The present invention employs antisense compounds, particularly oligonucleotides, for use in modulating the function of nucleic acid molecules encoding a p38 MAPK, ultimately modulating the amount of a p38 MAPK produced. This is accomplished by providing oligonucleotides which specifically hybridize with nucleic acids, preferably mRNA, encoding a p38 MAPK.

[0022] The antisense compounds may be used to modulate the function of a particular p38 MAPK isoform, e.g. for research purposes to determine the role of a particular isoform in a normal or disease process, or to treat a disease or condition that may be associated with a particular isoform. It may also be desirable to target multiple p38 MAPK isoforms. In each case, antisense compounds can be designed by taking advantage of sequence homology between the various isoforms. If an antisense compound to a particular isoform is desired, then the antisense compound is designed to a unique region in the desired isoform's gene sequence. With such a compound, it is desirable that this compound does not inhibit the expression of other isoforms. Less desirable, but acceptable, are compounds that do not “substantially” inhibit other isoforms. By “substantially”, it is intended that these compounds do not inhibit the expression of other isoforms greater than 25%; more preferred are compounds that do not inhibit other isoforms greater than 10%. If an antisense compound is desired to target multiple p38 isoforms, then regions of significant homology between the isoforms can be used.

[0023] This relationship between an antisense compound such as an oligonucleotide and its complementary nucleic acid target, to which it hybridizes, is commonly referred to as “antisense”. “Targeting” an oligonucleotide to a chosen nucleic acid target, in the context of this invention, is a multistep process. The process usually begins with identifying a nucleic acid sequence whose function is to be modulated. This may be, as examples, a cellular gene (or mRNA made from the gene) whose expression is associated with a particular disease state, or a foreign nucleic acid from an infectious agent. In the present invention, the target is a nucleic acid encoding a p38 MAPK; in other words, a p38 MAPK gene or RNA expressed from a p38 MAPK gene. p38 MAPK mRNA is presently the preferred target. The targeting process also includes determination of a site or sites within the nucleic acid sequence for the antisense interaction to occur such that modulation of gene expression will result.

[0024] In accordance with this invention, persons of ordinary skill in the art will understand that messenger RNA includes not only the information to encode a protein using the three letter genetic code, but also associated ribonucleotides which form a region known to such persons as the 5′-untranslated region, the 3′-untranslated region, the 5′ cap region and intron/exon junction ribonucleotides. Thus, oligonucleotides may be formulated in accordance with this invention which are targeted wholly or in part to these associated ribonucleotides as well as to the informational ribonucleotides. The oligonucleotide may therefore be specifically hybridizable with a transcription initiation site region, a translation initiation codon region, a 5′ cap region, an intron/exon junction, coding sequences, a translation termination codon region or sequences in the 5′- or 3′-untranslated region. Since, as is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon.” A minority of genes have a translation initiation codon having the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo. Thus, the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, “start codon” and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding p38, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively). The terms “start codon region” and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. This region is a preferred target region. Similarly, the terms “stop codon region” and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. This region is a preferred target region. The open reading frame (ORF) or “coding region,” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other preferred target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene) and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA or corresponding nucleotides on the gene). mRNA splice sites may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions may also be preferred targets.

[0025] Once the target site or sites have been identified, oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired modulation.

[0026] “Hybridization”, in the context of this invention, means hydrogen bonding, also known as Watson-Crick base pairing, between complementary bases, usually on opposite nucleic acid strands or two regions of a nucleic acid strand. Guanine and cytosine are examples of complementary bases which are known to form three hydrogen bonds between them. Adenine and thymine are examples of complementary bases which form two hydrogen bonds between them.

[0027] “Specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the oligonucleotide.

[0028] It is understood that an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when binding of the oligonucleotide to the target interferes with the normal function of the target molecule to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment and, in the case of in vitro assays, under conditions in which the assays are conducted.

[0029] Hybridization of antisense oligonucleotides with mRNA interferes with one or more of the normal functions of mRNA. The functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA.

[0030] The overall effect of interference with mRNA function is modulation of p38 MAPK expression. In the context of this invention “modulation” means either inhibition or stimulation; i.e., either a decrease or increase in expression. This modulation can be measured in ways which are routine in the art, for example by Northern blot assay of mRNA expression as taught in the examples of the instant application or by Western blot or ELISA assay of protein expression, or by an immunoprecipitation assay of protein expression, as taught in the examples of the instant application. Effects on cell proliferation or tumor cell growth can also be measured, as taught in the examples of the instant application.

[0031] The oligonucleotides of this invention can be used in diagnostics, therapeutics, prophylaxis, and as research reagents and in kits. Since the oligonucleotides of this invention hybridize to nucleic acids encoding a p38 MAPK, sandwich, calorimetric and other assays can easily be constructed to exploit this fact. Furthermore, since the oligonucleotides of this invention hybridize specifically to nucleic acids encoding particular isoforms of p38 MAPK, such assays can be devised for screening of cells and tissues for particular p38 MAPK isoforms. Such assays can be utilized for diagnosis of diseases associated with various p38 MAPK isoforms. Provision of means for detecting hybridization of oligonucleotide with a p38 MAPK gene or mRNA can routinely be accomplished. Such provision may include enzyme conjugation, radiolabelling or any other suitable detection systems. Kits for detecting the presence or absence of p38 MAPK may also be prepared.

[0032] The present invention is also suitable for diagnosing abnormal inflammatory states in tissue or other samples from patients suspected of having an inflammatory disease such as rheumatoid arthritis. The ability of the oligonucleotides of the present invention to inhibit inflammation may be employed to diagnose such states. A number of assays may be formulated employing the present invention, which assays will commonly comprise contacting a tissue sample with an oligonucleotide of the invention under conditions selected to permit detection and, usually, quantitation of such inhibition. In the context of this invention, to “contact” tissues or cells with an oligonucleotide or oligonucleotides means to add the oligonucleotide(s), usually in a liquid carrier, to a cell suspension or tissue sample, either in vitro or ex vivo, or to administer the oligonucleotide(s) to cells or tissues within an animal. Similarly, the present invention can be used to distinguish p38 MAPK-associated diseases, from diseases having other etiologies, in order that an efficacious treatment regime can be designed.

[0033] The oligonucleotides of this invention may also be used for research purposes. Thus, the specific hybridization exhibited by the oligonucleotides may be used for assays, purifications, cellular product preparations and in other methodologies which may be appreciated by persons of ordinary skill in the art.

[0034] In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid or deoxyribonucleic acid. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent intersugar (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced binding to target and increased stability in the presence of nucleases.

[0035] The antisense compounds in accordance with this invention preferably comprise from about 5 to about 50 nucleobases. Particularly preferred are antisense oligonucleotides comprising from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleosides). Preferred embodiments comprise at least an 8-nucleobase portion of a sequence of an antisense compound which inhibits the expression of a p38 mitogen activated kinase. As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2=, 3=or 5=hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3=to 5=phosphodiester linkage.

[0036] While the preferred form of antisense compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dsRNA) molecules, has been shown to induce potent and specific antisense-mediated reduction of the function of a gene or its associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection to viral defense and transposon silencing.

[0037] The first evidence that dsRNA could lead to gene silencing in animals came in 1995 from work in the nematode, Caenorhabditis elegans (Guo and Kempheus, Cell, 1995, 81, 611-620). Montgomery et al. have shown that the primary interference effects of dsRNA are posttranscriptional (Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507). The posttranscriptional antisense mechanism defined in Caenorhabditis elegans resulting from exposure to double-stranded RNA (dsRNA) has since been designated RNA interference (RNAi). This term has been generalized to mean antisense-mediated gene silencing involving the introduction of dsRNA leading to the sequence-specific reduction of endogenous targeted mRNA levels (Fire et al., Nature, 1998, 391, 806-811). Recently, it has been shown that it is, in fact, the single-stranded RNA oligomers of antisense polarity of the dsRNAs which are the potent inducers of RNAi (Tijsterman et al., Science, 2002, 295, 694-697). Single stranded and double stranded RNA (RNAi) inhibition of human p38 MAP kinase is also within the scope of the present invention.

[0038] Oligomer and Monomer Modifications

[0039] As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside linkage or in conjunction with the sugar ring the backbone of the oligonucleotide. The normal internucleoside linkage that makes up the backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage.

[0040] Modified Internucleoside Linkages

[0041] Specific examples of preferred antisense oligomeric compounds useful in this invention include oligonucleotides containing modified e.g. non-naturally occurring internucleoside linkages. As defined in this specification, oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.

[0042] In the C. elegans system, modification of the internucleotide linkage (phosphorothioate) did not significantly interfere with RNAi activity. Based on this observation, it is suggested that certain preferred oligomeric compounds of the invention can also have one or more modified internucleoside linkages. A preferred phosphorus containing modified internucleoside linkage is the phosphorothioate internucleoside linkage.

[0043] Preferred modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphoro-dithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and borano-phosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Preferred oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included.

[0044] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

[0045] In more preferred embodiments of the invention, oligomeric compounds have one or more phosphorothioate and/or heteroatom internucleoside linkages, in particular —CH2—NH—O—CH2—, —CH2—N(CH3)—O—CH2— [known as a methylene (methylimino) or MMI backbone], —CH2—O—N(CH3)—CH2—, —CH2—N(CH3)—N(CH3)—CH2— and —O—N(CH3)—CH2—CH2— [wherein the native phosphodiester internucleotide linkage is represented as —O—P(═O)(OH)—O—CH2—]. The MMI type internucleoside linkages are disclosed in the above referenced U.S. Pat. No. 5,489,677. Preferred amide internucleoside linkages are disclosed in the above referenced U.S. Pat. No. 5,602,240.

[0046] Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

[0047] Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.

[0048] Oligomer Mimetics

[0049] Another preferred group of oligomeric compounds amenable to the present invention includes oligonucleotide mimetics. The term mimetic as it is applied to oligonucleotides is intended to include oligomeric compounds wherein only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with novel groups, replacement of only the furanose ring is also referred to in the art as being a sugar surrogate. The heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA oligomeric compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA oligomeric compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA oligomeric compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

[0050] One oligonucleotide mimetic that has been reported to have excellent hybridization properties is peptide nucleic acids (PNA). The backbone in PNA compounds is two or more linked aminoethylglycine units which gives PNA an amide containing backbone. The heterocyclic base moieties are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

[0051] PNA has been modified to incorporate numerous modifications since the basic PNA structure was first prepared. The basic structure is shown below:

[0052] wherein

[0053] Bx is a heterocyclic base moiety;

[0054] T4 is hydrogen, an amino protecting group, —C(O)R5, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, substituted or unsubstituted C2-C10 alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group, a reporter group, a conjugate group, a D or L α-amino acid linked via the α-carboxyl group or optionally through the ω-carboxyl group when the amino acid is aspartic acid or glutamic acid or a peptide derived from D, L or mixed D and L amino acids linked through a carboxyl group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl;

[0055] T5 is —OH, —N(Z1) Z2, R5, D or L α-amino acid linked via the α-amino group or optionally through the ω-amino group when the amino acid is lysine or ornithine or a peptide derived from D, L or mixed D and L amino acids linked through an amino group, a chemical functional group, a reporter group or a conjugate group;

[0056] Z1 is hydrogen, C1-C6 alkyl, or an amino protecting group;

[0057] Z2 is hydrogen, C1-C6 alkyl, an amino protecting group, —C(═O)n—(CH2)n-J-Z3, a D or L α-amino acid linked via the α-carboxyl group or optionally through the ω-carboxyl group when the amino acid is aspartic acid or glutamic acid or a peptide derived from D, L or mixed D and L amino acids linked through a carboxyl group;

[0058] Z3 is hydrogen, an amino protecting group, —C1-C6 alkyl, —C(═O)—CH3, benzyl, benzoyl, or —(CH2)n—N(H)Z1;

[0059] each J is O, S or NH;

[0060] R5 is a carbonyl protecting group; and

[0061] n is from 2 to about 50.

[0062] Another class of oligonucleotide mimetic that has been studied is based on linked morpholino units (morpholino nucleic acid) having heterocyclic bases attached to the morpholino ring. A number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid. A preferred class of linking groups have been selected to give a non-ionic oligomeric compound. The non-ionic morpholino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins. Morpholino-based oligomeric compounds are non-ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41 (14), 4503-4510). Morpholino-based oligomeric compounds are disclosed in U.S. Pat. No. 5,034,506, issued Jul. 23, 1991. The morpholino class of oligomeric compounds have been prepared having a variety of different linking groups joining the monomeric subunits.

[0063] Morpholino nucleic acids have been prepared having a variety of different linking groups (L2) joining the monomeric subunits. The basic formula is shown below:

[0064] wherein

[0065] T1 is hydroxyl or a protected hydroxyl;

[0066] T5 is hydrogen or a phosphate or phosphate derivative;

[0067] L2 is a linking group; and

[0068] n is from 2 to about 50.

[0069] A further class of oligonucleotide mimetic is referred to as cyclohexenyl nucleic acids (CeNA). The furanose ring normally present in an DNA/RNA molecule is replaced with a cyclohenyl ring. CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry. Fully modified CeNA oligomeric compounds and oligonucleotides having specific positions modified with CeNA have been prepared and studied (see Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602). In general the incorporation of CeNA monomers into a DNA chain increases its stability of a DNA/RNA hybrid. CeNA oligoadenylates formed complexes with RNA and DNA complements with similar stability to the native complexes. The study of incorporating CeNA structures into natural nucleic acid structures was shown by NMR and circular dichrdism to proceed with easy conformational adaptation. Furthermore the incorporation of CeNA into a sequence targeting RNA was stable to serum and able to activate E. Coli RNase resulting in cleavage of the target RNA strand.

[0070] The general formula of CeNA is shown below:

[0071] wherein

[0072] each Bx is a heterocyclic base moiety;

[0073] T1 is hydroxyl or a protected hydroxyl; and

[0074] T2 is hydroxyl or a protected hydroxyl.

[0075] Another class of oligonucleotide mimetic (anhydrohexitol nucleic acid) can be prepared from one or more anhydrohexitol nucleosides (see, Wouters and Herdewijn, Bioorg. Med. Chem. Lett., 1999, 9, 1563-1566) and would have the general formula:

[0076] A further preferred modification includes Locked Nucleic Acids (LNAs) in which the 2′-hydroxyl group is linked to the 4′ carbon atom of the sugar ring thereby forming a 2′-C,4′-C-oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage is preferably a methylene (—CH2—)n group bridging the 2′ oxygen atom and the 4′ carbon atom wherein n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456). LNA and LNA analogs display very high duplex thermal stabilities with complementary DNA and RNA (Tm=+3 to +10 C), stability towards 3′-exonucleolytic degradation and good solubility properties. The basic structure of LNA showing the bicyclic ring system is shown below:

[0077] The conformations of LNAs determined by 2D NMR spectroscopy have shown that the locked orientation of the LNA nucleotides, both in single-stranded LNA and in duplexes, constrains the phosphate backbone in such a way as to introduce a higher population of the N-type conformation (Petersen et al., J. Mol. Recognit., 2000, 13, 44-53). These conformations are associated with improved stacking of the nucleobases (Wengel et al., Nucleosides Nucleotides, 1999, 18, 1365-1370).

[0078] LNA has been shown to form exceedingly stable LNA:LNA duplexes (Koshkin et al., J. Am. Chem. Soc., 1998, 120, 13252-13253). LNA:LNA hybridization was shown to be the most thermally stable nucleic acid type duplex system, and the RNA-mimicking character of LNA was established at the duplex level. Introduction of 3 LNA monomers (T or A) significantly increased melting points (Tm=+15/+11) toward DNA complements. The universality of LNA-mediated hybridization has been stressed by the formation of exceedingly stable LNA:LNA duplexes. The RNA-mimicking of LNA was reflected with regard to the N-type conformational restriction of the monomers and to the secondary structure of the LNA:RNA duplex.

[0079] LNAs also form duplexes with complementary DNA, RNA or LNA with high thermal affinities. Circular dichroism (CD) spectra show that duplexes involving fully modified LNA (esp. LNA:RNA) structurally resemble an A-form RNA:RNA duplex. Nuclear magnetic resonance (NMR) examination of an LNA:DNA duplex confirmed the 3′-endo conformation of an LNA monomer. Recognition of double-stranded DNA has also been demonstrated suggesting strand invasion by LNA. Studies of mismatched sequences show that LNAs obey the Watson-Crick base pairing rules with generally improved selectivity compared to the corresponding unmodified reference strands.

[0080] Novel types of LNA-oligomeric compounds, as well as the LNAs, are useful in a wide range of diagnostic and therapeutic applications. Among these are antisense applications, PCR applications, strand-displacement oligomers, substrates for nucleic acid polymerases and generally as nucleotide based drugs. Potent and nontoxic antisense oligonucleotides containing LNAs have been described (Wahlestedt et al., Proc. Natl. Acad. Sci. U.S. A., 2000, 97, 5633-5638.) The authors have demonstrated that LNAs confer several desired properties to antisense agents. LNA/DNA copolymers were not degraded readily in blood serum and cell extracts. LNA/DNA copolymers exhibited potent antisense activity in assay systems as disparate as G-protein-coupled receptor signaling in living rat brain and detection of reporter genes in Escherichia coli. Lipofectin-mediated efficient delivery of LNA into living human breast cancer cells has also been accomplished.

[0081] The synthesis and preparation of the LNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). LNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.

[0082] The first analogs of LNA, phosphorothioate-LNA and 2′-thio-LNAs, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs containing oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., PCT International Application WO 98-DK393 19980914). Furthermore, synthesis of 2′-amino-LNA, a novel conformationally restricted high-affinity oligonucleotide analog with a handle has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2′-Amino- and 2‘-methylamino-LNA’s have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

[0083] Further oligonucleotide mimetics have been prepared to include bicyclic and tricyclic nucleoside analogs having the formulas (amidite monomers shown):

[0084] (see Steffens et al., Helv. Chim. Acta, 1997, 80, 2426-2439; Steffens et al., J. Am. Chem. Soc., 1999, 121, 3249-3255; and Renneberg et al., J. Am. Chem. Soc., 2002, 124, 5993-6002). These modified nucleoside analogs have been oligomerized using the phosphoramidite approach and the resulting oligomeric compounds containing tricyclic nucleoside analogs have shown increased thermal stabilities (Tm's) when hybridized to DNA, RNA and itself. Oligomeric compounds containing bicyclic nucleoside analogs have shown thermal stabilities approaching that of DNA duplexes.

[0085] Another class of oligonucleotide mimetic is referred to as phosphonomonoester nucleic acids incorporate a phosphorus group in a backbone the backbone. This class of olignucleotide mimetic is reported to have useful physical and biological and pharmacological properties in the areas of inhibiting gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides and triplex-forming oligonucleotides), as probes for the detection of nucleic acids and as auxiliaries for use in molecular biology.

[0086] The general formula (for definitions of Markush variables see: U.S. Pat. Nos. 5,874,553 and 6,127,346 herein incorporated by reference in their entirety) is shown below.

[0087] Another oligonucleotide mimetic has been reported wherein the furanosyl ring has been replaced by a cyclobutyl moiety.

[0088] Modified Sugars

[0089] Oligomeric compounds of the invention may also contain one or more substituted sugar moieties. Preferred oligomeric compounds comprise a sugar substituent group selected from: OH; F; O—, S—, or N-alkyl; O—, S—, or N-alkenyl; O—, S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly preferred are O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other preferred oligonucleotides comprise a sugar substituent group selected from: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A preferred modification includes 2′-methoxyethoxy (2′-C—CH2CH2OCH3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred modification includes 2′-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2′-DMAOE, as described in examples hereinbelow, and 2′-dimethylamino-ethoxyethoxy (also known in the art as 2′-O-dimethyl-amino-ethoxy-ethyl or 2′-DMAEOE), i.e., 2′-O—CH2—O—CH2—N(CH3)2.

[0090] Other preferred sugar substituent groups include methoxy (—O—CH3), aminopropoxy (—OCH2CH2CH2NH2), allyl (—CH2—CH═CH2), —O-allyl (—O—CH2—CH═CH2) and fluoro (F). 2′-Sugar substituent groups may be in the arabino (up) position or ribo (down) position. A preferred 2′-arabino modification is 2′-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3′ position of the sugar on the 3′ terminal nucleoside or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

[0091] Further representative sugar substituent groups include groups of formula Ia or IIa:

[0092] wherein:

[0093] Rb is O, S or NH;

[0094] Rd is a single bond, O, S or C(═O);

[0095] Re is C1-C10 alkyl, N(Rk) (Rm), N(Rk) (Rn), N═C(Rp) (Rq), N═C(Rp) (Rr) or has formula IIIa;

[0096] Rp and Rq are each independently hydrogen or C1-C10 alkyl;

[0097] Rr is —Rx—Ry;

[0098] each Rs, Rt, Ru and Rv is, independently, hydrogen, C(O)Rw, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, substituted or unsubstituted C2-C10 alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group or a conjugate group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl;

[0099] or optionally, Ru and Rv, together form a phthalimido moiety with the nitrogen atom to which they are attached;

[0100] each Rw is, independently, substituted or unsubstituted C1-C10 alkyl, trifluoromethyl, cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy, 2-(trimethylsilyl)-ethoxy, 2,2,2-trichloroethoxy, benzyloxy, butyryl, iso-butyryl, phenyl or aryl;

[0101] Rk is hydrogen, a nitrogen protecting group or —Rx—Ry;

[0102] Rp is hydrogen, a nitrogen protecting group or —Rx—Ry;

[0103] Rx is a bond or a linking moiety;

[0104] Ry is a chemical functional group, a conjugate group or a solid support medium;

[0105] each Rm and Rn is, independently, H, a nitrogen protecting group, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, substituted or unsubstituted C2-C10 alkynyl, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, alkynyl; NH3+, N(Ru) (Rv), guanidino and acyl where said acyl is an acid amide or an ester;

[0106] or Rm and Rn, together, are a nitrogen protecting group, are joined in a ring structure that optionally includes an additional heteroatom selected from N and O or are a chemical functional group;

[0107] Ri is ORz, SRz, or N(Rz)2;

[0108] each Rz is, independently, H, C1-C8 alkyl, C1-C8 haloalkyl, C(═NH)N(H)Ru, C(═O)N(H)Ru or OC(═O)N(H)Ru;

[0109] Rf, Rg and Rh comprise a ring system having from about 4 to about 7 carbon atoms or having from about 3 to about 6 carbon atoms and 1 or 2 heteroatoms wherein said heteroatoms are selected from oxygen, nitrogen and sulfur and wherein said ring system is aliphatic, unsaturated aliphatic, aromatic, or saturated or unsaturated heterocyclic;

[0110] Rj is alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms, N(Rk) (Rm) ORk, halo, SRk or CN;

[0111] ma is 1 to about 10;

[0112] each mb is, independently, 0 or 1;

[0113] mc is 0 or an integer from 1 to 10;

[0114] md is an integer from 1 to 10;

[0115] me is from 0, 1 or 2; and

[0116] provided that when mc is 0, md is greater than 1.

[0117] Representative substituents groups of Formula I are disclosed in United States patent application Ser. No. 09/130,973, filed Aug. 7, 1998, entitled “Capped 2′-Oxyethoxy Oligonucleotides,” hereby incorporated by reference in its entirety.

[0118] Representative cyclic substituent groups of Formula II are disclosed in U.S. patent application Ser. No. 09/123,108, filed Jul. 27, 1998, entitled “RNA Targeted 2′-Oligomeric compounds that are Conformationally Preorganized,” hereby incorporated by reference in its entirety.

[0119] Particularly preferred sugar substituent groups include O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10.

[0120] Representative guanidino substituent groups that are shown in formula III and IV are disclosed in co-owned U.S. patent application Ser. No. 09/349,040, entitled “Functionalized Oligomers”, filed Jul. 7, 1999, hereby incorporated by reference in its entirety.

[0121] Representative acetamido substituent groups are disclosed in U.S. Pat. No. 6,147,200 which is hereby incorporated by reference in its entirety.

[0122] Representative dimethylaminoethyloxyethyl substituent groups are disclosed in International Patent Application PCT/US99/17895, entitled “2′-O-Dimethylaminoethyloxyethyl-Oligomeric compounds”, filed Aug. 6, 1999, hereby incorporated by reference in its entirety.

[0123] Modified Nucleobases/Naturally Occurring Nucleobases

[0124] Oligomeric compounds may also include nucleobase (often referred to in the art simply as “base” or “heterocyclic base moiety”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases also referred herein as heterocyclic base moieties include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C≡C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

[0125] Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.

[0126] In one aspect of the present invention oligomeric compounds are prepared having polycyclic heterocyclic compounds in place of one or more heterocyclic base moieties. A number of tricyclic heterocyclic compounds have been previously reported. These compounds are routinely used in antisense applications to increase the binding properties of the modified strand to a target strand. The most studied modifications are targeted to guanosines hence they have been termed G-clamps or cytidine analogs. Many of these polycyclic heterocyclic compounds have the general formula:

[0127] Representative cytosine analogs that make 3 hydrogen bonds with a guanosine in a second strand include 1,3-diazaphenoxazine-2-one (R10═O, R11—R14═H) [Kurchavov, et al., Nucleosides and Nucleotides, 1997, 16, 1837-1846], 1,3-diazaphenothiazine-2-one (R10═S, R11—R14═H), [Lin, K.-Y.; Jones, R. J.; Matteucci, M. J. Am. Chem. Soc. 1995, 117, 3873-3874] and 6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one (R10═O, R11—R14═F) [Wang, J.; Lin, K.-Y., Matteucci, M. Tetrahedron Lett. 1998, 39, 8385-8388]. Incorporated into oligonucleotides these base modifications were shown to hybridize with complementary guanine and the latter was also shown to hybridize with adenine and to enhance helical thermal stability by extended stacking interactions (also see U.S. Patent Application entitled “Modified Peptide Nucleic Acids” filed May 24, 2002, Ser. No. 10/155,920; and U.S. Patent Application entitled “Nuclease Resistant Chimeric Oligonucleotides” filed May 24, 2002, Ser. No. 10/013,295, both of which are commonly owned with this application and are herein incorporated by reference in their entirety).

[0128] Further helix-stabilizing properties have been observed when a cytosine analog/substitute has an aminoethoxy moiety attached to the rigid 1,3-diazaphenoxazine-2-one scaffold (R10═O, R11═—O—(CH2)2—NH2, R12-14═H) [Lin, K.-Y.; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532]. Binding studies demonstrated that a single incorporation could enhance the binding affinity of a model oligonucleotide to its complementary target DNA or RNA with a ΔTm of up to 18° relative to 5-methyl cytosine (dC5me), which is the highest known affinity enhancement for a single modification, yet. On the other hand, the gain in helical stability does not compromise the specificity of the oligonucleotides. The Tm data indicate an even greater discrimination between the perfect match and mismatched sequences compared to dC5me. It was suggested that the tethered amino group serves as an additional hydrogen bond donor to interact with the Hoogsteen face, namely the O6, of a complementary guanine thereby forming 4 hydrogen bonds. This means that the increased affinity of G-clamp is mediated by the combination of extended base stacking and additional specific hydrogen bonding.

[0129] Further tricyclic heterocyclic compounds and methods of using them that are amenable to the present invention are disclosed in U.S. Pat. Ser. No. 6,028,183, which issued on May 22, 2000, and U.S. Pat. Ser. No. 6,007,992, which issued on Dec. 28, 1999, the contents of both are commonly assigned with this application and are incorporated herein in their entirety.

[0130] The enhanced binding affinity of the phenoxazine derivatives together with their uncompromised sequence specificity makes them valuable nucleobase analogs for the development of more potent antisense-based drugs. In fact, promising data have been derived from in vitro experiments demonstrating that heptanucleotides containing phenoxazine substitutions are capable to activate RNaseH, enhance cellular uptake and exhibit an increased antisense activity [Lin, K-Y; Matteucci, M. J. Am. Chem. Soc. 1998, 120, 8531-8532]. The activity enhancement was even more pronounced in case of G-clamp, as a single substitution was shown to significantly improve the in vitro potency of a 20mer 2′-deoxyphosphorothioate oligonucleotides [Flanagan, W. M.; Wolf, J. J.; Olson, P.; Grant, D.; Lin, K.-Y.; Wagner, R. W.; Matteucci, M. Proc. Natl. Acad. Sci. USA, 1999, 96, 3513-3518]. Nevertheless, to optimize oligonucleotide design and to better understand the impact of these heterocyclic modifications on the biological activity, it is important to evaluate their effect on the nuclease stability of the oligomers.

[0131] Further modified polycyclic heterocyclic compounds useful as heterocyclcic bases are disclosed in but not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,646,269; 5,750,692; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, and U.S. patent application Ser. No. 09/996,292 filed Nov. 28, 2001, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.

[0132] The oligonucleotides of the present invention also include variants in which a different base is present at one or more of the nucleotide positions in the oligonucleotide. For example, if the first nucleotide is an adenosine, variants may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the oligonucleotide. Thus, a 20-mer may comprise 60 variations (20 positions×3 alternates at each position) in which the original nucleotide is substituted with any of the three alternate nucleotides. These oligonucleotides are then tested using the methods described herein to determine their ability to inhibit expression of HCV mRNA and/or HCV replication.

[0133] Conjugates

[0134] A further preferred substitution that can be appended to the oligomeric compounds of the invention involves the linkage of one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting oligomeric compounds. In one embodiment such modified oligomeric compounds are prepared by covalently attaching conjugate groups to functional groups such as hydroxyl or amino groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugates groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve oligomer uptake, distribution, metabolism or excretion. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which is incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-o-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937.

[0135] The oligomeric compounds of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in United States patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.

[0136] Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.

[0137] Chimeric Oligomeric Compounds

[0138] It is not necessary for all positions in an oligomeric compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligomeric compound or even at a single monomeric subunit such as a nucleoside within a oligomeric compound. The present invention also includes oligomeric compounds which are chimeric oligomeric compounds. “Chimeric” oligomeric compounds or “chimeras,” in the context of this invention, are oligomeric compounds that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a nucleic acid based oligomer.

[0139] Chimeric oligomeric compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligomeric compounds when chimeras are used, compared to for example phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0140] Chimeric oligomeric compounds of the invention may be formed as composite structures of two or more oligonucleotides, oligonucleotide analogs, oligonucleosides and/or oligonucleotide mimetics as described above. Such oligomeric compounds have also been referred to in the art as hybrids hemimers, gapmers or inverted gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

[0141] 3′-Endo Modifications

[0142] In one aspect of the present invention oligomeric compounds include nucleosides synthetically modified to induce a 3′-endo sugar conformation. A nucleoside can incorporate synthetic modifications of the heterocyclic base, the sugar moiety or both to induce a desired 3′-endo sugar conformation. These modified nucleosides are used to mimic RNA like nucleosides so that particular properties of an oligomeric compound can be enhanced while maintaining the desirable 3′-endo conformational geometry. There is an apparent preference for an RNA type duplex (A form helix, predominantly 3′-endo) as a requirement (e.g. trigger) of RNA interference which is supported in part by the fact that duplexes composed of 2′-deoxy-2′-F-nucleosides appears efficient in triggering RNAi response in the C. elegans system. Properties that are enhanced by using more stable 3′-endo nucleosides include but aren't limited to modulation of pharmacokinetic properties through modification of protein binding, protein off-rate, absorption and clearance; modulation of nuclease stability as well as chemical stability; modulation of the binding affinity and specificity of the oligomer (affinity and specificity for enzymes as well as for complementary sequences); and increasing efficacy of RNA cleavage. The present invention provides oligomeric triggers of RNAi having one or more nucleosides modified in such a way as to favor a C3′-endo type conformation.

[0143] Nucleoside conformation is influenced by various factors including substitution at the 2′, 3′ or 4′-positions of the pentofuranosyl sugar. Electronegative substituents generally prefer the axial positions, while sterically demanding substituents generally prefer the equatorial positions (Principles of Nucleic Acid Structure, Wolfgang Sanger, 1984, Springer-Verlag.) Modification of the 2′ position to favor the 3′-endo conformation can be achieved while maintaining the 2′-OH as a recognition element, as illustrated in FIG. 2, below (Gallo et al., Tetrahedronl (2001), 57, 5707-5713. Harry- O'kuru et al., J. Org. Chem., (1997), 62(6), 1754-1759 and Tang et al., J. Org. Chem (1999), 64, 747-754.) Alternatively, preference for the 3′-endo conformation can be achieved by deletion of the 2′-OH as exemplified by 2′deoxy-2′ F-nucleosides (Kawasaki et al., J. Med. Chel . (1993), 36, 831-841), which adopts the 3′-endo conformation positioning the electronegative fluorine atom in the axial position. Other modifications of the ribose ring, for example substitution at the 4′-position to give 4′-F modified nucleosides (Guillerm et al., Bioorganic and Medicinal Chemistry Lettersl (1995), 5, 1455-1460 and Owen et al., J. Org. Chem . (1976), 41, 3010-3017), or for example modification to yield methanocarba nucleoside analogs (Jacobson et al., J. Med. Chem. Lett . (2000), 43, 2196-2203 and Lee et al., Bioorganic and Medicinal Chemistry Letters (2001), 11, 1333-1337) also induce preference for the 3′-endo conformation. Along similar lines, oligomeric triggers of RNAi response might be composed of one or more nucleosides modified in such a way that conformation is locked into a C3′-endo type conformation, i.e. Locked Nucleic Acid (LNA, Singh et al, Chem. Commun. (1998), 4, 455-456), and ethylene bridged Nucleic Acids (ENA, Morita et al, Bioorganic & Medicinal Chemistry Letters (2002), 12, 73-76.) Examples of modified nucleosides amenable to the present invention are shown below in Table I. These examples are meant to be representative and not exhaustive.

1TABLE I

[0144] The preferred conformation of modified nucleosides and their oligomers can be estimated by various methods such as molecular dynamics calculations, nuclear magnetic resonance spectroscopy and CD measurements. Hence, modifications predicted to induce RNA like conformations, A-form duplex geometry in an oligomeric context, are selected for use in the modified oligoncleotides of the present invention. The synthesis of numerous modified nucleosides amenable to the present invention are known in the art (see for example, Chemistry of Nucleosides and Nucleotides Vol 1-3, ed. Leroy B. Townsend, 1988, Plenum press., and the examples section below.)

[0145] In one aspect, the present invention is directed to oligonucleotides that are prepared having enhanced properties compared to native RNA against nucleic acid targets. A target is identified and an oligonucleotide is selected having an effective length and sequence that is complementary to a portion of the target sequence. Each nucleoside of the selected sequence is scrutinized for possible enhancing modifications. A preferred modification would be the replacement of one or more RNA nucleosides with nucleosides that have the same 3′-endo conformational geometry. Such modifications can enhance chemical and nuclease stability relative to native RNA while at the same time being much cheaper and easier to synthesize and/or incorporate into an oligonulceotide. The selected sequence can be further divided into regions and the nucleosides of each region evaluated for enhancing modifications that can be the result of a chimeric configuration. Consideration is also given to the 5′ and 3′-termini as there are often advantageous modifications that can be made to one or more of the terminal nucleosides. The oligomeric compounds of the present invention include at least one 5′-modified phosphate group on a single strand or on at least one 5′-position of a double stranded sequence or sequences. Further modifications are also considered such as internucleoside linkages, conjugate groups, substitute sugars or bases, substitution of one or more nucleosides with nucleoside mimetics and any other modification that can enhance the selected sequence for its intended target. The terms used to describe the conformational geometry of homoduplex nucleic acids are “A Form” for RNA and “B Form” for DNA. The respective conformational geometry for RNA and DNA duplexes was determined from X-ray diffraction analysis of nucleic acid fibers (Arnott and Hukins, Biochem. Biophys. Res. Comm., 1970, 47, 1504.) In general, RNA:RNA duplexes are more stable and have higher melting temperatures (Tm's) than DNA:DNA duplexes (Sanger et al., Principles of Nucleic Acid Structure, 1984, Springer-Verlag; New York, N.Y.; Lesnik et al., Biochemistry, 1995, 34, 10807-10815; Conte et al., Nucleic Acids Res., 1997, 25, 2627-2634). The increased stability of RNA has been attributed to several structural features, most notably the improved base stacking interactions that result from an A-form geometry (Searle et al., Nucleic Acids Res., 1993, 21, 2051-2056). The presence of the 2′ hydroxyl in RNA biases the sugar toward a C3′ endo pucker, i.e., also designated as Northern pucker, which causes the duplex to favor the A-form geometry. In addition, the 2′ hydroxyl groups of RNA can form a network of water mediated hydrogen bonds that help stabilize the RNA duplex (Egli et al., Biochemistry, 1996, 35, 8489-8494). On the other hand, deoxy nucleic acids prefer a C2′ endo sugar pucker, i.e., also known as Southern pucker, which is thought to impart a less stable B-form geometry (Sanger, W. (1984) Principles of Nucleic Acid Structure, Springer-Verlag, New York, N.Y.). As used herein, B-form geometry is inclusive of both C2′-endo pucker and O4′-endo pucker. This is consistent with Berger, et. al., Nucleic Acids Research, 1998, 26, 2473-2480, who pointed out that in considering the furanose conformations which give rise to B-form duplexes consideration should also be given to a O4′-endo pucker contribution.

[0146] DNA:RNA hybrid duplexes, however, are usually less stable than pure RNA:RNA duplexes, and depending on their sequence may be either more or less stable than DNA:DNA duplexes (Searle et al., Nucleic Acids Res., 1993, 21, 2051-2056). The structure of a hybrid duplex is intermediate between A- and B-form geometries, which may result in poor stacking interactions (Lane et al., Eur. J. Biochem., 1993, 215, 297-306; Fedoroff et al., J. Mol. Biol., 1993, 233, 509-523; Gonzalez et al., Biochemistry, 1995, 34, 4969-4982; Horton et al., J. Mol. Biol., 1996, 264, 521-533). The stability of the duplex formed between a target RNA and a synthetic sequence is central to therapies such as but not limited to antisense and RNA interference as these mechanisms require the binding of a synthetic oligonucleotide strand to an RNA target strand. In the case of antisense, effective inhibition of the mRNA requires that the antisense DNA have a very high binding affinity with the mRNA. Otherwise the desired interaction between the synthetic oligonucleotide strand and target mRNA strand will occur infrequently, resulting in decreased efficacy.

[0147] One routinely used method of modifying the sugar puckering is the substitution of the sugar at the 2′-position with a substituent group that influences the sugar geometry. The influence on ring conformation is dependant on the nature of the substituent at the 2′-position. A number of different substituents have been studied to determine their sugar puckering effect. For example, 2′-halogens have been studied showing that the 2′-fluoro derivative exhibits the largest population (65%) of the C3′-endo form, and the 2′-iodo exhibits the lowest population (7%). The populations of adenosine (2′-OH) versus deoxyadenosine (2′-H) are 36% and 19%, respectively. Furthermore, the effect of the 2′-fluoro group of adenosine dimers (2′-deoxy-2′-fluoroadenosine-2′-deoxy-2′-fluoro-adenosine) is further correlated to the stabilization of the stacked conformation.

[0148] As expected, the relative duplex stability can be enhanced by replacement of 2′-OH groups with 2′-F groups thereby increasing the C3′-endo population. It is assumed that the highly polar nature of the 2′-F bond and the extreme preference for C3′-endo puckering may stabilize the stacked conformation in an A-form duplex. Data from UV hypochromicity, circular dichroism, and 1H NMR also indicate that the degree of stacking decreases as the electronegativity of the halo substituent decreases. Furthermore, steric bulk at the 2′-position of the sugar moiety is better accommodated in an A-form duplex than a B-form duplex. Thus, a 2′-substituent on the 3′-terminus of a dinucleoside monophosphate is thought to exert a number of effects on the stacking conformation: steric repulsion, furanose puckering preference, electrostatic repulsion, hydrophobic attraction, and hydrogen bonding capabilities. These substituent effects are thought to be determined by the molecular size, electronegativity, and hydrophobicity of the substituent. Melting temperatures of complementary strands is also increased with the 2′-substituted adenosine diphosphates. It is not clear whether the 3′-endo preference of the conformation or the presence of the substituent is responsible for the increased binding. However, greater overlap of adjacent bases (stacking) can be achieved with the 3′-endo conformation.

[0149] One synthetic 2′-modification that imparts increased nuclease resistance and a very high binding affinity to nucleotides is the 2-methoxyethoxy (2′-MOE, 2′-OCH2CH2OCH3) side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). One of the immediate advantages of the 2′-MOE substitution is the improvement in binding affinity, which is greater than many similar 2′ modifications such as O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2′-O-methoxyethyl substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, P., Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926). Relative to DNA, the oligonucleotides having the 2′-MOE modification displayed improved RNA affinity and higher nuclease resistance. Chimeric oligonucleotides having 2′-MOE substituents in the wing nucleosides and an internal region of deoxy-phosphorothioate nucleotides (also termed a gapped oligonucleotide or gapmer) have shown effective reduction in the growth of tumors in animal models at low doses. 2′-MOE substituted oligonucleotides have also shown outstanding promise as antisense agents in several disease states. One such MOE substituted oligonucleotide is presently being investigated in clinical trials for the treatment of CMV retinitis.

[0150] Chemistries Defined

[0151] Unless otherwise defined herein, alkyl means C1-C12, preferably C1-C8, and more preferably C1-C6, straight or (where possible) branched chain aliphatic hydrocarbyl.

[0152] Unless otherwise defined herein, heteroalkyl means C1-C12, preferably C1-C8, and more preferably C1-C6, straight or (where possible) branched chain aliphatic hydrocarbyl containing at least one, and preferably about 1 to about 3, hetero atoms in the chain, including the terminal portion of the chain. Preferred heteroatoms include N, O and S. Unless otherwise defined herein, cycloalkyl means C3-C12, preferably C3-C8, and more preferably C3-C6, aliphatic hydrocarbyl ring.

[0153] Unless otherwise defined herein, alkenyl means C2-C12, preferably C2-C8, and more preferably C2-C6 alkenyl, which may be straight or (where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon double bond.

[0154] Unless otherwise defined herein, alkynyl means C2-C12, preferably C2-C8, and more preferably C2-C6 alkynyl, which may be straight or (where possible) branched hydrocarbyl moiety, which contains at least one carbon-carbon triple bond.

[0155] Unless otherwise defined herein, heterocycloalkyl means a ring moiety containing at least three ring members, at least one of which is carbon, and of which 1, 2 or three ring members are other than carbon. Preferably the number of carbon atoms varies from 1 to about 12, preferably 1 to about 6, and the total number of ring members varies from three to about 15, preferably from about 3 to about 8. Preferred ring heteroatoms are N, O and S. Preferred heterocycloalkyl groups include morpholino, thiomorpholino, piperidinyl, piperazinyl, homopiperidinyl, homopiperazinyl, homomorpholino, homothiomorpholino, pyrrolodinyl, tetrahydrooxazolyl, tetrahydroimidazolyl, tetrahydrothiazolyl, tetrahydroisoxazolyl, tetrahydropyrrazolyl, furanyl, pyranyl, and tetrahydroisothiazolyl.

[0156] Unless otherwise defined herein, aryl means any hydrocarbon ring structure containing at least one aryl ring. Preferred aryl rings have about 6 to about 20 ring carbons. Especially preferred aryl rings include phenyl, napthyl, anthracenyl, and phenanthrenyl.

[0157] Unless otherwise defined herein, hetaryl means a ring moiety containing at least one fully unsaturated ring, the ring consisting of carbon and non-carbon atoms. Preferably the ring system contains about 1 to about 4 rings. Preferably the number of carbon atoms varies from 1 to about 12, preferably 1 to about 6, and the total number of ring members varies from three to about 15, preferably from about 3 to about 8. Preferred ring heteroatoms are N, O and S. Preferred hetaryl moieties include pyrazolyl, thiophenyl, pyridyl, imidazolyl, tetrazolyl, pyridyl, pyrimidinyl, purinyl, quinazolinyl, quinoxalinyl, benzimidazolyl, benzothiophenyl, etc.

[0158] Unless otherwise defined herein, where a moiety is defined as a compound moiety, such as hetarylalkyl (hetaryl and alkyl), aralkyl (aryl and alkyl), etc., each of the sub-moieties is as defined herein.

[0159] Unless otherwise defined herein, an electron withdrawing group is a group, such as the cyano or isocyanato group that draws electronic charge away from the carbon to which it is attached. Other electron withdrawing groups of note include those whose electronegativities exceed that of carbon, for example halogen, nitro, or phenyl substituted in the ortho- or para-position with one or more cyano, isothiocyanato, nitro or halo groups.

[0160] Unless otherwise defined herein, the terms halogen and halo have their ordinary meanings. Preferred halo (halogen) substituents are Cl, Br, and I.

[0161] The aforementioned optional substituents are, unless otherwise herein defined, suitable substituents depending upon desired properties. Included are halogens (Cl, Br, I), alkyl, alkenyl, and alkynyl moieties, NO2, NH3 (substituted and unsubstituted), acid moieties (e.g. —CO2H, —OSO3H2, etc.), heterocycloalkyl moieties, hetaryl moieties, aryl moieties, etc. In all the preceding formulae, the squiggle (˜) indicates a bond to an oxygen or sulfur of the 5′-phosphate.

[0162] Phosphate protecting groups include those described in U.S. Pat. Nos. 5,760,209, U.S. Pat. No. 5,614,621, U.S. Pat. No. 6,051,699, U.S. Pat. No. 6,020,475, U.S. Pat. No. 6,326,478, U.S. Pat. No. 6,169,177, U.S. Pat. No. 6,121,437, U.S. Pat. No. 6,465,628 each of which is expressly incorporated herein by reference in its entirety.

[0163] The oligonucleotides in accordance with this invention (single stranded or double stranded) preferably comprise from about 8 to about 80 nucleotides, more preferably from about 12-50 nucleotides and most preferably from about 15 to 30 nucleotides. As is known in the art, a nucleotide is a base-sugar combination suitably bound to an adjacent nucleotide through a phosphodiester, phosphorothioate or other covalent linkage.

[0164] The oligonucleotides of the present invention also include variants in which a different base is present at one or more of the nucleotide positions in the oligonucleotide. For example, if the first nucleotide is an adenosine, variants may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the oligonucleotide. Thus, a 20-mer may comprise 60 variations (20 positions×3 alternates at each position) in which the original nucleotide is substituted with any of the three alternate nucleotides. These oligonucleotides are then tested using the methods described herein to determine their ability to inhibit expression of p38α MAP kinase mRNA.

[0165] The oligonucleotides used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the talents of the routineer. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and 2′-alkoxy or 2′-alkoxyalkoxy derivatives, including 2′-O-methoxyethyl oligonucleotides [Martin, P., Helv. Chim. Acta, 78, 486 (1995)]. It is also well known to use similar techniques and commercially available modified amidites and controlled-pore glass (CPG) products such as biotin, fluorescein, acridine or psoralen-modified amidites and/or CPG (available from Glen Research, Sterling Va.) to synthesize fluorescently labeled, biotinylated or other conjugated oligonucleotides.

[0166] The antisense compounds of the present invention include bioequivalent compounds, including pharmaceutically acceptable salts and prodrugs. This is intended to encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of the nucleic acids of the invention and prodrugs of such nucleic acids.

[0167] Pharmaceutically acceptable “salts” are physiologically and pharmaceutically acceptable salts of the nucleic acids of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto [see, for example, Berge et al., “Pharmaceutical Salts,” J. of Pharma Sci., 66:1 (1977)].

[0168] For oligonucleotides, examples of pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (d) salts formed from elemental anions such as chlorine, bromine, and iodine.

[0169] The oligonucleotides of the invention may additionally or alternatively be prepared to be delivered in a “prodrug” form. The term “prodrug” indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE [(S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al., published Dec. 9, 1993.

[0170] For therapeutic or prophylactic treatment, oligonucleotides are administered in accordance with this invention. Oligonucleotide compounds of the invention may be formulated in a pharmaceutical composition, which may include pharmaceutically acceptable carriers, thickeners, diluents, buffers, preservatives, surface active agents, neutral or cationic lipids, lipid complexes, liposomes, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients and the like in addition to the oligonucleotide. Such compositions and formulations are comprehended by the present invention.

[0171] Pharmaceutical compositions comprising the oligonucleotides of the present invention may include penetration enhancers in order to enhance the alimentary delivery of the oligonucleotides. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., fatty acids, bile salts, chelating agents, surfactants and non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, 8:91-192; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7:1). One or more penetration enhancers from one or more of these broad categories may be included.

[0172] The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional compatible pharmaceutically-active materials such as, e.g., antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the composition of present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the invention.

[0173] Regardless of the method by which the oligonucleotides of the invention are introduced into a patient, colloidal dispersion systems may be used as delivery vehicles to enhance the in vivo stability of the oligonucleotides and/or to target the oligonucleotides to a particular organ, tissue or cell type. Colloidal dispersion systems include, but are not limited to, macromolecule complexes, nanocapsules, microspheres, beads and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, liposomes and lipid:oligonucleotide complexes of uncharacterized structure. A preferred colloidal dispersion system is a plurality of liposomes. Liposomes are microscopic spheres having an aqueous core surrounded by one or more outer layers made up of lipids arranged in a bilayer configuration [see, generally, Chonn et al., Current Op. Biotech., 6, 698 (1995)].

[0174] The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer, metered dose inhaler or dry powder inhaler; intratracheal, intranasal, or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration.

[0175] Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.

[0176] Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.

[0177] Compositions for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. In some cases it may be more effective to treat a patient with an oligonucleotide of the invention in conjunction with other traditional therapeutic modalities in order to increase the efficacy of a treatment regimen. In the context of the invention, the term “treatment regimen” is meant to encompass therapeutic, palliative and prophylactic modalities. For example, a patient may be treated with conventional chemotherapeutic agents, particularly those used for tumor and cancer treatment. Examples of such chemotherapeutic agents include but are not limited to daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine,taxol, vincristine, vinblastine, etoposide, trimetrexate, teniposide, cisplatin and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., pp. 1206-1228, Berkow et al., eds., Rahay, N.J., 1987). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide).

[0178] The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every 20 years.

[0179] Thus, in the context of this invention, by “therapeutically effective amount” is meant the amount of the compound which is required to have a therapeutic effect on the treated mammal. This amount, which will be apparent to the skilled artisan, will depend upon the type of mammal, the age and weight of the mammal, the type of disease to be treated, perhaps even the gender of the mammal, and other factors which are routinely taken into consideration when treating a mammal with a disease. A therapeutic effect is assessed in the mammal by measuring the effect of the compound on the disease state in the animal. For example, if the disease to be treated is cancer, therapeutic effects are assessed by measuring the rate of growth or the size of the tumor, or by measuring the production of compounds such as cytokines, production of which is an indication of the progress or regression of the tumor.

[0180] The following examples illustrate the present invention and are not intended to limit the same.

EXAMPLES

[0181] Eample 1

Synthesis of Oligonucleotides

[0182] Unmodified oligodeoxynucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine. β-cyanoethyldiisopropyl-phosphoramidites were purchased from Applied Biosystems (Foster City, Calif.). For phosphorothioate oligonucleotides, the standard oxidation bottle was replaced by a 0.2 M solution of 3H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the stepwise thiation of the phosphite linkages. The thiation cycle wait step was increased to 68 seconds and was followed by the capping step.

[0183] 2′-methoxy oligonucleotides are synthesized using 2′-methoxy β-cyanoethyldiisopropyl-phosphoramidites (Chemgenes, Needham, Mass.) and the standard cycle for unmodified oligonucleotides, except the wait step after pulse delivery of tetrazole and base was increased to 360 seconds. Other 2′-alkoxy oligonucleotides were synthesized by a modification of this method, using appropriate 2′-modified amidites such as those available from Glen Research, Inc., Sterling, Va.

[0184] 2′-fluoro oligonucleotides are synthesized as described in Kawasaki et al., J. Med. Chem., 36, 831 (1993). Briefly, the protected nucleoside N6-benzoyl-2′-deoxy-2′-fluoroadenosine is synthesized utilizing commercially available 9-β-D-arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2′-α-fluoro atom is introduced by a SN2-displacement of a 2′-β-O-trifyl group. Thus N6-benzoyl-9-β-D-arabinofuranosyladenine is selectively protected in moderate yield as the 3′,5′-ditetrahydropyranyl (THP) intermediate. Deprotection of the THP and N6-benzoyl groups is accomplished using standard methodologies and standard methods are used to obtain the 5′-dimethoxytrityl-(DMT) and 5′-DMT-3′-phosphoramidite intermediates.

[0185] The synthesis of 2′-deoxy-2′-fluoroguanosine is accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-β-D-arabinofuranosylguanine as starting material, and conversion to the intermediate diisobutyryl-arabinofuranosylguanosine. Deprotection of the TPDS group is followed by protection of the hydroxyl group with THP to give diisobutyryl di-THP protected arabinofuranosylguanine. Selective O-deacylation and triflation is followed by treatment of the crude product with fluoride, then deprotection of the THP groups. Standard methodologies are used to obtain the 5′-DMT- and 5′-DMT-3′-phosphoramidites.

[0186] Synthesis of 2′-deoxy-2′-fluorouridine is accomplished by the modification of a known procedure in which 2,2′-anhydro-1-B-D-arabinofuranosyluracil is treated with 70% hydrogen fluoride-pyridine. Standard procedures are used to obtain the 5′-DMT and 5′-DMT-3′phosphoramidites.

[0187] 2′-deoxy-2′-fluorocytidine is synthesized via amination of 2′-deoxy-2′-fluorouridine, followed by selective protection to give N4-benzoyl-2′-deoxy-2′-fluorocytidine. Standard procedures are used to obtain the 5′-DMT and 5′-DMT-3′phosphoramidites.

[0188] 2′-(2-methoxyethyl)-modified amidites were synthesized according to Martin, P., Helv. Chim. Acta, 78,486 (1995). For ease of synthesis, the last nucleotide was a deoxynucleotide. 2′-O—CH2CH2OCH3-cytosines may be 5-methyl cytosines. Synthesis of 5-Methyl Cytosine Monomers:

[0189] 2,2′-Anhydro[1-(β-D-arabinofuranosyl)-5-methyluridine]:

[0190] 5-Methyluridine (ribosylthymine, commercially available through Yamasa, Choshi, Japan) (72.0 g, 0.279 M), diphenyl-carbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were added to DMF (300 mL). The mixture was heated to reflux, with stirring, allowing the evolved carbon dioxide gas to be released in a controlled manner. After 1 hour, the slightly darkened solution was concentrated under reduced pressure. The resulting syrup was poured into diethylether (2.5 L), with stirring. The product formed a gum. The ether was decanted and the residue was dissolved in a minimum amount of methanol (ca. 400 mL). The solution was poured into fresh ether (2.5 L) to yield a stiff gum. The ether was decanted and the gum was dried in a vacuum oven (60° C. at 1 mm Hg for 24 hours) to give a solid which was crushed to a light tan powder (57 g, 85% crude yield). The material was used as is for further reactions.

[0191] 2′-O-Methoxyethyl-5-methyluridine:

[0192] 2,2′-Anhydro-5-methyluridine (195 g, 0.81 M), tris(2-methoxyethyl)borate (231 g, 0.98 M) and 2-methoxyethanol (1.2 L) were added to a 2 L stainless steel pressure vessel and placed in a pre-heated oil bath at 160° C. After heating for 48 hours at 155-160° C., the vessel was opened and the solution evaporated to dryness and triturated with MeOH (200 mL). The residue was suspended in hot acetone (1 L). The insoluble salts were filtered, washed with acetone (150 mL) and the filtrate evaporated. The residue (280 g) was dissolved in CH3CN (600 mL) and evaporated. A silica gel column (3 kg) was packed in CH2Cl2/acetone/MeOH (20:5:3) containing 0.5% Et3NH. The residue was dissolved in CH2Cl2 (250 mL) and adsorbed onto silica (150 g) prior to loading onto the column. The product was eluted with the packing solvent to give 160 g (63%) of product.

[0193] 2′-O-Methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine:

[0194] 2′-O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was co-evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L). A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the reaction stirred for an additional one hour. Methanol (170 mL) was then added to stop the reaction. HPLC showed the presence of approximately 70% product. The solvent was evaporated and triturated with CH3CN (200 mL). The residue was dissolved in CHCl3 (1.5 L) and extracted with 2×500 mL of saturated NaHCO3 and 2×500 mL of saturated NaCl. The organic phase was dried over Na2SO4, filtered and evaporated. 275 g of residue was obtained. The residue was purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/Hexane/Acetone (5:5:1) containing 0.5% Et3NH. The pure fractions were evaporated to give 164 g of product. Approximately 20 g additional was obtained from the impure fractions to give a total yield of 183 g (57%).

[0195] 3′-O-Acetyl-2′-O-methoxyethyl-51-O-dimethoxytrityl-5-methyluridine:

[0196] 2′-O-Methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine (106 g, 0.167 M), DMF/pyridine (750 mL of a 3:1 mixture prepared from 562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38 mL, 0.258 M) were combined and stirred at room temperature for 24 hours. The reaction was monitored by tic by first quenching the tic sample with the addition of MeOH. Upon completion of the reaction, as judged by tic, MeOH (50 mL) was added and the mixture evaporated at 35° C. The residue was dissolved in CHCl3 (800 mL) and extracted with 2×200 mL of saturated sodium bicarbonate and 2×200 mL of saturated NaCl. The water layers were back extracted with 200 mL of CHCl3. The combined organics were dried with sodium sulfate and evaporated to give 122 g of residue (approx. 90% product). The residue was purified on a 3.5 kg silica gel column and eluted using EtOAc/Hexane(4:1). Pure product fractions were evaporated to yield 96 g (84%).

[0197] 3′-O-Acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyl-4-triazoleuridine:

[0198] A first solution was prepared by dissolving 3′-O-acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH3CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH3CN (1 L), cooled to −5° C. and stirred for 0.5 h using an overhead stirrer. POCl3 was added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10EC, and the resulting mixture stirred for an additional 2 hours. The first solution was added dropwise, over a 45 minute period, to the later solution. The resulting reaction mixture was stored overnight in a cold room. Salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 L) and the insoluble solids were removed by filtration. The filtrate was washed with 1×300 mL of NaHCO3 and 2×300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound.

[0199] 2′-O-Methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine:

[0200] A solution of 3′-O-acetyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and NH4OH (30 mL) was stirred at room temperature for 2 hours. The dioxane solution was evaporated and the residue azeotroped with MeOH (2×200 mL). The residue was dissolved in MeOH (300 mL) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated with NH3 gas was added and the vessel heated to 100° C. for 2 hours (tlc showed complete conversion). The vessel contents were evaporated to dryness and the residue was dissolved in EtOAc (500 mL) and washed once with saturated NaCl (200 mL). The organics were dried over sodium sulfate and the solvent was evaporated to give 85 g (95%) of the title compound.

[0201] N4-Benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine:

[0202] 2′-O-Methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine (85 g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) was added with stirring. After stirring for 3 hours, tlc showed the reaction to be approximately 95% complete. The solvent was evaporated and the residue azeotroped with MeOH (200 mL). The residue was dissolved in CHCl3 (700 mL) and extracted with saturated NaHCO3 (2×300 mL) and saturated NaCl (2×300 mL), dried over MgSO4 and evaporated to give a residue (96 g). The residue was chromatographed on a 1.5 kg silica column using EtOAc/-Hexane (1:1) containing 0.5% Et3NH as the eluting solvent. The pure product fractions were evaporated to give 90 g (90%) of the title compound.

[0203] N4-Benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine-3′-amidite:

[0204] N4-Benzoyl-2′-O-methoxyethyl-5′-O-dimethoxytrityl-5-methylcytidine (74 g, 0.10 M) was dissolved in CH2Cl2 (1 L) Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra-(isopropyl)phosphite (40.5 mL, 0.123 M) were added with stirring, under a nitrogen atmosphere. The resulting mixture was stirred for 20 hours at room temperature (tlc showed the reaction to be 95% complete). The reaction mixture was extracted with saturated NaHCO3 (1×300 mL) and saturated NaCl (3×300 mL). The aqueous washes were back-extracted with CH2Cl2 (300 mL), and the extracts were combined, dried over MgSO4 and concentrated. The residue obtained was chromatographed on a 1.5 kg silica column using EtOAc\Hexane (3:1) as the eluting solvent. The pure fractions were combined to give 90.6 g (87%) of the title compound.

[0205] 5-methyl-2′-deoxycytidine (5-me-C) containing oligonucleotides were synthesized according to published methods [Sanghvi et al., Nucl. Acids Res., 21, 3197 (1993)] using commercially available phosphoramidites (Glen Research, Sterling Va. or ChemGenes, Needham Mass.).

[0206] 2=-O-(dimethylaminooxyethyl) Nucleoside Amidites

[0207] 2′-(Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2′-O-(dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5-methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine.

[0208] 5′-O-tert-Butyldiphenylsilyl-O2-2′-anhydro-5-methyluridine

[0209] O2-2′-anhydro-5-methyluridine (Pro. Bio. Sint., Varese, Italy, 100.0 g, 0.416 mmol), dimethylaminopyridine (0.66 g, 0.013eq, 0.0054 mmol) are dissolved in dry pyridine (500 ml) at ambient temperature under an argon atmosphere and with mechanical stirring. tert-Butyldiphenylchlorosilane (125.8 g, 119.0 mL, 1.1eq, 0.458 mmol) is added in one portion. The reaction is stirred for 16 h at ambient temperature. TLC (Rf 0.22, ethyl acetate) indicates a complete reaction. The solution is concentrated under reduced pressure to a thick oil. This is partitioned between dichloromethane (1 L) and saturated sodium bicarbonate (2×1 L) and brine (1 L). The organic layer is dried over sodium sulfate and concentrated under reduced pressure to a thick oil. The oil is dissolved in a 1:1 mixture of ethyl acetate and ethyl ether (600 mL) and the solution is cooled to −10° C. The resulting crystalline product is collected by filtration, washed with ethyl ether (3×200 mL) and dried (40° C., 1 mm Hg, 24 h) to 149 g (74.8%) of white solid. TLC and NMR are used to check consistency with pure product.

[0210] 5′-O-tert-Butyldiphenylsilyl-2′-O-(2-hydroxyethyl)-5-methyluridine

[0211] In a 2 L stainless steel, unstirred pressure reactor is added borane in tetrahydrofuran (1.0 M, 2.0 eq, 622 mL). In the fume hood and with manual stirring, ethylene glycol (350 mL, excess) is added cautiously at first until the evolution of hydrogen gas subsided. 5′-O-tert-Butyldiphenylsilyl-O2-2′-anhydro-5-methyluridine (149 g, 0.311 mol) and sodium bicarbonate (0.074 g, 0.003 eq) are added with manual stirring. The reactor is sealed and heated in an oil bath until an internal temperature of 160° C. is reached and then maintained for 16 h (pressure<100 psig). The reaction vessel is cooled to ambient and opened. TLC (Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate) indicates % conversion to the product. In order to avoid additional side product formation, the reaction is stopped, concentrated under reduced pressure (10 to 1 mm Hg) in a warm water bath (40-100° C.) with the more extreme conditions used to remove the ethylene glycol. [Alternatively, once the low boiling solvent is gone, the remaining solution can be partitioned between ethyl acetate and water. The product will be in the organic phase.] The residue is purified by column chromatography (2 kg silica gel, ethyl acetate-hexanes gradient 1:1 to 4:1). The appropriate fractions are combined, stripped and dried to product as a white crisp foam (84 g, 50%), contaminated starting material (17.4 g) and pure reusable starting material 20 g. TLC and NMR are used to determine consistency with pure product.

[0212] 2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine

[0213] 5′-O-tert-Butyldiphenylsilyl-2′-O-(2-hydroxyethyl)-5-methyluridine (20 g, 36.98 mmol) was mixed with triphenylphosphine (11.63 g, 44.36 mmol) and N-hydroxyphthalimide (7.24 g, 44.36 mmol). It was then dried over P2O5 under high vacuum for two days at 40° C. The reaction mixture was flushed with argon and dry THF (369.8 mL, Aldrich, sure seal bottle) was added to get a clear solution. Diethyl-azodicarboxylate (6.98 mL, 44.36 mmol) was added dropwise to the reaction mixture. The rate of addition is maintained such that resulting deep red coloration is just discharged before adding the next drop. After the addition was complete, the reaction was stirred for 4 hrs. By that time TLC showed the completion of the reaction (ethylacetate:hexane, 60:40). The solvent was evaporated in vacuum. Residue obtained was placed on a flash column and eluted with ethyl acetate:hexane (60:40), to get 2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine as white foam (21.819, 86%).

[0214] 5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine

[0215] 2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine (3.1 g, 4.5 mmol) is dissolved in dry CH2Cl2 (4.5 mL) and methylhydrazine (300 mL, 4.64 mmol) is added dropwise at −10° C. to 0° C. After 1 hr the mixture is filtered, the filtrate is washed with ice cold CH2Cl2 and the combined organic phase is washed with water, brine and dried over anhydrous Na2SO4. The solution is concentrated to get 2′-O-(aminooxyethyl) thymidine, which is then dissolved in MeOH (67.5 mL). To this formaldehyde (20% aqueous solution, w/w, 1.1eg.) is added and the mixture for 1 hr. Solvent is removed under vacuum; residue chromatographed to get 5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine as white foam.

[0216] 5′-O-tert-Butyldiphenylsilyl-2′-O-[N,N-dimethylaminooxyethyl]-5-methyluridine

[0217] 5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine (1.77 g, 3.12 mmol) is dissolved in a solution of 1M pyridinium p-toluenesulfonate (PPTS) in dry MeOH (30.6 mL). Sodium cyanoborohydride (0.39 g, 6.13 mmol) is added to this solution at 10° C. under inert atmosphere. The reaction mixture is stirred for 10 minutes at 10° C. After that the reaction vessel is removed from the ice bath and stirred at room temperature for 2 hr, the reaction monitored by TLC (5% MeOH in CH2Cl2). Aqueous NaHCO3 solution (5%, 10 mL) is added and extracted with ethyl acetate (2×20 mL). Ethyl acetate phase is dried over anhydrous Na2SO4, evaporated to dryness. Residue is dissolved in a solution of 1M PPTS in MeOH (30.6 mL). Formaldehyde (20% w/w, 30 mL, 3.37 mmol) is added and the reaction mixture is stirred at room temperature for 10 minutes. Reaction mixture cooled to 10° C. in an ice bath, sodium cyanoborohydride (0.39 g, 6.13 mmol) is added and reaction mixture stirred at 10° C. for 10 minutes. After 10 minutes, the reaction mixture is removed from the ice bath and stirred at room temperature for 2 hrs. To the reaction mixture 5% NaHCO3 (25 mL) solution is added and extracted with ethyl acetate (2×25 mL). Ethyl acetate layer is dried over anhydrous Na2SO4 and evaporated to dryness. The residue obtained is purified by flash column chromatography and eluted with 5% MeOH in CH2Cl2 to get 5′-O-tert-butyldiphenylsilyl-2′-O-[N,N-dimethylaminooxyethyl]-5-methyluridine as a white foam (14.6 g).

[0218] 2′-O-(dimethylaminooxyethyl)-5-methyluridine

[0219] Triethylamine trihydrofluoride (3.91 mL, 24.0 mmol) is dissolved in dry THF and triethylamine (1.67 mL, 12 mmol, dry, kept over KOH). This mixture of triethylamine-2HF is then added to 5′-O-tert-butyldiphenylsilyl-2′-O-[N,N-dimethylaminooxyethyl]-5-methyluridine (1.40 g, 2.4 mmol) and stirred at room temperature for 24 hrs. Reaction is monitored by TLC (5% MeOH in CH2Cl2). Solvent is removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH2Cl2 to get 2′-O-(dimethylaminooxyethyl)-5-methyluridine (766 mg).

[0220] 5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine

[0221] 2′-O-(dimethylaminooxyethyl)-5-methyluridine (750 mg, 2.17 mmol) is dried over P2O5 under high vacuum overnight at 40° C. It is then co-evaporated with anhydrous pyridine (20 mL). The residue obtained is dissolved in pyridine (11 mL) under argon atmosphere. 4-dimethylaminopyridine (26.5 mg, 2.60 mmol), 4,4′-dimethoxytrityl chloride (880 mg, 2.60 mmol) is added to the mixture and the reaction mixture is stirred at room temperature until all of the starting material disappeared. Pyridine is removed under vacuum and the residue chromatographed and eluted with 10% MeOH in CH2Cl2 (containing a few drops of pyridine) to get 5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine (1.13 g).

[0222] 5′-O-DMT-2′-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite]

[0223] 5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine (1.08 g, 1.67 mmol) is co-evaporated with toluene (20 mL). To the residue N,N-diisopropylamine tetrazonide (0.29 g, 1.67 mmol) is added and dried over P2O5 under high vacuum overnight at 40° C. Then the reaction mixture is dissolved in anhydrous acetonitrile (8.4 mL) and 2-cyanoethyl-N,N,N1,N1′-tetraisopropylphosphoramidite (2.12 mL, 6.08 mmol) is added. The reaction mixture is stirred at ambient temperature for 4 hrs under inert atmosphere. The progress of the reaction was monitored by TLC (hexane:ethyl acetate 1:1). The solvent is evaporated, then the residue is dissolved in ethyl acetate (70 mL) and washed with 5% aqueous NaHCO3 (40 mL). Ethyl acetate layer is dried over anhydrous Na2SO4 and concentrated. Residue obtained is chromatographed (ethyl acetate as eluent) to get 5′-O-DMT-2′-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite] as a foam (1.04 g).

[0224] 2′-(Aminooxyethoxy) Nucleoside Amidites

[0225] 2′-(Aminooxyethoxy) nucleoside amidites [also known in the art as 2′-O-(aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs. Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly.

[0226] N2-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite]

[0227] The 2′-O-aminooxyethyl guanosine analog may be obtained by selective 2′-O-alkylation of diaminopurine riboside. Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2′-O-(2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3′-O-isomer. 2′-O-(2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2′-O-(2-ethylacetyl)guanosine by treatment with adenosine deaminase. (McGee, D. P. C., Cook, P. D., Guinosso, C. J., WO 94/02501 A1 940203.) Standard protection procedures should afford 2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine and 2-N-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine which may be reduced to provide 2-N-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine. As before the hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite].

[0228] Oligonucleotides having methylene (methylimino) (MMI) backbones are synthesized according to U.S. Pat. No. 5,378,825, which is coassigned to the assignee of the present invention and is incorporated herein in its entirety. For ease of synthesis, various nucleoside dimers containing MMI linkages were synthesized and incorporated into oligonucleotides. Other nitrogen-containing backbones are synthesized according to WO 92/20823 which is also coassigned to the assignee of the present invention and incorporated herein in its entirety.

[0229] Oligonucleotides having amide backbones are synthesized according to De Mesmaeker et al., Acc. Chem. Res., 28, 366 (1995). The amide moiety is readily accessible by simple and well-known synthetic methods and is compatible with the conditions required for solid phase synthesis of oligonucleotides.

[0230] Oligonucleotides with morpholino backbones are synthesized according to U.S. Pat. No. 5,034,506 (Summerton and Weller).

[0231] Peptide-nucleic acid (PNA) oligomers are synthesized according to P. E. Nielsen et al., Science, 254, 1497 (1991).

[0232] After cleavage from the controlled pore glass column (Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55° C. for 18 hours, the oligonucleotides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol. Synthesized oligonucleotides were analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis were periodically checked by 31P nuclear magnetic resonance spectroscopy, and for some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem., 266, 18162 (1991). Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.

Example 2

Human p38α Oligonucleotide Sequences

[0233] Antisense oligonucleotides were designed to target human p38α. Target sequence data are from the p38 MAPK cDNA sequence; Genbank accession number L35253, provided herein as SEQ ID NO: 1. Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of eight 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by six-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All 2′-MOE cytosines were 5-methylcytosines. These oligonucleotide sequences are shown in Table 1.

[0234] The human Jurkat T-cell line (American Type Culture Collection, Manassas, Va.) was maintained in RPMI 1640 growth media supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, Utah). HUVEC cells (Clonetics, San Diego, Calif.) were cultivated in endothelial basal media supplemented with 10% FBS (Hyclone, Logan, Utah).

[0235] Jurkat cells were grown to approximately 75% confluency and resuspended in culture media at a density of 1×107 cells/ml. A total of 3.6×106 cells were employed for each treatment by combining 360 μl of cell suspension with oligonucleotide at the indicated concentrations to reach a final volume of 400 μl. Cells were then transferred to an electroporation cuvette and electroporated using an Electrocell Manipulator 600 instrument (Biotechnologies and Experimental Research, Inc.) employing 150 V, 1000 μF, at 13 Ω. Electroporated cells were then transferred to conical tubes containing 5 ml of culture media, mixed by inversion, and plated onto 10 cm culture dishes.

[0236] HUVEC cells were allowed to reach 75% confluency prior to use. The cells were washed twice with warm (37° C.) OPTI-MEM™ (Life Technologies). The cells were incubated in the presence of the appropriate culture medium, without the growth factors added, and the oligonucleotide formulated in LIPOFECTIN7 (Life Technologies), a 1:1 (w/w) liposome formulation of the cationic lipid N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA), and dioleoyl phosphotidylethanolamine (DOPE) in membrane filtered water. HUVEC cells were treated with 100 nM oligonucleotide in 10 μg/ml LIPOFECTIN7. Treatment was for four hours.

[0237] Total mRNA was isolated using the RNEASY7 Mini Kit (Qiagen, Valencia, Calif.; similar kits from other manufacturers may also be used), separated on a 1% agarose gel, transferred to HYBOND™-N+ membrane (Amersham Pharmacia Biotech, Piscataway, N.J.), a positively charged nylon membrane, and probed. p38 MAPK probes were made using the Prime-A-Gene7 kit (Promega Corporation, Madison, Wis.), a random primer labeling kit, using mouse p38α or p38β cDNA as a template. A glyceraldehyde 3-phosphate dehydrogenase (G3PDH) probe was purchased from Clontech (Palo Alto, Calif.), Catalog Number 9805-1. The fragments were purified from low-melting temperature agarose, as described in Maniatis, T., et al., Molecular Cloning: A Laboratory Manual, 1989. The G3PDH probe was labeled with REDIVUE™ 32P-dCTP (Amersham Pharmacia Biotech, Piscataway, N.J.) and Strip-EZ labelling kit (Ambion, Austin, Tex.). mRNA was quantitated by a PhosphoImager (Molecular Dynamics, Sunnyvale, Calif.).

2TABLE 1Nucleotide Sequences of Human p38α Chimeric(deoxy gapped) PhosphorothioateOligonucleotidesSEQTARGET GENEGENEISISNUCLEOTIDE SEQUENCE1IDNUCLEOTIDETARGETNO.(5′ → 3′)NO:CO-ORDINATES2REGION16486AAGACCGGGCCCGGAATTCC30001-00205′-UTR16487GTGGAGGCCAGTCCCCGGGA40044-00635′-UTR16488TGGCAGCAAAGTGCTGCTGG50087-01065′-UTR16489CAGAGAGCCTCCTGGGAGGG60136-01555′-UTR16490TGTGCCGAATCTCGGCCTCT70160-01795′-UTR16491GGTCTCGGGCGACCTCTCCT80201-02205′-UTR16492CAGCCGCGGGACCAGCGGCG90250-02695′-UTR16493CATTTTCCAGCGGCAGCCGC100278-0297AUG16494TCCTGAGACATTTTCCAGCG110286-0305AUG16495CTGCCGGTAGAACGTGGGCC120308-0327coding16496GTAAGCTTCTGACATTTCAC130643-0662coding16497TTTAGGTCCCTGTGAATTAT140798-0817coding16498ATGTTCTTCCAGTCAACAGC150939-0958coding16499TAAGGAGGTCCCTGCTTTCA161189-1208coding16500AACCAGGTGCTCAGGACTCC171368-1387stop16501GAAGTGGGATCAACAGAACA181390-14093′-UTR16502TGAAAAGGCCTTCCCCTCAC191413-14323′-UTR16503AGGCACTTGAATAATATTTG201444-14633′-UTR16504CTTCCACCATGGAGGAAATC211475-14943′-UTR16505ACACATGCACACACACTAAC221520-15393′-UTR1Emboldened residues, 2′-methoxyethoxy- residues (others are 2′-deoxy-) including “C” residues, 5-methyl-cytosines; all linkages are phosphorothioate linkages. 2Co-ordinates from Genbank Accession No. L35253, locus name “HUMMAPKNS”, SEQ ID NO. 1.

[0238] For an initial screen of human p38α antisense oligonucleotides, Jurkat cells were electroporated with 10 μM oligonucleotide. mRNA was measured by Northern blot. Results are shown in Table 2. Oligonucleotides 16496 (SEQ ID NO. 13), 16500 (SEQ ID NO. 17) and 16503 (SEQ ID NO. 20) gave 35% or greater inhibition of p38α mRNA.

3TABLE 2Inhibition of Human p38α mRNA expression in Jurkat Cells byChimeric (deoxy gapped) Phosphorothioate OligonucleotidesSEQGENEISISIDTARGET% mRNA% mRNANo:NO:REGIONEXPRESSIONINHIBITIONcontrol——100% 0%16486 35′-UTR212%—16487 45′-UTR171%—16488 55′-UTR157%—16489 65′-UTR149%—16490 75′-UTR152%—16491 85′-UTR148%—16492 95′-UTR125%—1649310AUG101%—1649411AUG 72%28%1649512coding 72%28%1649613coding 61%39%1649714coding104%—1649815coding 88%12%1649916coding 74%26%1650017stop 63%37%16501183′-UTR 77%23%16502193′-UTR 79%21%16503203′-UTR 65%35%16504213′-UTR 72%28%16505223′-UTR 93% 7%

[0239] The most active human p38α oligonucleotides were chosen for dose response studies. Oligonucleotide 16490 (SEQ ID NO. 7) which showed no inhibition in the initial screen was included as a negative control. Jurkat cells were grown and treated as described above except the concentration of oligonucleotide was varied as indicated in Table 3. Results are shown in Table 3. Each of the active oligonucleotides showed a dose response effect with IC50s around 10 nM. Maximum inhibition was approximately 70% with 16500 (SEQ ID NO 17). The most active oligonucleotides were also tested for their ability to inhibit p38β. None of these oligonucleotides significantly reduced p38β mRNA expression.

4TABLE 3Dose Response of p38α mRNA in Jurkat cells to human p38αChimeric (deoxy gapped) Phosphorothioate OligonucleotidesSEQ IDASO Gene% mRNA% mRNAISIS #NO:TargetDoseExpressionInhibitioncontrol———100% 0%1649613coding2.5 nM94% 6%″″″ 5 nM74%26%″″″ 10 nM47%53%″″″ 20 nM41%59%1650017stop2.5 nM82%18%″″″ 5 nM71%29%″″″ 10 nM49%51%″″″ 20 nM31%69%16503203′-UTR2.5 nM74%26%″″″ 5 nM61%39%″″″ 10 nM53%47%″″″ 20 nM41%59%16490 75′-UTR2.5 nM112% —″″″ 5 nM109% —″″″ 10 nM104% —″″″ 20 nM97% 3%

Example 3

Human p38β Oligonucleotide Sequences

[0240] Antisense oligonucleotides were designed to target human p38β. Target sequence data are from the p38β MAPK cDNA sequence; Genbank accession number U53442, provided herein as SEQ ID NO: 23. Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All 2′-MOE cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 4.

5TABLE 4Nucleotide Sequences of Human p38βPhosphorothioate OligonucleotidesSEQTARGET GENEGENEISISNUCLEOTIDE SEQUENCE1IDNUCLEOTIDETARGETNO.(5′ → 3′)NO:CO-ORDINATES2REGION17891CGACATGTCCGGAGCAGAAT250006-0025AUG17892TTCAGCTCCTGCCGGTAGAA260041-0060coding17893TGCGGCACCTCCCACACGGT270065-0084coding17894CCGAACAGACGGAGCCGTAT280121-0140coding17895GTGCTTCAGGTGCTTGAGCA290240-0259coding17896GCGTGAAGACGTCCAGAAGC300274-0293coding17897ACTTGACGATGTTGTTCAGG310355-0374coding17898AACGTGCTCGTCAAGTGCCA320405-0424coding17899ATCCTGAGCTCACAGTCCTC330521-0540coding17900ACTGTTTGGTTGTAATGCAT340635-0654coding17901ATGATGCGCTTCAGCTGGTC350731-0750coding17902GCCAGTGCCTCAGGTGCACT360935-0954coding17903AACGCTCTCATCATATGGCT371005-1024coding17904CAGCACCTCACTGCTCAATC381126-1145stop17905TCTGTGACCATAGGAGTGTG391228-12473′-UTR17906ACACATGTTTGTGCATGCAT401294-13133′-UTR17907CCTACACATGGCAAGCACAT411318-13373′-UTR17908TCCAGGCTGAGCAGCTCTAA421581-16003′-UTR17909AGTGCACGCTCATCCACACG431753-17723′-UTR17910CTTGCCAGATATGGCTGCTG441836-18553′-UTR1Emboldened residues, 2′-methoxyethoxy- residues (others are 2′-deoxy-) including “C” residues, 5-methyl-cytosines; all linkages are phosphorothioate linkages. 2Co-ordinates from Genbank Accession No. U53442, locus name “HSU53442”, SEQ ID NO. 23.

[0241] For an initial screen of human p38β antisense oligonucleotides, HUVEC cells were cultured and treated as described in Example 2. mRNA was measured by Northern blot as described in Example 2. Results are shown in Table 5. Every oligonucleotide tested gave at least 50% inhibition. Oligonucleotides 17892 (SEQ ID NO. 26), 17893 (SEQ ID NO. 27), 17894 (SEQ ID NO. 28), 17899 (SEQ ID NO. 33), 17901 (SEQ ID NO. 35), 17903 (SEQ ID NO. 37), 17904 (SEQ ID NO. 38), 17905 (SEQ ID NO. 39), 17907 (SEQ ID NO. 41), 17908 (SEQ ID NO. 42), and 17909 (SEQ ID NO. 43) gave greater than approximately 85% inhibition and are preferred.

6TABLE 5Inhibition of Human p38β mRNA expression in Huvec Cells byChimeric (deoxy gapped) Phosphorothioate OligonucleotidesSEQGENEISISIDTARGET% mRNA% mRNANo:NO:REGIONEXPRESSIONINHIBITIONcontrol——100% 0%1789125AUG22%78%1789226coding10%90%1789327coding 4%96%1789428coding13%87%1789529coding25%75%1789630coding24%76%1789731coding25%75%1789832coding49%51%1789933coding 5%95%1790034coding40%60%1790135coding15%85%1790236coding49%51%1790337coding11%89%1790438stop 9%91%17905393′-UTR14%86%17906403′-UTR22%78%17907413′-UTR 8%92%17908423′-UTR17%83%17909433′-UTR13%87%17910443′-UTR26%74%

[0242] Oligonucleotides 17893 (SEQ ID NO. 27), 17899 (SEQ ID NO:33), 17904 (SEQ ID NO. 38), and 17907 (SEQ ID NO. 41) were chosen for dose response studies. HUVEC cells were cultured and treated as described in Example 2 except that the oligonucleotide concentration was varied as shown in Table 6. The Lipofectin7/Oligo ratio was maintained at 3 μg Lipofectin7/100 nM oligo, per ml. mRNA was measured by Northern blot as described in Example 2.

[0243] Results are shown in Table 6. Each oligonucleotide tested had an IC50 of less than 10 nM. The effect of these oligonucleotides on human p38α was also determined. Only oligonucleotide 17893 (SEQ ID NO. 27) showed an effect on p38α mRNA expression. The IC50 of this oligonucleotide was approximately 4 fold higher for p38α compared to p38β.

7TABLE 6Dose Response of p38β in Huvec cells to human p38βChimeric (deoxy gapped) Phosphorothioate OligonucleotidesSEQ IDASO Gene% mRNA% mRNAISIS #NO:TargetDoseExpressionInhibitioncontrol———100% 0%1789327coding 10 nM37%63%″″″ 25 nM18%82%″″″ 50 nM16%84%″″″100 nM19%81%1789933coding 10 nM37%63%″″″ 25 nM23%77%″″″ 50 nM18%82%″″″100 nM21%79%1790438stop 10 nM31%69%″″″ 25 nM21%79%″″″ 50 nM17%83%″″″100 nM19%81%17907413′-UTR 10 nM37%63%″″″ 25 nM22%78%″″″ 50 nM18%72%″″″100 nM18%72%

Example 4

Rat p38α Oligonucleotide Sequences

[0244] Antisense oligonucleotides were designed to target rat p38α. Target sequence data are from the p38 MAPK cDNA sequence; Genbank accession number U73142, provided herein as SEQ ID NO: 45. Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages in the wings are phosphodiester (P═O). Internucleoside linkages in the central gap are phosphorothioate (P═S). All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 7.

[0245] bEND.3, a mouse endothelial cell line (gift of Dr. Werner Risau; see Montesano et al., Cell, 1990, 62, 435, and Stepkowski et al., J. Immunol., 1994, 153, 5336) were grown in high-glucose DMEM (Life Technologies, Gaithersburg, Md.) medium containing 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycinin. Cells were plated at approximately 2×105 cells per 100 mm dish. Within 48 hours of plating, the cells were washed with phosphate-buffered saline (Life Technologies). Then, Opti-MEM7 medium containing 3 μg/mL LIPOFECTIN7 and an appropriate amount of oligonucleotide were added to the cells. As a control, cells were treated with LIPOFECTIN7 without oligonucleotide under the same conditions and for the same times as the oligonucleotide-treated samples.

[0246] After 4 hours at 37° C., the medium was replaced with high glucose DMEM medium containing 10% FBS and 1% Penicillin/Streptomycinin. The cells were typically allowed to recover overnight (about 18 to 24 hours) before RNA and/or protein assays were performed as described in Example 2. The p38α, p38β and G3PDH probes used were identical to those described in Example 2.

8TABLE 7Nucleotide Sequences of Rat p38α PhosphorothioateOligonucleotidesSEQTARGET GENEGENEISISNUCLEOTIDE SEQUENCE1IDNUCLEOTIDETARGETNO.(5′ → 3′)NOCO-ORDINATES2REGION21844CoToGoCoGsAsCsAsTsTsTsTsCsCsAsGoCoGoGoC470001-0020AUG21845GoGoToAoAsGsCsTsTsCsTsGsAsCsAsCoToToCoA480361-0380coding21846GoGoCoCoAsGsAsGsAsCsTsGsAsAsTsGoToAoGoT490781-0800coding21871CoAoToCoAsTsCsAsGsGsGsTsCsGsTsGoGoToAoC500941-0960coding21872GoGoCoAoCsAsAsAsGsCsTsAsAsTsGsAoCoToToC511041-1060coding21873AoGoGoToGsCsTsCsAsGsGsAsCsTsCsCoAoToToT521081-1100stop21874GoGoAoToGsGsAsCsAsGsAsAsCsAsGsAoAoGoCoA531101-11203′-UTR21875GoAoGoCoAsGsGsCsAsGsAsCsTsGsCsCoAoAoGoG541321-13403′-UTR21876AoGoGoCoTsAsGsAsGsCsCsCsAsGsGsAoGoCoCoA551561-15803′-UTR21877GoAoGoCoCsTsGsTsGsCsCsTsGsGsCsAoCoToGoG561861-18803′-UTR21878ToGoCoAoCsCsAsCsAsAsGsCsAsCsCsToGoGoAoG572081-21003′-UTR21879GoGoCoToAsCsCsAsTsGsAsGsTsGsAsGoAoAoGoA582221-22403′-UTR21880GoToCoCoCsTsGsCsAsCsTsGsAsTsAsGoAoGoAoA592701-27203′-UTR21881ToCoToToCsCsAsAsTsGsGsAsGsAsAsAoCoToGoG603001-30203′-UTR

[0247]

1
Emboldened residues, 2′-methoxyethoxy-residues (others are 2′-deoxy-); 2′-MOE cytosines and 2′-deoxy cytosine residues are 5-methyl-cytosines; “s” linkages are phosphorothioate linkages; “o” linkages are phosphodiester linkages. 2 Co-ordinates from Genbank Accession No. U73142, locus name “RNU73142”, SEQ ID NO. 45.

[0248] Rat p38α antisense oligonucleotides were screened in bEND.3 cells for inhibition of p38α and p38β mRNA expression. The concentration of oligonucleotide used was 100 nM. Results are shown in Table 8. Oligonucleotides 21844 (SEQ ID NO. 47), 21845 (SEQ ID NO. 48), 21872 (SEQ ID NO. 51), 21873 (SEQ ID NO. 52), 21875 (SEQ ID NO. 54), and 21876 (SEQ ID NO.

[0249] 55) showed greater than approximately 70% inhibition of p38α mRNA with minimal effects on p38β mRNA levels. Oligonucleotide 21871 (SEQ ID NO. 50) inhibited both p38α and p38β levels greater than 70%.

9TABLE 8Inhibition of Mouse p38 mRNA expression in bEND.3 Cells byChimeric (deoxy gapped) Mixed Backbone p38α AntisenseOligonucleotidesSEQGENEISISIDTARGET% p38α mRNA% p38β mRNANo:NO:REGIONINHIBITIONINHIBITIONcontrol—— 0% 0%2184447AUG81%20%2184548coding75%25%2187150coding90%71%2187251coding87%23%2187352stop90% 3%21874533′-UTR38%21%21875543′-UTR77%—21876553′-UTR69%—21877563′-UTR55%13%21878573′-UTR25%10%21879583′-UTR——21881603′-UTR——

[0250] Several of the most active oligonucleotides were selected for dose response studies. bEND.3 cells were cultured and treated as described above, except that the concentration of oligonucleotide was varied as noted in Table 9. Results are shown in Table 9.

10TABLE 9Dose Response of bEND.3 cells to rat p38βChimeric (deoxy gapped) Phosphorothioate OligonucleotidesSEQIDASO Gene% p38α mRNA% p38β mRNAISIS #NO:TargetDoseInhibitionInhibitioncontrol———100% 0%2184447AUG 1 nM——″″″ 5 nM——″″″ 25 nM36% 8%″″″100 nM80% 5%2187150coding 1 nM 1%—″″″ 5 nM23% 4%″″″ 25 nM34%24%″″″100 nM89%56%2187251stop 1 nM——″″″ 5 nM——″″″ 25 nM35%—″″″100 nM76% 1%2187352stop 1 nM—53%″″″ 5 nM—31%″″″ 25 nM54%28%″″″100 nM92%25%21875543′-UTR 1 nM—11%″″″ 5 nM—16%″″″ 25 nM33% 2%″″″100 nM72% 4%

Example 5

Mouse p38β Oligonucleotide Sequences

[0251] Antisense oligonucleotides were designed to target mouse p38β. Target sequence data are from a mouse EST sequence; Genbank accession number AI119044, provided herein as SEQ ID NO 61. Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages in the wings are phosphodiester (P═O). Internucleoside linkages in the central gap are phosphorothioate (P═S). All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 10.

11TABLE 10Nucleotide Sequences of Mouse p38βChimeric (deoxy gapped) Phosphorothioate OligonucleotidesTARGETSEQGENEISISNUCLEOTIDE SEQUENCE′IDNUCLEOTIDENO.(5′ → 3′)NO:CO-ORDINATES2100800CoAoCoAoGsAsAsGsCsAsGsCsTsGsGsAoGoCoGoA630051-0070100801ToGoCoGoGsCsAsCsCsTsCsCsCsAsTsAoCoToGoT640119-0138100802CoCoCoToGsCsAsGsCsCsGsCsTsGsCsGoGoCoAoC650131-0150100803GoCoAoGoAsCsTsGsAsGsCsCsGsTsAsGoGoCoGoC660171-0190100804ToToAoCoAsGsCsCsAsCsCsTsTsCsTsGoGoCoGoC670211-0230100805GoToAoToGsTsCsCsTsCsCsTsCsGsCsGoToGoGoA680261-0280100806AoToGoGoAsTsGsTsGsGsCsCsGsGsCsGoToGoAoA690341-0360100807GoAoAoToTsGsAsAsCsAsTsGsCsTsCsAoToCoGoC700441-0460100808AoCoAoToTsGsCsTsGsGsGsCsTsTsCsAoGoGoToC710521-0540100809AoToCoCoTsCsAsGsCsTsCsGsCsAsGsToCoCoToC720551-0570100810ToAoCoCoAsCsCsGsTsGsTsGsGsCsCsAoCoAoToA730617-0636100811CoAoGoToTsTsAsGsCsAsTsGsAsTsCsToCoToGoG740644-0663100812CoAoGoGoCsCsAsCsAsGsAsCsCsAsGsAoToGoToC750686-0705100813CoCoToToCsCsAsGsCsAsGsTsTsCsAsAoGoCoCoA760711-0730101123CoAoGoCoAsCsCsAsTsGsGsAsCsGsCsGoGoAoAoC7721871mismatch1Emboldened residues, 2′-methoxyethoxy- residues (others are 2′-deoxy-), including 2′-MOE and 2′-deoxy residues, 5-methyl-cytosines; “s” linkages are phosphorothioate linkages, “o” linkages are phosphodiester. 2Co-ordinates from Genbank Accession No. AI119044, locus name “AI119044”, SEQ ID NO. 61.

[0252] Mouse p38β antisense sequences were screened in bEND.3 cells as described in Example 4. Results are shown in Table 11.

[0253] Oligonucleotides 100800 (SEQ ID NO. 63), 100801 (SEQ ID NO. 64), 100803 (SEQ ID NO. 66), 100804 (SEQ ID NO. 67), 100805 (SEQ ID NO. 68), 100807 (SEQ ID NO. 70), 100808 (SEQ ID NO. 71), 100809 (SEQ ID NO. 72), 100810 (SEQ ID NO. 73), 100811 (SEQ ID NO.74), and 100813 (SEQ ID NO. 76) resulted in at least 50% inhibition of p38β mRNA expression. Oligonucleotides 100801 (SEQ ID NO.64), 100803 (SEQ ID NO. 66), 100804 (SEQ ID NO. 67), 100805 (SEQ ID NO. 68), 100809 (SEQ ID NO. 72), and 100810 (SEQ ID NO. 73) resulted in at least 70% inhibition and are preferred. Oligonucleotides 100801 (SEQ ID NO. 64), 100805 (SEQ ID NO. 68), and 100811 (SEQ ID NO. 74) resulted in significant inhibition of p38α mRNA expression in addition to their effects on p38β.

12TABLE 11Inhibition of Mouse p38 mRNA expression in bEND.3 Cells byChimeric (deoxy gapped) Mixed Backbone p38β AntisenseOligonucleotidesISISSEQ ID% p38β mRNA% p38α mRNANo:NO:INHIBITIONINHIBITIONcontrol— 0% 0%1008006351%—1008016474%31%1008026535%—1008036674%18%1008046785%18%1008056878%58%1008066922% 3%1008077064%—1008087153%13%1008097284%14%1008107372% 1%1008117460%43%1008127536%17%1008137654%—

Example 6

Effect of p38 MAPK Antisense Oligonucleotides on IL-6 Secretion

[0254] p38 MAPK antisense oligonucleotides were tested for their ability to reduce IL-6 secretion. bEND.3 cells were cultured and treated as described in Example 4 except that 48 hours after oligonucleotide treatment, cells were stimulated for 6 hours with 1 ng/mL recombinant mouse IL-1 (R&D Systems, Minneapolis, Minn.). IL-6 was measured in the medium using an IL-6 ELISA kit (Endogen Inc., Woburn, Mass.).

[0255] Results are shown in Table 12. Oligonucleotides targeting a specific p38 MAPK isoform were effective in reducing IL-6 secretion greater than approximately 50%.

13TABLE 12Effect of p38 Antisense Oligonucleotides on IL-6 secretionISISSEQ IDDOSE% IL-6No:NO:GENE TARGET(μM)INHIBITIONcontrol—— 0% 2187352p38α10049%10080467p38β10057% 2187150p38α and p38β20023%

Example 7

Activity of p38α Antisense Oligonucleotides in Rat Cardiomyocytes

[0256] Rat p38α antisense oligonucleotides were screened in Rat A-10 cells. A-10 cells (American Type Culture Collection, Manassas, Va.) were grown in high-glucose DMEM (Life Technologies, Gaithersburg, Md.) medium containing 10% fetal calf serum (FCS). Cells were treated with oligonucleotide as described in Example 2. Oligonucleotide concentration was 200 nM. mRNA was isolated 24 hours after time zero and quantitated by Northern blot as described in Example 2.

[0257] Results are shown in Table 13. Oligonucleotides 21845 (SEQ ID NO. 48), 21846 (SEQ ID NO. 49), 21871 (SEQ ID NO. 50), 21872 (SEQ ID NO. 51), 21873 (SEQ ID NO. 52), 21874 (SEQ ID NO. 53), 21875 (SEQ ID NO. 54), 21877 (SEQ ID NO. 56), 21878 (SEQ ID NO. 57), 21879 (SEQ ID NO. 58), and 21881 (SEQ ID NO. 60) inhibited p38α mRNA expression by 65% or greater in this assay. Oligonucleotides 21846 (SEQ ID NO. 49), 21871 (SEQ ID NO. 50), 21872 (SEQ ID NO. 51), 21877 (SEQ ID NO. 56), and 21879 (SEQ ID NO. 58) inhibited p38α mRNA expression by greater than 85% and are preferred.

14TABLE 13Inhibition of Rat p38α mRNA expression in A-10 Cells byChimeric (deoxy gapped) Mixed Backbone p38α AntisenseOligonucleotidesSEQGENEISISIDTARGET% p38α mRNA% p38α mRNANo:NO:REGIONEXPRESSIONINHIBITIONcontrol——100% 0%2184447AUG75%25%2184548coding25%75%2184649coding 8%92%2187150coding12%88%2187251coding13%87%2187352stop19%81%21874533′-UTR22%78%21875543′-UTR26%74%21876553′-UTR61%39%21877563′-UTR12%88%21878573′-UTR35%65%21879583′-UTR11%89%21881603′-UTR31%69%

[0258] The most active oligonucleotide in this screen (SEQ ID NO. 49) was used in rat cardiac myocytes prepared from neonatal rats (Zechner, D., et. al., J. Cell Biol., 1997, 139, 115-127). Cells were grown as described in Zechner et al. and transfected with oligonucleotide as described in Example 2. Oligonucleotide concentration was 1 μM. mRNA was isolated 24 hrs after time zero and quantitated using Northern blotting as described in Example 2. An antisense oligonucleotide targeted to JNK-2 was used as a non-specific target control.

[0259] Results are shown in Table 14. Oligonucleotide 21846 (SEQ ID NO. 49) was able to reduce p38α expression in rat cardiac myocytes by nearly 60%. The JNK-2 antisense oligonucleotide had little effect on p38α expression.

15TABLE 14Inhibition of Rat p38α mRNA expression in Rat CardiacMyocytes by A Chimeric (deoxy gapped) Mixed Backbone p38αAntisense OligonucleotideSEQGENEISISIDTARGET% p38α mRNA% p38α mRNANo:NO:REGIONEXPRESSIONINHIBITIONcontrol——100% 0%2184649coding 41%59%

[0260] Eample 8

Additional Human p38α Oligonucleotide Sequences

[0261] Additional antisense oligonucleotides were designed to target human p38α based on active rat sequences. Target sequence data are from the p38 MAPK cDNA sequence; Genbank accession number L35253, provided herein as SEQ ID NO: 1. Oligonucleotides were synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 15.

16TABLE 15Additional Nucleotide Sequences of Human p38αChimeric (deoxy gapped) PhosphorothioateOligonucleotidesSEQTARGET GENEGENEISISNUCLEOTIDE SEQUENCE1IDNUCLEOTIDETARGETNO.(5′ → 3′)NO:CO-ORDINATES2REGION100860CTGAGACATTTTCCAGCGGC780284-0303Start100861ACGCTCGGGCACCTCCCAGA790344-0363coding100862AGCTTCTTCACTGCCACACG800439-0458coding100863AATGATGGACTGAAATGGTC810464-0483coding100864TCCAACAGACCAATCACATT820538-0557coding100865TGTAAGCTTCTGACATTTCA830644-0663coding100866TGAATGTATATACTTTAGAC840704-0723coding100867CTCACAGTCTTCATTCACAG850764-0783coding100868CACGTAGCCTGTCATTTCAT860824-0843coding100869CATCCCACTGACCAAATATC870907-0926coding100870TATGGTCTGTACCAGGAAAC880960-0979coding100871AGTCAAAGACTGAATATAGT891064-1083coding100872TTCTCTTATCTGAGTCCAAT901164-1183coding100873CATCATCAGGATCGTGGTAC911224-1243coding100874TCAAAGGACTGATCATAAGG921258-1277coding100875GGCACAAAGCTGATGACTTC931324-1343coding100876AGGTGCTCAGGACTCCATCT941364-1383stop100877GCAACAAGAGGCACTTGAAT951452-14713′-UTR1Emboldened residues, 2′-methoxyethoxy- residues (others are 2′-deoxy-) including “C” and “C” residues, 5-methyl-cytosines; all linkages are phosphorothioate linkages. 2s Co-ordinates from Genbank Accession No. L35253, locus name “HUMMAPKNS”, SEQ ID NO. 1.

[0262] For an initial screen of human p38α antisense oligonucleotides, T-24 cells, a human transitional cell bladder carcinoma cell line, were obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis. A control oligonucleotide ISIS 118965 (TTATCCTAGCTTAGACCTAT, herein incorporated as SEQ ID NO: 96) was synthesized as chimeric oligonucleotide (“gapmer”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All 2′-MOE cytosines and 2′OH cytosines were 5-methyl-cytosines.

[0263] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. mRNA was measured by Northern blot. Results are shown in Table 16. Oligonucleotides 100861 (SEQ ID NO. 79) 100862 (SEQ ID NO. 80), 100863 (SEQ ID NO. 81), 100866 (SEQ ID NO. 84), 100867 (SEQ ID NO. 85), 100868 (SEQ ID NO. 86) 100870 (SEQ ID NO. 88), 100871 (SEQ ID NO. 89), 100872 (SEQ NO. 90), 100873 (SEQ ID NO. 91), and 100874 (SEQ ID NO. 92) 100875 (SEQ ID NO. 93) and 100877 (SEQ ID NO. 95) gave greater than approximately 40% inhibition and are preferred.

17TABLE 16Inhibition of Human p38α mRNA expression in T-24 Cells byChimeric (deoxy gapped) Phosphorothioate OligonucleotidesSEQISISIDGENE TARGET% P38α mRNA% P38β mRNANo:NO:REGIONEXPRESSIONEXPRESSION100860780284-030373%71%100861790344-036360%47%100862800439-045856%45%100863810464-048349%67%100864820538-055766%70%100865830644-066364%63%100866840704-072355%65%100867850764-078358%33%100868860824-084347%60%100869870907-092661%100% 100870880960-097951%No data100871891064-108357%96%100872901164-118337%77%100873911224-124334%70%100874921258-127742%76%100875931324-134339%90%100876941364-138377%93%100877951452-147147%95%

[0264] Oligonucleotides 100872 (SEQ ID NO. 90), 100873 (SEQ ID NO. 91), 100874 (SEQ ID NO. 92), and 100875 (SEQ ID NO. 93) were chosen for dose response studies.

[0265] Results are shown in Table 17. The effect of these oligonucleotides on human p38β was also determined.

18TABLE 17Dose Response of p38α in T-24 cells to human p38αChimeric (deoxy gapped) Phosphorothioate OligonucleotidesSEQIDASO Gene% p38α mRNA% p38β mRNAISIS #NO:TargetDoseExpressionInhibitionControl96——94% 80%11896510087290coding 50 nM45%108%″″″100 nM18%91%″″″200 nM17%92%10087391coding 50 nM19%90%″″″100 nM12%78%″″″200 nM 8%44%10087492coding 50 nM47%107% ″″″100 nM27%101% ″″″200 nM13%51%10087593coding 50 nM30%105% ″″″100 nM13%92%″″″200 nM 8%69%

Example 9

Additional Human p38β Oligonucleotide Sequences

[0266] Additional antisense oligonucleotides were designed to target human p38β based on active rat sequences. Target sequence data are from the p38 MAPK cDNA sequence; Genbank accession number U53442, provided herein as SEQ ID NO: 23.

[0267] Oligonucleotides was synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages in the wings are phosphodiester (P═O). Internucleoside linkages in the central gap are phosphorothioate (P═S). All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines. These oligonucleotide sequences are shown in Table 18. A control oligonucleotide ISIS 118966 (GTTCGATCGGCTCGTGTCGA), herein incorporated as SEQ ID NO: 107) was synthesized as chimeric oligonucleotide (“gapmer”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) in the gap and phosphodiester in the wings. All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines.

19TABLE 18Additional Nucleotide Sequences of Human p38βChimeric (deoxy gapped) Mixed-BackbonePhosphorothioate OligonucleotidesSEQTARGET GENEGENEISISNUCLEOTIDE SEQUENCE1IDNUCLEOTIDETARGETNO.(5′ → 3′)NO:CO-ORDINATES2REGION107869ACAGACGGAGCCGTAGGCGC97117-136coding107870CACCGCCACCTTCTGGCGCA98156-175coding107871GTACGTTCTGCGCGCGTGGA99207-226coding107872ATGGACGTGGCCGGCGTGAA100287-306coding107873CAGGAATTGAACGTGCTCGT101414-433coding107874ACGTTGCTGGGCTTCAGGTC102491-510coding107875TACCAGCGCGTGGCCACATA103587-606coding107876CAGTTGAGCATGATCTCAGG104614-633coding107877CGGACCAGATATCCACTGTT105649-668coding107878TGCCCTGGAGCAGCTCAGCC106682-701coding1Emboldened residues, 2′-methoxyethoxy- residues (others are 2′-deoxy-) including “C” and “C” residues, 5-methyl-cytosines. 2Co-ordinates from Genbank Accession No. U53442, SEQ ID NO. 23.

[0268] For an initial screen of human p38β antisense oligonuleotides, T-24 cells, a human transitional cell bladder carcinoma cell line, were obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 7000 cells/well for use in RT-PCR analysis. A control oligonucleotide ISIS 118966 (TTATCCTAGCTTAGACCTAT, herein incorporated as SEQ ID NO: 106) was synthesized as chimeric oligonucleotide (“gapmer”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) in the gap and phosphodiester in the wings. All 2′-MOE cytosines and 2′-OH cytosines were 5-methyl-cytosines.

[0269] For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide. mRNA was measured by Northern blot. Results are shown in Table 19. For comparison, ISIS 17893 and ISIS 17899, both targeting human p38β (SEQ ID NO: 27) and ISIS 100802 targeting mouse p38β (SEQ ID NO: 65) described in Examples 3 and 5 above, respectively, were included in the screen.

[0270] Oligonucleotides 107869 (SEQ ID NO. 97), 107871 (SEQ ID NO. 99), 107872 (SEQ ID NO. 100), 107873 (SEQ ID NO. 101), 107878 (SEQ ID NO.106), 17893 (SEQ ID NO. 27), 17899 (SEQ ID NO. 33) and 100802 (SEQ ID NO.65, targeted to mouse p38β) gave greater than approximately 40% inhibition and are preferred.

20TABLE 19Inhibition of Human p38β mRNA expression in T-24 Cells byChimeric (deoxy gapped) Mixed-Backbone PhosphorothioateOligonucleotidesSEQISISIDGENE TARGET% p38β mRNA% p38α mRNANo:NO:REGIONEXPRESSIONEXPRESSION107869 97Coding60% 93%107870 98Coding74% 97%107871 99Coding60%111%107872100Coding57%123%107873101Coding58%120%107874102Coding61%100%107875103Coding92%112%107876104Coding127% 137%107877105CodingNo dataNo data107878106Coding54%112% 17893 27Coding31% 61% 17899 33Coding56%117%100802 65Coding47% 78%

[0271] Oligonucleotides 107871, 107872, 107873, 107874, 107875, 107877, 107878, 17893 and 17899 were chosen for dose response studies.

[0272] Results are shown in Table 20. The effect of these oligonucleotides on human p38α was also determined.

21TABLE 20Dose Response of p38β in T-24 cells to human p38βChimeric (deoxy gapped) Mixed-backbone PhosphorothioateOligonucleotidesSEQIDASO Gene% p38β mRNA% p38α mRNAISIS #NO:TargetDoseExpressionInhibitionControl107——100% 100%118966107871 99coding 50 nM41%105%″″″100 nM42%132%″″″200 nM10%123%107872100coding 50 nM71%124%″″″100 nM13% 84%″″″200 nM22%102%107873101coding 50 nM69%132%″″″100 nM41%119%″″″200 nM23%131%107874102coding 50 nM75%109%″″″100 nM34% 99%″″″200 nM23% 87%107875103coding 50 nM82% 93%″″″100 nM38%101%″″″200 nM40% 91%107877105coding 50 nM50%127%″″″100 nM34%125%″″″200 nM22%106%107878106coding 50 nM70%110%″″″100 nM43%109%″″″200 nM27%116% 17893 27coding 50 nM28% 88%″″″100 nM27%115%″″″200 nM16%108% 17899 33coding 50 nM89% 87%″″″100 nM36%104%″″″200 nM15% 80%

[0273] These data show that the oligonucleotides designed to target human p38β, do so in a target-specific and dose-dependent manner.

Eample 10

Real-Time Quantitative PCR Analysis of p38β mRNA Levels

[0274] Quantitation of p38α mRNA levels was accomplished by real-time quantitative PCR using the ABI PRISM™ 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 5′ end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 3′ end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3′ quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5′-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM™ Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.

[0275] Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be “multiplexed” with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only (“single-plexing”), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.

[0276] PCR reagents were obtained from Invitrogen Corporation, (Carlsbad, Calif.). RT-PCR reactions were carried out by adding 20 μL PCR cocktail (2.5×PCR buffer minus MgCl2, 6.6 mM MgCl2, 375 μM each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5×ROX dye) to 96-well plates containing 30 μL total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48° C. Following a 10 minute incubation at 95° C. to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were carried out: 95° C. for 15 seconds (denaturation) followed by 60° C. for 1.5 minutes (annealing/extension).

[0277] Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreen™ (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen™ RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RiboGreen™ are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374).

[0278] In this assay, 170 μL of RiboGreen™ working reagent (RiboGreen™ reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 μL purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.

[0279] Probes and primers to human p38α were designed to hybridize to a human p38α sequence, using published sequence information (GenBank accession number L35253, incorporated herein as SEQ ID NO:1). For human p38α the PCR primers were:

[0280] forward primer: GATGAGTGGAAAAGCCTGAC (SEQ ID NO: 108)

[0281] reverse primer: CTGCAACAAGAGGCACTTGA (SEQ ID NO: 109) and the PCR probe was: FAM-GATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGA-TAMRA (SEQ ID NO: 110) where FAM is the fluorescent dye and TAMRA is the quencher dye. For human GAPDH the PCR primers were:

[0282] forward primer: GAAGGTGAAGGTCGGAGTC(SEQ ID NO: 111)

[0283] reverse primer: GAAGATGGTGATGGGATTTC (SEQ ID NO: 112) and the PCR probe was: 5′ JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA 3′ (SEQ ID NO: 113) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.

[0284] Probes and primers to mouse p38α were designed to hybridize to a mouse p38α sequence, using published sequence information (GenBank accession number U10871.1, incorporated herein as SEQ ID NO: 114). For mouse p38α the PCR primers were:

[0285] forward primer: AAGGGAACGAGAAAACTGCTGTT (SEQ ID NO: 115)

[0286] reverse primer: TATTTTAACCAGTGGTATTATCTGACATCCT (SEQ ID NO: 116) and the PCR probe was: FAM-TTGTATTTGTGAACTTGGCTGTAATCTGGTATGCC -TAMRA

[0287] (SEQ ID NO: 117) where FAM is the fluorescent reporter dye and TAMRA is the quencher dye. For mouse GAPDH the PCR primers were:

[0288] forward primer: GGCAAATTCAACGGCACAGT(SEQ ID NO: 118)

[0289] reverse primer: GGGTCTCGCTCCTGGAAGAT(SEQ ID NO: 119) and the PCR probe was: 5′ JOE-AAGGCCGAGAATGGGAAGCTTGTCATC-TAMRA 3′ (SEQ ID NO: 120) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.

[0290] Probes and primers to rat p38α were designed to hybridize to a rat p38α sequence, using published sequence information (GenBank accession number U73142, incorporated herein as SEQ ID NO: 45). For rat p38α the PCR primers were:

[0291] forward primer: ATCATTTGGAGCCCAGAAGGA (SEQ ID NO: 121)

[0292] reverse primer: TGGAGCTGGACTGCATACTGA (SEQ ID NO: 122) and the PCR probe was: FAM-CTGGCCAGGCCTCACCGC-TAMRA

[0293] (SEQ ID NO: 123) where FAM is the fluorescent reporter dye and TAMRA is the quencher dye. For rat GAPDH the PCR primers were:

[0294] forward primer: TGTTCTAGAGACAGCCGCATCTT(SEQ ID NO: 124)

[0295] reverse primer: CACCGACCTTCACCATCTTGT(SEQ ID NO: 125) and the PCR probe was: 5′ JOE-TTGTGCAGTGCCAGCCTCGTCTCA-TAMRA 3′ (SEQ ID NO: 126) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.

Example 11

Additional Human p38α Oligonucleotide Sequences

[0296] Additional antisense oligonucleotides were designed to target human p38α using published sequence (Genbank accession number NM—001315.1, provided herein as SEQ ID NO: 127). Oligonucleotides were synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings. ” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. Internucleoside linkages are phosphorothioate (P═S). These oligonucleotide sequences are shown in Table 21. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds. The compounds can be analyzed for their effect on human p38α mRNA levels by quantitative real-time PCR as described in other examples herein.

22TABLE 21Additional chimeric phosphorothioate antisenseoligonucleotides targeted to human p38αTargetSequenceTargetSEQISIS #RegionAccession #SiteSEQUENCEID NO:186877codingNM_001315.11271GAGCAAAGTAGGCATGTGCA1281868783′ UTRNM_001315.12703GTTTCCGAAGTTTGGGATAT1291868793′ UTRNM_001315.12735GCATTAGTTATTGGGAGTGA1301868803′ UTRNM_001315.11671CCCTGGAGCATCCACAACCT131186881codingNM_001315.11021TGTACCAGGAAACAATGTTC1321868825′ UTRNM_001315.1326CGGGCAAGAAGGTGGCCCTG1331868833′ UTRNM_001315.13296ATCGCCATCAGTCTGCCTCC1341868843′ UTRNM_001315.12312TGACATCAAGAACCTGCTTC1351868853′ UTRNM_001315.12134GGCCCACAAGCAGCTGTCCA1361868863′ UTRNM_001315.13063TGAAAACGACACTTCTCCAC1371868873′ UTRNM_001315.13307GGTGAGAGGGAATCGCCATC1381868883′ UTRNM_001315.12007ATACTGTCAAGATCTGAGAA1391868893′ UTRNM_001315.12702TTTCCGAAGTTTGGGATATT1401868903′ UTRNM_001315.12205AGAGAGACGCACATATACGC1411868913′ UTRNM_001315.11516CAACAGGCACTTGAATAATA142186892codingNM_001315.1638ATTCCTCCAGAGACCTTGCA1431868933′ UTRNM_001315.12848AAGACACCTTGTTACTTTTT1441868943′ UTRNM_001315.12989TGCCCTTTCTCCCCATCAAA145186895codingNM_001315.11096TGGCATCCTGTTAATGAGAT1461868963′ UTRNM_001315.11477AAGGCCTTCCCCTCACAGTG1471868973′ UTRNM_001315.13728AATAGGCTTTATTTTAACCA1481868983′ UTRNM_001315.12455ACCCAAGAAGTCTTCACTGG1491868993′ UTRNM_001315.13135TTTCTTATTACACAAAAGGC1501869003′ UTRNM_001315.13445GGAAATCACACGAGCATTTA151186901codingNM_001315.1794GGTCCCTGTGAATTATGTCA1521869023′ UTRNM_001315.13112AATATATGAGTCCTCATGTA1531869033′ UTRNM_001315.13511CTAACACGTATGTGGTCACA1541869043′ UTRNM_001315.12984TTTCTCCCCATCAAAAGGAA155186905codingNM_001315.1727CTGAACATGGTCATCTGTAA1561869063′ UTRNM_001315.13681ATAACTGATTACAGCCAAGT1571869073′ UTRNM_001315.12959TTCTCAAAGGGATTCCTACA158186908codingNM_001315.1678TCTGCCCCCATGAGATGGGT159186909codingNM_001315.1540TTCGCATGAATGATGGACTG160186910codingNM_001315.11275TACTGAGCAAAGTAGGCATG161186911codingNM_001315.11336GTCCCTGCTTTCAAAGGACT162186912codingNM_001315.1577CATATGTTTAAGTAACCGCA1631869133′ UTRNM_001315.12963CACATTCTCAAAGGGATTCC164

[0297] Additional antisense oligonucleotides were designed to target human p38α using published sequence (Genbank accession number NM—001315.1, provided herein as SEQ ID NO: 127. Oligonucleotides were synthesized as oligonucleotides comprised of 2′-deoxynucleotides and phosphodiester internucleoside linkages (P═O). These oligonucleotide sequences are shown in Table 22. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

23TABLE 22Additional phosphodiester oligonucleotidestargeted to p38αTargetSEQISISSequenceTargetID#RegionAccessionSiteSEQUENCENO169107codingNM_001315.11420GGACTCCATCTCTTCTTGGTCAA1653367473′ UTRNM_001315.11454GAAGTGGGATCAACAGAACAGAAA166336750codingNM_001315.1436AGCCCACTGGAGACAGGTTCT167

Example 12

Mouse and Rat p38α Antisense Oligonucleotides

[0298] Antisense oligonucleotides were designed to target mouse p38α using published sequences (Genbank accession number U10871.1, provided herein as SEQ ID NO: 114, GenBank accession number D83073.1, provided herein as SEQ ID NO: 168, GenBank accession number AA002328.1, provided herein as SEQ ID NO: 169, GenBank accession number AF128892.1, provided herein as SEQ ID NO: 170, GenBank accession number BY159314.1, provided herein as SEQ ID NO: 171 and Genbank accession number BY257628.1, provided herein as SEQ ID NO: 172). These compounds are shown in the tables included in this example.

[0299] Antisense oligonucleotides were also designed to target rat p38α using published sequences (GenBank accession number U73142, provided herein as SEQ ID NO: 45, and Genbank accession number U91847.1, provided herein as SEQ ID NO: 173). These compounds are shown in the tables in this example.

[0300] Oligonucleotides were synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. Internucleoside linkages are phosphorothioate (P═S). In Table 23, “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

[0301] The compounds in Table 23 were analyzed for their effect on mouse p38α mRNA levels by quantitative real-time PCR as described in other examples herein. Data are averages from two experiments in which bEND.3 cells were treated with the antisense oligonucleotides of the present invention and are presented in the column labeled “% inhib, mouse p38α”. If present, “N.D.” indicates “no data”. ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 174) was used as a scrambled control oligonucleotide.

[0302] The compounds in Table 23 were also analyzed for their effect on rat p38α mRNA levels in NR-8383 cells by quantitative real-time PCR as described in other examples herein. The rat normal lung alveolar macrophage cell line NR-8383 was obtained from the American Type Culture Collection (Manassas, Va.). NR-8383 cells were routinely cultured in Ham's F12 medium (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal bovine serum (Gibco/Life Technologies, Gaithersburg, Md.), and 1% Penicillin/Streptomycin (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. For transfection with oligonucleotides, NR-8383 cells were plated on 24 well plates at a density of 4×104 cells/cm2 (8.0×104 cells/well) in serum-free F12 Nutrient Medium (Gibco/Life Technologies, Gaithersburg, Md.). After 2 hours, media was removed and replaced with 400 ul of Ham's F12 Nutrient Medium supplemented with 15% fetal bovine serum and 1% Penicillin/Streptomyocin. Cells were then transfected with 300 nM of antisense oligonucleotides mixed with FuGENE 6

[0303] Transfection Reagent (Roche Applied Science, Indianapolis, Ind.) for 24 hours, after which mRNA was quantitated as described in other examples herein. Data are averages from two experiments in which NR-8383 cells were treated with the antisense oligonucleotides of the present invention and are presented in the column labeled “% inhib, rat p38α”. If present, “N.D.” indicates “no data”. ISIS 18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 174) was used as a scrambled control oligonucleotide.

[0304] One additional compound, ISIS 186911 (SEQ ID NO: 143), targeted to human p38α, was also tested for its effect on mouse and rat p38α mRNA expression in bEND.3 cells and NR-8383 cells, respectively.

[0305] An asterisk (*) adjacent to the ISIS oligonucleotide number in Table 23 indicates that the oligonucleotide targets human, mouse and rat p38αsequences. Compounds in Table 23, with the exception of ISIS 101753, ISIS 320119, ISIS 320120 and 320121 target both mouse and rat p38α.

24TABLE 23Inhibition of mouse and rat p38α by chimeric phosphorothioateoligonucleotides having 2′-MOE wings and a deoxy gapTarget% Inhib.% Inhib.SequenceTargetmouseratSeqISIS #RegionAccession #SiteSequencep38αp38αID NO100864*codingL35253538TCCAACAGACCAATCACATT835782101753startU731421CTGCGACATTTTCCAGCGGC6443175codon101755*codingU10871.11226CATCATCAGGGTCGTGGTAC8474176101757*codingU10871.11336AGGTGCTCAGGACTCCATTT8853177186911*codingNM 001315.11336GTCCCTGCTTTCAAAGGACT8140178306022*codingU73142781GGCCAGAGACTGAATGTAGT7853179320103*codingU10871.1315AGCTCCTGCCGGTAGAACGT8155180320104*codingU10871.1405TCAAAAGCAGCACACACCGA8242181320105*codingU10871.1417CCCGTCTTTGTATCAAAAGC8959182320106*codingU10871.1453AACGGTCTCGACAGCTTCTT9167183320107*codingU10871.1483TAGGTCCTTTTGGCGTGAAT8460184320108*codingU10871.1600AGATGGGTCACCAGGTACAC6157185320109*codingU10871.1609GCCCCCATGAGATGGGTCAC6934186320110*codingU10871.1807TCATCAGTGTGCCGAGCCAG8754187320111*codingU10871.1930GTCAACAGCTCAGCCATGAT8655188320112*codingU10871.1940CGTTCTTCCGGTCAACAGCT9358189320113*codingU10871.1967ATCAATATGGTCTGTACCAG359190320114*codingU10871.1987CTTAAAATGAGCTTCAACTG7160191320115*codingU10871.11001GGGTTCCAACGAGTCTTAAA6753192320116*codingU10871.11019TCAGAAGCTCAGCCCCTGGG9573193320117*codingU10871.11030GGAGATTTTCTTCAGAAGCT7255194320118*codingU10871.11040CAGACTCTGAGGAGATTTTC4769195320119codingU10871.11050TAGTTTCTTGCAGACTCTGA5332196320120codingU10871.11060AGACTGAATGTAGTTTCTTG7439197320121codingU10871.11083TTCATCTTCGGCATCTGGGC8357198320122codingU10871.11093ATTTGCGAAGTTCATCTTCG7348199320123codingU10871.11103CAATAAATACATTTGCGAAG7932200320124codingU10871.11113GGATTGGCACCAATAAATAC2931201320125codingU10871.11176GCTGCTGTGATCCTCTTATC6763202320126codingU10871.11196AGGCATGCGCAAGAGCTTGG9069203320127codingU10871.11206TGAGCAAAGTAGGCATGCGC7356204320128codingU10871.11260TCAAAGGACTGGTCATAAGG7937205320129codingU10871.11351CATTTCTTCTTGGTCAAGGG6965206320130stopU10871.11358AGGACTCCATTTCTTCTTGG8161207codon3201313′ UTRU10871.11406CTTCCCCTCACAGTGAAGTG92392083201323′ UTRU10871.11432TATTTGGAGAGTTCCCATGA85562093201333′ UTRU10871.11442ACTTGAATGGTATTTGGAGA52612103201343′ UTRU10871.11452AACAAGAGGCACTTGAATGG85742113201353′ UTRU10871.11480ACCCCCTTCCACCATGAAGG95472123201363′ UTRU10871.11608AGCAGGCAGACTGCCAAGGA83342133201373′ UTRU10871.11663CACACACATCCCTAAGGAGA80442143201383′ UTRU10871.11745TAAAGGCAGGGCCACAGGAG87462153201393′ UTRU10871.11771GCAGCCTCTCTCTGTCACTG87612163201403′ UTRU10871.11791GGGATAGCCTCAGACCTGAA61372173201413′ UTRU10871.11801GCATGGCTGAGGGATAGCCT83732183201423′ UTRU10871.11828GAGCCAGTTGGTTCTCTTGG85532193201433′ UTRU10871.11910AGGCACAAACAGACTGACAG88542203201443′ UTRU10871.11917CCTTTTAAGGCACAAACAGA83392213201453′ UTRU10871.12138GACCTCTGCACTGAGGTGAA52442223201463′ UTRU10871.12147GGCACTGGAGACCTCTGCAC74572233201473′ UTRU10871.12228AGAGCACAGCATGCAAACAC66432243201483′ UTRU10871.12259CCAGGGCTTCCAGAAGACAG78332253201493′ UTRU10871.12576AAGGAGCTCCTGGCTTCAGG74252263201503′ UTRU10871.12738GGATTCCTACAACATACAAA82622273201513′ UTRU10871.12758GAAGGAACCACACTCTCTAA90472283201523′ UTRU10871.12778TTTGCCCTTTCTCCCCATCA93662293201533′ UTRU10871.12791AATATTAAAATAATTTGCCC0222303201543′ UTRU10871.12817TCATGTTTATAAAGGTGAAA52502313201553′ UTRU10871.12827CCCTGAGGATTCATGTTTAT93732323201563′ UTRU10871.12930GGAATTGGCTTTACACTTTC91642333201573′ UTRU10871.12941CGTCCAACACTGGAATTGGC96712343201583′ UTRU10871.13042CCTTCTGGGCTCCAAATGAT91712353201593′ UTRU10871.13386TCTGACATCCTATGGCATAC9469236320160codingD83073.1900GTTAATATGGTCTGTACCAG5343237320161codingD83073.1910GCTGAAGCTGGTTAATATGG8066238320162codingD83073.1920CGCATTATCTGCTGAAGCTG9262239320163codingD83073.1955TGTTAATGAGATAAGCAGGG040240320164codingD83073.1965CTTGGCATCCTGTTAATGAG8073241320165codingD83073.1975TGCCTCATGGCTTGGCATCC8153242320166codingD83073.1991ACTGAATGTAGTTTCTTGCC53352433201675′ UTRAA002328.1155CTTGCCTGTAAAAACACAGA711244320168stopAF128892.11059TCACCTCATGGCTTGGCATC8356245codon320169stopAF128892.11066TTTGTTCTCACCTCATGGCT9264246codon3201703′ UTRAF128892.11132TGCTGGCTATACACAGACAC8355247320171intronBY159314.158TGGAAAACTGTTTTGTCAAA352248320172intron3Y257628.139ACTCTCGCGAGAACAGCTCC390249320173intronBY257628.172TCCCACAGGCAGCGGCCGGG160250320174intronBY257628.197CCCGCTTGGGCTCCAGTGGC6229251

[0306] Additional antisense oligonucleotides were designed to target mouse p38α using published sequences (Genbank accession number U10871.1, provided herein as SEQ ID NO: 114). Oligonucleotides are composed of 2′-deoxynucleotides. Internucleoside linkages are phosphorodiester (P═O). These oligonucleotide sequences are shown in Table 24. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

25TABLE 24Antisense oligonucleotides targeted to mousep38α having 2′-deoxynucleotides andphosphodiester linkagesTargetSequenceStartSEQISIS #RegionAccession #SiteSEQUENCEID NO1379343′ UTRU10871.13331GCAGTTTTCTCGTTCC252CTTG264006codingU10871.11207CTGAGCAAAGTAGGCA253TGCG3201843′ UTRU10871.12306GGAGGCAATGTGGACA254GGAA279221codingU10871.1521CATTTTCGTGTTTCAT255GTGCTTC3264033′ UTRU10871.13395TATTTTAACCAGTGGT256ATTATCTACATCCT

[0307] Additional antisense oligonucleotides were designed to target mouse p38α using published sequences (Genbank accession number U10871.1, provided herein as SEQ ID NO: 114). Oligonucleotides were synthesized as chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings.” The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. Internucleoside linkages in the central gap region are phosphorothioate (P═S), and internucleoside linkages in the wings are phosphodiester (P═O). These oligonucleotide sequences are shown in Table 25. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

26TABLE 25Chimeric oligonucleotides targeted to mousep38a having 2′-MOE wings and a deoxy gapand mixed phophorothioate and phosphodiesterinternucleoside linkagesTargetSequenceSEQISISAccessionStartID#Region#SiteSEQUENCENO101369codonU10871.1286CTGCGACATCTTCCAGCG257GC101370codingU10871.1646GGTCAGCTTCTGGCACTT258CA1013723′ UTRU10871.11609AAGCAGGCAGACTGCCAA259GG

[0308] Additional antisense oligonucleotides were designed to target rat p38α using published sequences (GenBank accession number U73142, provided herein as SEQ ID NO: 45, and GenBank accession number U91847.1, provided herein as SEQ ID NO: 173). Oligonucleotides are composed of 2′-deoxynucleotides. Internucleoside linkages are phosphorodiester (P═O). These oligonucleotide sequences are shown in Table 26. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

27TABLE 26Antisense oligonucleotides targeted to rat p38αhaving 2′-deoxynucleotides and phosphodiesterlinkagesTargetSequenceSEQISISAccessionStartID#Region#SiteSEQUENCENO336744codingU91847.1902AGGCATGCGCAAGAGCTT260336741codingU91847.166GGGACAGGTTCTGGTATC261GC257014codingU91847.1224TCTCGTGCTTCATGTGCT262TCA3201873′ UTRU73142 2800TGGAGCTGGACTGCATAC263TGA

[0309] Additional antisense oligonucleotides were designed to target rat p38α using published sequences (GenBank accession number U73142, provided herein as SEQ ID NO: 45). Oligonucleotides were synthesized as chimeric oligonucleotides, composed 2′-deoxynucleotides and 2′-methoxyethyl (2′-MOE) nucleotides (indicated in bold type in Table 27). Internucleoside linkages in the central gap region are phosphorothioate (P═S), and internucleoside linkages in the wings are phosphodiester (P═O). These oligonucleotide sequences are shown in Table 27. “Target site” indicates the first (5′-most) nucleotide number on the particular target sequence to which the compound binds.

28TABLE 27Chimeric oligonucleotides targeted to rat p38αhaving 2′-MOE wings and a deoxy gap and mixedphophorothioate and phosphodiesterinternucleoside linkagesTargetSequenceSEQISISAccessionStartID#Region#SiteSEQUENCENO111831codingU73142941CATCAGGGTCGTGGTAC264111830codingU73142942CATCATCAGGGTCGT265

Example 13

Mouse model of allergic inflammation

[0310] In the mouse model of allergic inflammation, mice were sensitized and challenged with aerosolized chicken ovalbumin (OVA). Airway responsiveness was assessed by inducing airflow obstruction with a methacholine aerosol using a noninvasive method. This methodology utilized unrestrained conscious mice that are placed into the main chamber of a plthysmograph (Buxco Electronics, Inc., Troy, N.Y.). Pressure differences between this chamber and a reference chamber were used to extrapolate minute volume, breathing frequency and enhanced pause (Penh). Penh is a dimensionless parameter that is a function of total pulmonary airflow in mice (i.e., the sum of the airflow in the upper and lower respiratory tracts) during the respiratory cycle of the animal. The lower the Penh, the greater the airflow. This parameter closely correlates with lung resistance as measured by traditional invasive techniques using ventilated animals (Hamelmann et al., 1997). Dose-response data were plotted as raw Penh values to increasing concentrations of methacholine. This system was used to test the efficacy of an antisense oligonucleotide targeted to mouse p38α (ISIS 101757; SEQ ID NO: 177). Mismatched p38α oligonucleotide (ISIS 101758; SEQ ID NO: 266) was used as a negative control.

[0311] There are several important features common to human asthma and the mouse model of allergic inflammation. One of these is pulmonary inflammation, in which cytokine expression and Th2 profile is dominant. Another is goblet cell hyperplasia with increased mucus production. Lastly, airway hyperresponsiveness (AHR) occurs resulting in increased sensitivity to cholinergic receptor agonists such as acetylcholine or methacholine. The compositions and methods of the present invention may be used to treat AHR and pulmonary inflammation. The combined use of antisense oligonucleotides targeted to human p38 MAP kinase with one or more conventional asthma medications including, but not limited to, montelukast sodium (Singulair™), albuterol, beclomethasone dipropionate, triamcinolone acetonide, ipratropium bromide (Atrovent™), flunisolide, fluticasone propionate (Flovent™) and other steroids is also contemplated.

[0312] Ovalbumin-Induced Allergic Inflammation

[0313] For intratracheal administration of ISIS 101757, female Balb/c mice (Charles Rivers Laboratory, Taconic Farms, N.Y.) were maintained in micro-isolator cages housed in a specific pathogen-free (SPF) facility. The sentinel cages within the animal colony surveyed negative for viral antibodies and the presence of known mouse pathogens. Mice were sensitized and challenged with aerosolized chicken OVA. Briefly, 20 μm alum-precipitated OVA was injected intraperitoneally on days 0 and 14. On day 24, 25 and 26, the animals were exposed for 20 minutes to 1.0% OVA (in saline) by nebulization. The challenge was conducted using an ultrasonic nebulizer (PulmoSonic, The DeVilbiss Co., Somerset, Pa.). Animals were analyzed about 24 hours following the last nebulization using the Buxco electronics Biosystem. Lung function (Penh), lung histology (cell infiltration and mucus production), target mRNA reduction in the lung, inflammation (BAL cell type & number, cytokine levels), spleen weight and serum AST/ALT were determined.

[0314] For the aerosol studies, the protocol described above was slightly modified. Male Balb/c mice were injected IP with OVA (20 μg) in aluminum hydroxide on days 0 and 14. Aerosol dosing was performed with nebulized sterile saline, antisense oligonucleotide or mismatched control oligonucleotide using 25, 125 and 250 μg/ml solutions (5 mg/kg) for 30 min. on days 14-20 in a closed chamber. Aerosol lung challenge was carried out with nebulized saline or 1% OVA for 20 min. on days 18, 19 and 20. BAL fluid was collected at 24 hr post-last lung challenge (cell differentials) or at 2-12 h post-challenge (cytokine analysis). AHR was measured 24 hours after OVA challenge. Mice were exposed to aerosolized methacholine 24 hr post-last lung challenge from 2-80 mg/ml for 3 min. until a 200% increase in Penh was achieved.

[0315] Intratracheal Oligonucleotide Administration

[0316] Antisense oligonucleotides (ASOs) were dissolved in saline and used to intratracheally dose mice every day, four times per day, from days 15-26 of the OVA sensitization and challenge protocol, or used as an aerosol. Specifically, the mice were anesthetized with isofluorane and placed on a board with the front teeth hung from a line. The nose was covered and the animal's tongue was extended with forceps and 25 μl of various doses of ASO, or an equivalent volume of saline (control) was placed at the back of the tongue until inhaled into the lung.

[0317] Mouse antisense oligonucleotides to p38α are phosphorothioates with 2′-MOE modifications on nucleotides 1-5 and 16-20, and 2′-deoxy at positions 6-15. These ASOs were identified by mouse-targeted ASO screening of 10 p38α antisense oligonucleotides by target p38α mRNA reduction in mouse bEND.3 cells, as described in Example 12. Dose-response confirmation led to selection of ISIS 21873 (>70% reduction at 50 nM). ISIS 101757 contains all phosphorothioate linkages, whereas ISIS 21873 is a mixed phosphodiester/phosphorothioate compound. ISIS 101757 had an IC50<50 nM for reducing p38α mRNA in endothelial cells, and an IC50 of about 250 nM in fibroblasts.

[0318] Results of Aerosol Administration

[0319] The p38α knock-down effect of ISIS 101757 was confirmed in a mouse T cell line (EL4) and a mouse macrophage cell line (RAW264.7) using Western blotting. ISIS 101757, but not the mismatched control, dose-dependently suppressed methacholine-induced AHR in sensitized mice measured by whole body plethysmography (FIG. 1A-1B). The PC200 values for methacholine (FIG. 2) significantly (P<0.05) reduced OVA-induced increases in total cell counts and eosinophils recovered in BAL fluid (FIG. 3). In addition, histological studies revealed that ISIS 101757 markedly inhibited OVA-induced inflammatory cell infiltration into the lungs (H&E stain) and mucus hypersecretion in the airway epithelium (PAS stain). ISIS 101757 also significantly (P<0.05);lowered blood levels of total IgE, OVA-specific IgE and OVA-specific IgG1 in sensitized mice as compared to the mismatched control. Oligonucleotide levels of up to 1 μg/g of lung tissue were sufficient to achieve the pharmacological effects described above. The aerosolized ISIS 101757 concentration in mouse lung vs. dose is shown in FIG. 4. There was no significant effect of aerosol oligonucleotide administration of spleen weight. These data indicate that p38α antisense oligonucleotides are useful for the treatment of asthma.

[0320] Intratracheal Administration Results

[0321] After intratracheal administration of ISIS 101757 as described above, dose-dependent inhibition of the Penh response to methacholine (50 mg/ml) challenge was observed (FIG. 5). The oligonucleotide concentration (μg/g) in lungs vs. dose is shown in FIG. 6.

[0322] RT-PCR Analysis

[0323] RNA was harvested from experimental lungs removed on day 28 of the OVA protocol. P38α levels were measured by quantitative RT-PCR as described in other examples herein.

[0324] Collection of Bronchial Alveolar Lavage (BAL) Fluid and Blood Serum for the Determination of Cytokine and Chemokine Levels

[0325] Animals were injected with a lethal dose of ketamine, the trachea was exposed and a cannula was inserted and secured by sutures. The lungs were lavaged twice with 0.5 ml aliquots of ice cold PBS with 0.2% FCS. The recovered BAL fluid was centrifuged at 1,000 rpm for 10 min at 4° C., frozen on dry ice and stored at −80° C. until used. Luminex was used to measure cytokine levels in BAL fluid and serum.

[0326] BAL Cell Counts and Differentials

[0327] Cytospins of cells recovered from BAL fluid were prepared using a Shandon Cytospin 3 (Shandon Scientific LTD, Cheshire, England). Cell differentials were performed from slides stained with Leukostat (Fisher Scientific, Pittsburgh, Pa.). Total cell counts were quantified by hemocytometer and, together with the percent type by differential, were used to calculate specific cell number.

[0328] Tissue Histology

[0329] Before resection, lungs were inflated with 0.5 ml of 10% phosphate-buffered formalin and fixed overnight at 4° C. The lung samples were washed free of formalin with 1×PBS and subsequently dehydrated through an ethanol series prior to equilibration in xylene and embedded in paraffin. Sections (6μ) were mounted on slides and stained with hematoxylin/eosin, massons trichome and periodic acid-schiff (PAS) reagent. Parasagittal sections were analyzed by bright-field microscopy. Mucus cell content was assessed as the airway epithelium staining with PAS. Relative comparisons of mucus content were made between cohorts of animals by counting the number of PAS-positive airways.

Example 14

Design and Screening of Duplexed Antisense Compounds Targeting p38α MAP Kinase

[0330] In accordance with the present invention, a series of nucleic acid duplexes comprising the antisense compounds of the present invention and their complements can be designed to target p38α MAP kinase. The nucleobase sequence of the antisense strand of the duplex comprises at least a portion of an oligonucleotide to p38α MAP kinase as described herein. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. The sense strand of the dsRNA is then designed and synthesized as the complement of the antisense strand and may also contain modifications or additions to either terminus. For example, in one embodiment, both strands of the dsRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini. For example, a duplex comprising an antisense strand having the sequence CGAGAGGCGGACGGGACCG and having a two-nucleobase overhang of deoxythymidine(dT) would have the following structure:

29 cgagaggcggacgggaccgTTAntisense Strand |||||||||||||||||||TTgctctccgcctgccctggcComplement

[0331] RNA strands of the duplex can be synthesized by methods disclosed herein or purchased from Dharmacon Research Inc., (Lafayette, Colo.). Once synthesized, the complementary strands are annealed. The single strands are aliquoted and diluted to a concentration of 50 uM. Once diluted, 30 uL of each strand is combined with 15 uL of a 5×solution of annealing buffer. The final concentration of said buffer is 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, and 2 mM magnesium acetate. The final volume is 75 uL. This solution is incubated for 1 minute at 90° C. and then centrifuged for 15 seconds. The tube is allowed to sit for 1 hour at 37° C. at which time the dsRNA duplexes are used in experimentation. The final concentration of the dsRNA duplex is 20 uM. This solution can be stored frozen (−20° C.) and freeze-thawed up to 5 times.

[0332] Once prepared, the duplexed antisense compounds are evaluated for their ability to modulate p38α MAP kinase expression according to the protocols described herein.

Example 15

Design of Phenotypic Assays and In Vivo Studies for the Use of p38α MAP Kinase Inhibitors

[0333] Phenotypic Assays

[0334] Once p38α MAP kinase inhibitors have been identified by the methods disclosed herein, the compounds are further investigated in one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition. Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to investigate the role and/or association of p38α MAP kinase in health and disease. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.).

[0335] In one non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with p38α MAP kinase inhibitors identified from the in vitro studies as well as control compounds at optimal concentrations which are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.

[0336] Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.

[0337] Analysis of the genotype of the cell (measurement of the expression of one or more of the genes of the cell) after treatment is also used as an indicator of the efficacy or potency of the p38α MAP kinase inhibitors. Hallmark genes, or those genes suspected to be associated with a specific disease state, condition, or phenotype, are measured in both treated and untreated cells.

	Number	Date	Country
Parent	09640101	Aug 2000	US
Child	10238442	Sep 2002	US

	Number	Date	Country
Parent	10238442	Sep 2002	US
Child	10641455	Aug 2003	US
Parent	09286904	Apr 1999	US
Child	09640101	Aug 2000	US

Antisense modulation of p38 mitogen activated protein kinase expression

Information

Publication Number

Date Filed

Date Published

Inventors

CPC

US Classifications

International Classifications

Abstract

Description

Claims

Parent Case Info

Continuations (1)

Continuation in Parts (2)