Patent Grant
RE48887
This application includes a Sequence Listing submitted electronically as an ASCII file created on Jan. 2, 2016, named ND5123179US_SL.txt, which is 141,105 bytes in size, and is hereby incorporated by reference in its entirety.
Mutation of a KRAS gene can be related to malignant tumors, such as lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas, and colorectal carcinoma. Recent observations indicate that elevated levels of the protein Glutathione S-transferase-π (GST-π) is associated with such KRAS mutations.
Without wishing to be bound by any one particular theory, it has been found that upon suppression of GST-π in cells, the level of the cell cycle-regulating protein p21 can be surprisingly elevated.
One of the functions of the cell cycle-regulating protein p21 is to inhibit apoptosis. For example, p21 may have the effect of protecting a cell from apoptosis induced by a chemotherapeutic agent, both in vitro and in vivo. See, e.g., Gartel and Tyner, 2002, Mol Cancer Ther., 2002, 1(8):639-49; Abbas and Dutta, 2009, Nat Rev Cancer., 2009, 9(6): 400-14. p21 is encoded by CDKN1A gene and belongs to the CIP/KIP family. p21 can function to inhibit cell cycle progression at the G1 phase and the G2/M phase by binding a cyclin-CDK complex. For example, the p21 gene undergoes activation by p53, a tumor suppressor gene. Upon activation of p53 due to DNA damage, p53 activates p21 so that the cell cycle is arrested at the G1 phase and the G2/M phase.
GST-π is a member of the Glutathione S-transferase (IUBMB EC 2.5.1.18) family of six isoenzymes that play a role in detoxification by catalyzing the conjugation of hydrophobic and electrophilic compounds with reduced glutathione. The GST-π gene (GSTP1) is a polymorphic gene encoding active, functionally different GSTP1 variant proteins that are thought to function in xenobiotic metabolism. GSTP1 may play a role in susceptibility to cancer and is expressed abundantly in tumor cells. See, e.g., Aliya S. et al. Mol Cell Biochem., 2003 November; 253(1-2):319-327. Glutathione S-transferase-π is an enzyme that in humans is encoded by the GSTP1 gene. See, e.g., Bora P S, et al. (October 1991) J. Biol. Chem., 266 (25): 16774-16777. The GST-π isoenzyme has been shown to catalyze the conjugation of GSH with some alkylating anti-cancer agents, suggesting that over-expression of GST-π would result in tumor cell resistance.
Elevated serum GST-π levels were observed in patients with various gastrointestinal malignancies including gastric, esophageal, colonic, pancreatic, hepatocellular, and biliary tract cancers. Over 80% of patients with Stage III or IV gastric cancer and even about 50% of those with Stage I and II had elevated levels of serum GST-π. See, e.g., Niitsu Y, et al. Cancer, 1989 Jan. 15; 63(2):317-23. GST-π was found to be a useful marker for predicting the recurrence of tumors in patients with oral cancer after chemotherapy. See, e.g., Hirata S. et al. Cancer, 1992 Nov. 15:70(10):2381-7.
In human colorectal cancer, KRAS mutation appears to induce overexpression of GST-π via activation of AP-1. See, e.g., Miyanishi et al., Gastroenterology, 2001; 121 (4):865-74.
Expression of GST-π increases in various cancer cells, which may be related to resistance to some anticancer agents. See, e.g. Ban et al., Cancer Res., 1996, 56(15):3577-82; Nakajima et al., J Pharmacol Exp Ther., 2003, 306(3): 861-9.
Agents for suppressing GST-π have been disclosed for inducing apoptosis in cells. However, such compositions and techniques also caused autophagy and required the combined action of various agents. See, e.g., US 2014/0315975 A1. Moreover, suppressing GST-π has not been found to shrink or reduce tumors. For example, in a cancer that was overexpressing GST-π, the weights of tumors were not affected by suppressing GST-π, although other effects were observed. See, e.g., Hokaiwado et al., Carcinogenesis, 2008, 29(6):1134-1138.
There is an urgent need for methods and compositions to develop therapies for patients with malignancies, such as siRNA sequences, compounds and structures for inhibition of expression of GST-π and p21.
What is needed are methods and compositions for preventing or treating malignant tumors. There is a continuing need for RNAi molecules, and other structures and compositions for preventing, treating, or reducing malignant tumors.
This invention relates to the fields of biopharmaceuticals and therapeutics composed of nucleic acid based molecules. More particularly, this invention relates to methods and compositions for delivering RNA interference agents for preventing, treating or ameliorating the effects of conditions and diseases involving malignant tumors.
This invention provides compositions and methods for RNAi molecules that are targeted to human GST-π, in combination with RNAi molecules targeted to human p21. The compositions include a pharmaceutically acceptable carrier.
This invention relates to molecules and compositions thereof for use in biopharmaceuticals and therapeutics for malignant tumors. More particularly, this invention relates to compounds, compositions and methods for providing nanoparticles to deliver and distribute active agents or drug compounds to cells, tissues, organs, and subjects having malignant tumors.
Included are methods for preventing, treating or ameliorating one or more symptoms of a malignant tumor in a subject in need. The method can involve administering to the subject an effective amount of a composition of RNAi molecules targeted to GST-π and p21.
Embodiments of this invention include the following:
A composition comprising RNAi molecules targeted to a human GST-π, RNAi molecules targeted to a human p21, and a pharmaceutically acceptable carrier. The RNAi molecules can contain a 2′-deoxynucleotide in one or more of positions 2 to 8 from the 3′ end of the antisense strand.
The carrier can include liposome nanoparticles that encapsulate the RNAi molecules. The liposome nanoparticles can encapsulate the RNAi molecules and retain at least 80% of the encapsulated RNAi molecules after 1 hour exposure to human serum. The liposome nanoparticles can have a size of 10 to 1000 nm, or 10 to 150 nm.
The composition can be active for treating malignant tumor, which may be located in any organ or tissue, including lung, colon, kidney, pancreas, liver, bone, skin, or intestine.
The liposome nanoparticles can be composed of an ionizable lipid, a structural lipid, one or more stabilizer lipids, and a lipid for reducing immunogenicity of the nanoparticles. The ionizable lipid can be selected from the group of compound 81, compound 71, compound 57, compound 84, compound 49, compound 76, compound 78, and compound 102.
This invention further contemplates methods for preventing, treating or ameliorating one or more symptoms of a malignant tumor in a subject in need. The method can involve administering to the subject an effective amount of a composition above.
In some embodiments, the malignant tumor may be associated with KRAS mutation, the method further comprising identifying a tumor cell in the subject, the tumor cell comprising at least one of: (i) a mutation of the KRAS gene, and (ii) an aberrant expression level of KRAS protein.
In certain embodiments, the malignant tumor can overexpress GST-π.
The RNAi molecules can decrease expression of GST-π and p21 in the subject. In some embodiments, the administration can decrease expression of GST-π and p21 in the subject by at least 5% for at least 5 days. The administration can decrease the volume of the malignant tumor in the subject by at least 5%, or at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%. The method may reduce one or more symptoms of the malignant tumor, or delays or terminates the progression of the malignant tumor.
In certain embodiments, the administration may reduce growth of malignant tumor cells in the subject. The administration can reduce growth for at least 2%, or at least 5%, or at least 10%, or at least 15%, or at least 20% of the malignant tumor cells in the subject.
In some aspects, the malignant tumor can be colon cancer, pancreatic cancer, kidney cancer, lung cancer, breast cancer, fibrosarcoma, lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas, or colorectal carcinoma.
Embodiments of this invention can provide methods where administration is performed from 1 to 12 times per day. The administration may be performed for a duration of 1, 2, 3, 4, 5, 6 or 7 days, or for a duration of 1, 2, 3, 4, 5, 6, 8, 10 or 12 weeks.
In some embodiments, the administration can be a dose of from 0.01 to 2 mg/kg of the RNAi molecules at least once per day for a period up to twelve weeks. In further embodiments, the administration can provide a mean AUC(0-last) of from 1 to 1000 ug*min/mL and a mean Cmax of from 0.1 to 50 ug/mL for the GST-π RNAi molecule. In certain embodiments, the administration may provide a mean AUC (0-last) of from 1 to 1000 ug*min/mL and a mean Cmax of from 0.1 to 50 ug/mL for the p21 RNAi molecule.
Methods of administration can be intravenous injection, intradermal injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, oral, topical, infusion, or inhalation.
The invention provides compounds and compositions for use in therapeutic combinations for delivery to malignant tumors. In some aspects, this invention relates to compounds, compositions and methods for providing nanoparticles to deliver and distribute active agents or drug compounds to malignant tumor cells, as well as tissues, organs, and subjects having malignant tumors.
This invention provides a range of ionizable compounds for delivering the active agents to cells of malignant tumors. Among other uses, the ionizable compounds of this invention can be used to form nanoparticles to deliver and distribute active agents for ameliorating malignant tumors.
Embodiments of this invention include a broad range of compounds having lipid-like properties, and such compounds can be used to deliver active agents for uptake to malignant tumor cells.
The compositions and methods of this invention can be used to distribute agents for suppressing gene expression. Examples of an agent for suppressing gene expression include inhibitory nucleic acid molecules, including ribozymes, anti-sense nucleic acids, and RNA interference molecules (RNAi molecules).
In another aspect, this invention provides methods for utilizing therapeutic compositions that decrease the expression of a GST-π nucleic acid molecule or polypeptide and a p21 nucleic acid molecule or polypeptide for the treatment of a neoplasia in a subject, wherein the neoplasia is associated with cells containing a KRAS mutation or displaying aberrant KRAS expression levels.
The therapeutic compositions of this invention can include inhibitory nucleic acid molecules such as siRNAs, shRNAs, and antisense RNAs, as well as DNA-directed RNAs (ddRNA), Piwi-interacting RNAs (piRNA), and repeat associated siRNAs (rasiRNA).
A KRAS-associated malignant tumor or KRAS-associated cancer is defined herein as (a) a cancer cell or tumor cell containing a somatic KRAS mutation, or (b) a cancer cell or tumor cell with an abnormal expression level of KRAS including, but not limited to, amplification of the KRAS encoding DNA, or over-expression of the KRAS gene, or under-expression of the KRAS gene when compared to level found in normal, non-cancer cells.
GST-π denotes an enzyme, which is encoded by the GSTP1 gene, and catalyzes glutathione conjugation. GST-π is present in various animals, including humans, and its sequence information is known and given in NCBI database accession numbers (e.g., human: NP_000843 (NM_000852), rat: NP_036709 (NM_012577), mouse: NP_038569 (NM_013541), etc.
This invention encompasses RNAi molecules for suppressing DNA encoding GST-π, ribozymes, antisense nucleic acids, DNA/RNA chimeric polynucleotides, and vectors for expressing them, and dominant negative variants of GST-π.
p21 is present in various animals including humans, and its sequence information is also publicly known (e.g., human: NM_000389.4, NM_078467.2, NM_001291549.1, NM_001220778.1, NM_001220777.1 (NP_001207707.1, NP_001278478.1, NP_001207706.1, NP_510867.1, NP_000380.1), etc.; the numbers represent accession numbers of the NCBI database, and the nucleotide sequence and the amino acid sequence are indicated outside and inside the parentheses, respectively). As one example, the nucleotide sequence of the human CDKN1A gene is registered in the database as NM_000389.4. As for p21, sequence information has been registered with a plurality of accession numbers as mentioned above, and a plurality of transcript variants are present.
This invention encompasses RNAi molecules for suppressing DNA encoding p21, ribozymes, antisense nucleic acids, DNA/RNA chimeric polynucleotides, and vectors for expressing them, and dominant negative variants of p21.
In general, after a subject is diagnosed as having a neoplasia, e.g., a lung cancer, kidney cancer or a pancreatic cancer, associated with a KRAS mutation or a KRAS amplification, a method of treatment involving suppression of GST-π and p21 is selected.
Examples of an agent that suppresses GST-π as used herein include a drug that suppresses GST-π production and/or activity, and a drug that promotes GST-π degradation and/or inactivation. Examples of the drug that suppresses GST-π production include an RNAi molecule, a ribozyme, an antisense nucleic acid, a DNA/RNA chimera polynucleotide for DNA encoding GST-π, or a vector expressing same.
Examples of an agent that suppresses p21 as used herein include a drug that suppresses p21 production and/or activity, and a drug that promotes p21 degradation and/or inactivation. Examples of the drug that suppresses p21 production include an RNAi molecule, a ribozyme, an antisense nucleic acid, a DNA/RNA chimera polynucleotide for DNA encoding p21, or a vector expressing same.
RNAi Molecules
One of ordinary skill in the art would understand that a reported sequence may change over time and to incorporate any changes needed in the nucleic acid molecules herein accordingly.
Embodiments of this invention can provide compositions and methods for gene silencing of GST-π expression using nucleic acid molecules.
Embodiments of this invention can provide compositions and methods for gene silencing of p21 expression using nucleic acid molecules.
Embodiments of this invention can provide compositions and methods for gene silencing of a combination of GST-π and p21 expression using nucleic acid molecules.
Examples of nucleic acid molecules capable of mediating RNA interference include molecules active in RNA interference (RNAi molecules), including a duplex RNA such as an siRNA (small interfering RNA), miRNA (micro RNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-interacting RNA), or rasiRNA (repeat associated siRNA), and modified forms thereof.
The composition and methods disclosed herein can also be used in treating various kinds of malignant tumors in a subject.
The nucleic acid molecules and methods of this invention may be pooled, or used in combination to down regulate the expression of genes that encode GST-π, and to down regulate the expression of genes that encode p21.
The compositions and methods of this invention can include one or more nucleic acid molecules, which in combination can modulate or regulate the expression of GST-π and p21 proteins and/or genes encoding the proteins, proteins and/or genes encoding the proteins that are associated with the maintenance and/or development of diseases, as well as conditions or disorders associated with GST-π and p21, such as malignant tumor.
The compositions and methods of this invention are described with reference to exemplary sequences of GST-π and p21. A person of ordinary skill in the art would understand that various aspects and embodiments of the invention are directed to any related GST-π or p21 genes, sequences, or variants, such as homolog genes and transcript variants, and polymorphisms, including single nucleotide polymorphism (SNP) associated with any GST-π or p21 genes.
In some embodiments, the compositions and methods of this invention can provide a double-stranded short interfering nucleic acid (siRNA) molecule that downregulates the expression of a GST-π gene, for example human GST-π. The compositions and methods of this invention further contemplate providing a double-stranded short interfering nucleic acid (siRNA) molecule that downregulates the expression of a p21 gene, for example human p21.
A RNAi molecule of this invention can be targeted to GST-π or p21, and any homologous sequences, for example, using complementary sequences or by incorporating non-canonical base pairs, for example, mismatches and/or wobble base pairs, that can provide additional target sequences.
In instances where mismatches are identified, non-canonical base pairs, for example, mismatches and/or wobble bases can be used to generate nucleic acid molecules that target more than one gene sequence.
For example, non-canonical base pairs such as UU and CC base pairs can be used to generate nucleic acid molecules that are capable of targeting sequences for differing targets that share sequence homology. Thus, a RNAi molecule can be targeted to a nucleotide sequence that is conserved between homologous genes, and a single RNAi molecule can be used to inhibit expression of more than one gene.
In some aspects, the compositions and methods of this invention include RNAi molecules that are active against any portion of GST-π mRNA. The RNAi molecule can include a sequence complementary to any mRNA encoding a GST-π sequence. This invention further contemplates compositions and methods including RNAi molecules that are active against any portion of p21 mRNA. The RNAi molecule can include a sequence complementary to any mRNA encoding a p21 sequence.
In some embodiments, a RNAi molecule of this disclosure can have activity against GST-π RNA, where the RNAi molecule includes a sequence complementary to an RNA having a variant GST-π encoding sequence, for example, a mutant GST-π gene known in the art to be associated with malignant tumor. In some embodiments, a RNAi molecule of this disclosure can have activity against p21 RNA, where the RNAi molecule includes a sequence complementary to an RNA having a variant p21 encoding sequence, for example, a mutant p21 gene known in the art to be associated with malignant tumor.
In further embodiments, a RNAi molecule of this invention can include a nucleotide sequence that can mediate silencing of GST-π gene expression. In further embodiments, a RNAi molecule of this invention can include a nucleotide sequence that can mediate silencing of p21 gene expression.
Examples of RNAi molecules of this invention targeted to GST-π mRNA are shown in Table 1.
Examples of RNAi molecules of this invention targeted to GST-π mRNA are shown in Table 2.
UAGGGUCUCAAAAGGCUUCUU
UAGGGUCUCAAAAGGCUUCUU
GAAGCCUUUUGAGACCCUAUU
GAAGCCUUUUGAGACCCUAUU
GAAGCCUUUUGAGACCCUAUU
UAGgGuCuCAAAAGGCUUCUU
GAAGCCUUUUGAGACCCUAUU
UAGgGuCuCAAAAGGCUUCUU
GAAGCCUUUUGAGACCCUAUU
UAGgGuCuCAAAAGGCUUCUU
GAAGCCUUUUGAGACCCUAUU
Examples of RNAi molecules of this invention targeted to GST-π mRNA are shown in Table 3.
CCUCAUCUACACCAACUAUUU
Examples of RNAi molecules of this invention targeted to GST-π mRNA are shown in Table 4.
GGAUGACUAUGUGAAGGCAUU
GGAUGACUAUGUGAAGGCAUU
GGAUGACUAUGUGAAGGCAUU
Examples of RNAi molecules of this invention targeted to GST-π mRNA are shown in Table 5.
GAAGCCUUUUGAGACCCUGUU
Examples of RNAi molecules of this invention targeted to GST-π mRNA are shown in Table 6.
CCUCAUCUACACCAACUAUUU
Examples of RNAi molecules of this invention targeted to p21 mRNA are shown in Table 7.
Examples of RNAi molecules of this invention targeted to p21 mRNA are shown in Table 8.
AAGGAGUCAGACAUUUUAAUU
AAGGAGUCAGACAUUUUAAUU
AAGGAGUCAGACAUUUUAAUU
AAGGAGUCAGACAUUUUAAUU
AAGGAGUCAGACAUUUUAAUU
AAGGAGUCAGACAUUUUAAUU
In some embodiments, this invention provides a range of nucleic acid molecules, where a) the molecule has a polynucleotide sense strand and a polynucleotide antisense strand; b) each strand of the molecule is from 15 to 30 nucleotides in length; c) a contiguous region of from 15 to 30 nucleotides of the antisense strand is complementary to a sequence of an mRNA encoding p21; and d) at least a portion of the sense strand is complementary to at least a portion of the antisense strand, and the molecule has a duplex region of from 15 to 30 nucleotides in length.
In some embodiments, the nucleic acid molecule can have a contiguous region of from 15 to 30 nucleotides of the antisense strand that is complementary to a sequence of an mRNA encoding p21, and is located in the duplex region of the molecule.
In additional embodiments, the nucleic acid molecule can have a contiguous region of from 15 to 30 nucleotides of the antisense strand that is complementary to a sequence of an mRNA encoding p21.
In further aspects, a nucleic acid molecule of this invention can have each strand of the molecule being from 18 to 22 nucleotides in length. A nucleic acid molecule can have a duplex region of 19 nucleotides in length.
In certain embodiments, a nucleic acid molecule can have a polynucleotide sense strand and the polynucleotide antisense strand that are connected as a single strand, and form a duplex region connected at one end by a loop.
The nucleic acid molecules of this invention can have a blunt end, and can have one or more 3′ overhangs.
The nucleic acid molecules of this invention can be RNAi molecules that are active for gene silencing, for example, a dsRNA that is active for gene silencing, a siRNA, a micro-RNA, or a shRNA active for gene silencing, as well as a DNA-directed RNA (ddRNA), a Piwi-interacting RNA (piRNA), and a repeat associated siRNA (rasiRNA).
This invention provides a range of nucleic acid molecules that are active for inhibiting expression of p21. In some embodiments, the nucleic acid molecule can have an IC50 for knockdown of p21 of less than 100 pM.
In additional embodiments, the nucleic acid molecule can have an IC50 for knockdown of p21 of less than 50 pM.
This invention further contemplates compositions containing one or more inventive nucleic acid molecules and a pharmaceutically acceptable carrier. The carrier can be a lipid molecule or liposome.
The compounds and compositions of this invention are useful in methods for preventing or treating a p21 associated disease, by administering a compound or composition to a subject in need.
In further aspects, this invention includes methods for treating a disease associated with p21 expression, by administering to a subject in need a composition containing one or more inventive nucleic acid molecules. The disease can be malignant tumor, which may be presented in a disease such as cancers associated with p21 expression, among others.
In some embodiments, this invention provides a range of nucleic acid molecules, wherein: a) the molecule has a polynucleotide sense strand and a polynucleotide antisense strand; b) each strand of the molecule is from 15 to 30 nucleotides in length; c) a contiguous region of from 15 to 30 nucleotides of the antisense strand is complementary to a sequence of an mRNA encoding GST-π; d) at least a portion of the sense strand is complementary to at least a portion of the antisense strand, and the molecule has a duplex region of from 15 to 30 nucleotides in length.
In some embodiments, the nucleic acid molecule can have contiguous region of from 15 to 30 nucleotides of the antisense strand that is complementary to a sequence of an mRNA encoding GST-π is located in the duplex region of the molecule.
In additional embodiments, the nucleic acid molecule can have a contiguous region of from 15 to 30 nucleotides of the antisense strand that is complementary to a sequence of an mRNA encoding GST-π.
In certain embodiments, each strand of the nucleic acid molecule can be from 18 to 22 nucleotides in length. The duplex region of the nucleic acid molecule can be 19 nucleotides in length.
In alternative forms, the nucleic acid molecule can have a polynucleotide sense strand and a polynucleotide antisense strand that are connected as a single strand, and form a duplex region connected at one end by a loop.
Some embodiments of a nucleic acid molecule of this disclosure can have a blunt end. In certain embodiments, a nucleic acid molecule can have one or more 3′ overhangs.
This invention provides a range of nucleic acid molecules that are RNAi molecules active for gene silencing. The inventive nucleic acid molecules can be a dsRNA, a siRNA, a micro-RNA, or a shRNA active for gene silencing, as well as a DNA-directed RNA (ddRNA), Piwi-interacting RNA (piRNA), or a repeat associated siRNA (rasiRNA). The nucleic acid molecules can be active for inhibiting expression of GST-π.
Embodiments of this invention further provide nucleic acid molecules having an IC50 for knockdown of GST-π of less than 100 pM.
Additional embodiments of this invention provide nucleic acid molecules having an IC50 for knockdown of GST-π of less than 50 pM.
This invention further contemplates compositions containing one or more of the inventive nucleic acid molecules, along with a pharmaceutically acceptable carrier. In certain embodiments, the carrier can be a lipid molecule or liposome.
The compounds and compositions of this invention are useful in methods for preventing or treating a GST-π associated disease, by administering a compound or composition to a subject in need.
As used herein, the RNAi molecule denotes any molecule that causes RNA interference, including a duplex RNA such as siRNA (small interfering RNA), miRNA (micro RNA), shRNA (short hairpin RNA), ddRNA (DNA-directed RNA), piRNA (Piwi-interacting RNA), or rasiRNA (repeat associated siRNA) and modified forms thereof. These RNAi molecules may be commercially available or may be designed and prepared based on known sequence information, etc. The antisense nucleic acid includes RNA, DNA, PNA, or a complex thereof. As used herein, the DNA/RNA chimera polynucleotide includes a double-strand polynucleotide composed of DNA and RNA that inhibits the expression of a target gene.
In one embodiment, the agents of this invention contain siRNA as a therapeutic agent. An siRNA molecule can have a length from about 10-50 or more nucleotides. An siRNA molecule can have a length from about 15-45 nucleotides. An siRNA molecule can have a length from about 19-40 nucleotides. An siRNA molecule can have a length of from 19-23 nucleotides. An siRNA molecule of this invention can mediate RNAi against a target mRNA. Commercially available design tools and kits, such as those available from Ambion, Inc. (Austin, Tex.), and the Whitehead Institute of Biomedical Research at MIT (Cambridge, Mass.) allow for the design and production of siRNA.
Methods for Treating Malignant Tumor
Embodiments of this invention can provide RNAi molecules that can be used to down regulate or inhibit the expression of GST-π and/or GST-π proteins, as well as RNAi molecules that can be used to down regulate or inhibit the expression of p21 and/or p21 proteins.
In some embodiments, a RNAi molecule of this invention can be used to down regulate or inhibit the expression of GST-π and/or GST-π proteins arising from GST-π haplotype polymorphisms that may be associated with a disease or condition such as malignant tumor. Embodiments of this invention further contemplate a RNAi molecule that can be used to down regulate or inhibit the expression of p21 and/or p21 proteins arising from p21 haplotype polymorphisms that may be associated with a disease or condition such as malignant tumor.
Monitoring of GST-π protein or mRNA levels, as well as p21 protein or mRNA levels can be used to characterize gene silencing, and to determine the efficacy of compounds and compositions of this invention.
The RNAi molecules of this disclosure can be used individually, or in combination with other siRNAs for modulating the expression of one or more genes.
The RNAi molecules of this disclosure can be used individually, or in combination, or in conjunction with other known drugs for preventing or treating diseases, or ameliorating symptoms of conditions or disorders associated with GST-π and p21, including malignant tumor.
The RNAi molecules of this invention can be used to modulate or inhibit the expression of GST-π in a sequence-specific manner. Also, RNAi molecules of this invention can be used to modulate or inhibit the expression of p21 in a sequence-specific manner.
The RNAi molecules of this disclosure can include a guide strand for which a series of contiguous nucleotides are at least partially complementary to a GST-π mRNA or a p21 mRNA.
In certain aspects, malignant tumor may be treated by RNA interference using a RNAi molecule of this invention. Treatment of malignant tumor may be characterized in suitable cell-based models, as well as ex vivo or in vivo animal models.
Treatment of malignant tumor may be characterized by determining the level of GST-π mRNA or the level of GST-π protein in cells of affected tissue. Treatment of malignant tumor may also be characterized by determining the level of p21 mRNA or the level of p21 protein in cells of affected tissue.
Treatment of malignant tumor may be characterized by non-invasive medical scanning of an affected organ or tissue.
Embodiments of this invention may include methods for preventing, treating, or ameliorating the symptoms of a disease or condition associated with GST-π and/or p21 in a subject in need thereof.
In some embodiments, methods for preventing, treating, or ameliorating the symptoms of malignant tumor in a subject can include administering to the subject a RNAi molecule of this invention to modulate the expression of a GST-π gene, and/or of a p21 gene in the subject or organism.
In some embodiments, this invention contemplates methods for down regulating the expression of a GST-π gene in a cell or organism, by contacting the cell or organism with a RNAi molecule of this invention. This invention further contemplates methods for down regulating the expression of a p21 gene in a cell or organism, by contacting the cell or organism with a RNAi molecule of this invention.
GST-π and p21 inhibitory nucleic acid molecules can be nucleotide oligomers that may be employed as single-stranded or double-stranded nucleic acid molecule to decrease gene expression. In one approach, the inhibitory nucleic acid molecule is a double-stranded RNA used for RNA interference (RNAi)-mediated knockdown of gene expression. In one embodiment, a double-stranded RNA (dsRNA) molecule that is active in RNA interference is made that includes from eight to twenty-five (e.g., 8, 10, 12, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25) consecutive nucleotides of a nucleotide oligomer of the invention. The dsRNA can be two complementary strands of RNA that have duplexed, or a single RNA strand that has self-duplexed (small hairpin (sh)RNA).
In some embodiments, dsRNAs that are active in RNA interference are about 21 or 22 base pairs, but may be shorter or longer, up to about 29 nucleotides. Double stranded RNA can be made using standard techniques, e.g., chemical synthesis or in vitro transcription. Kits are available, for example, from Ambion (Austin, Tex.) and Epicentre (Madison, Wis.).
Methods for expressing dsRNA in mammalian cells are described in Brummelkamp et al. Science 296:550-553, 2002; Paddison et al. Genes & Devel. 16:948-958, 2002; Paul et al. Nature Biotechnol. 20:505-508, 2002; Sui et al., Proc. Natl. Acad. Sci. USA 99:5515-5520, 2002; Yu et al. Proc. Natl. Acad. Sci. USA 99:6047-6052, 2002; Miyagishi et al., Nature Biotechnol. 20:497-500, 2002; and Lee et al., Nature Biotechnol. 20:500-505 2002, each of which is hereby incorporated by reference.
An inhibitory nucleic acid molecule that “corresponds” to a GST-π gene comprises at least a fragment of the double-stranded gene, such that each strand of the double-stranded inhibitory nucleic acid molecule is capable of binding to the complementary strand of the target GST-π gene. The inhibitory nucleic acid molecule need not have perfect correspondence to the reference GST-π sequence.
An inhibitory nucleic acid molecule that “corresponds” to a p21 gene comprises at least a fragment of the double-stranded gene, such that each strand of the double-stranded inhibitory nucleic acid molecule is capable of binding to the complementary strand of the target p21 gene. The inhibitory nucleic acid molecule need not have perfect correspondence to the reference p21 sequence.
In one embodiment, a siRNA has at least about 85%, 90%, 95%, 96%, 97%, 98%, or even 99% sequence identity with the target nucleic acid. For example, a 19 base pair duplex having 1-2 base pair mismatch is considered useful in the methods of the invention. In other embodiments, the nucleotide sequence of the inhibitory nucleic acid molecule exhibits 1, 2, 3, 4, 5 or more mismatches.
The inhibitory nucleic acid molecules provided by the invention are not limited to siRNAs, but include any nucleic acid molecule sufficient to decrease the expression of a GST-π or p21 nucleic acid molecule or polypeptide. The DNA sequences provided herein may be used, for example, in the discovery and development of therapeutic antisense nucleic acid molecule to decrease the expression of the encoded protein. The invention further provides catalytic RNA molecules or ribozymes. Such catalytic RNA molecules can be used to inhibit expression of a target nucleic acid molecule in vivo. The inclusion of ribozyme sequences within an antisense RNA confers RNA-cleaving activity upon the molecule, thereby increasing the activity of the constructs. The design and use of target RNA-specific ribozymes is described in Haseloff et al., Nature 334:585-591. 1988, and US 2003/0003469 A1, each of which is incorporated by reference.
In various embodiments of this invention, the catalytic nucleic acid molecule is formed in a hammerhead or hairpin motif. Examples of such hammerhead motifs are described by Rossi et al., Aids Research and Human Retroviruses, 8:183, 1992. Example of hairpin motifs are described by Hampel et al., Biochemistry, 28:4929, 1989, and Hampel et al., Nucleic Acids Research, 18: 299, 1990. Those skilled in the art will recognize that what is needed in an enzymatic nucleic acid molecule is a specific substrate binding site that is complementary to one or more of the target gene RNA regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart an RNA cleaving activity to the molecule.
Suppression of a target may be determined by the expression or activity of the corresponding protein in cells being suppressed, as compared to cells in which a suppressing agent is not utilized. Expression of protein may be evaluated by any known technique; examples thereof include an immunoprecipitation method utilizing an antibody, EIA, ELISA, IRA, IRMA, a western blot method, an immunohistochemical method, an immunocytochemical method, a flow cytometry method, various hybridization methods utilizing a nucleic acid that specifically hybridizes with a nucleic acid encoding the protein or a unique fragment thereof, or a transcription product (e.g., mRNA) or splicing product of said nucleic acid, a northern blot method, a Southern blot method, and various PCR methods.
The activity of the protein may be evaluated by analyzing a known activity of the protein including binding to a protein such as, for example, Raf-1 (in particular phosphorylated Raf-1) or EGFR (in particular phosphorylated EGFR) by means of any known method such as for example an immunoprecipitation method, a western blot method, amass analysis method, a pull-down method, or a surface plasmon resonance (SPR) method.
Examples of the mutated KRAS include, but are not limited to, those having a mutation that causes constant activation of KRAS, such as a mutation that inhibits endogenous GTPase or a mutation that increases the guanine nucleotide exchange rate. Specific examples of such mutation include, but are not limited to, for example, mutation in amino acids 12, 13 and/or 61 in human KRAS (inhibiting endogenous GTPase) and mutation in amino acids 116 and/or 119 in human KRAS (increasing guanine nucleotide exchange rate) (Bos, Cancer Res. 1989; 49 (17): 4682-9, Levi et al., Cancer Res. 1991; 51 (13): 3497-502).
In some embodiments of the present invention, the mutated KRAS can be a KRAS having a mutation in at least one of amino acids 12, 13, 61, 116, and 119 of human KRAS. In one embodiment of the present invention, the mutated KRAS has a mutation at amino acid 12 of human KRAS. In some embodiments, the mutated KRAS may be one that induces overexpression of GST-π. Cells having mutated KRAS may exhibit overexpression of GST-π.
Detection of mutated KRAS may be carried out using any known technique, e.g., selective hybridization by means of a nucleic acid probe specific to a known mutation sequence, an enzyme mismatch cleavage method, sequencing (Bos, Cancer Res. 1989; 49 (17): 4682-9), and a PCR-RFLP method (Miyanishi et al., Gastroenterology. 2001; 121 (4): 865-74).).
Detection of target expression may be carried out using any known technique. Whether or not the target is being overexpressed may be evaluated by for example comparing the degree of expression of the target in cells having mutated KRAS with the degree of expression of the target in the same type of cells having normal KRAS. In this situation, the target is being overexpressed if the degree of expression of the target in cells having mutated KRAS exceeds the degree of expression of the target in the same type of cells having normal KRAS.
In one aspect, the invention features a vector encoding an inhibitory nucleic acid molecule of any of the above aspects. In a particular embodiment, the vector is a retroviral, adenoviral, adeno-associated viral, or lentiviral vector. In another embodiment, the vector contains a promoter suitable for expression in a mammalian cell.
The amount of active RNA interference inducing ingredient formulated in the composition of the present invention may be an amount that does not cause an adverse effect exceeding the benefit of administration. Such an amount may be determined by an in vitro test using cultured cells, or a test in a model animal or mammal such as a mouse, a rat, a dog, or a pig, etc., and such test methods are known to those skilled in the art. The methods of this invention can be applicable to any animal, including humans.
The amount of active ingredient formulated can vary according to the manner in which the agent or composition is administered. For example, when a plurality of units of the composition is used for one administration, the amount of active ingredient to be formulated in one unit of the composition may be determined by dividing the amount of active ingredient necessary for one administration by said plurality of units.
This invention also relates to a process for producing an agent or composition for suppressing GST-π and p21, and the use of a composition that suppresses GST-π and p21 for reducing or shrinking malignant tumors.
RNA Interference
RNA interference (RNAi) refers to sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs). See, e.g., Zamore et al., Cell, 2000, Vol. 101, pp. 25-33; Fire et al., Nature, 1998, Vol. 391, pp. 806811; Sharp, Genes & Development, 1999, Vol. 13, pp. 139-141.
An RNAi response in cells can be triggered by a double stranded RNA (dsRNA), although the mechanism is not yet fully understood. Certain dsRNAs in cells can undergo the action of Dicer enzyme, a ribonuclease III enzyme. See, e.g., Zamore et al., Cell, 2000, Vol. 101, pp. 25-33; Hammond et al., Nature, 2000, Vol. 404, pp. 293-296. Dicer can process the dsRNA into shorter pieces of dsRNA, which are siRNAs.
In general, siRNAs can be from about 21 to about 23 nucleotides in length and include a base pair duplex region about 19 nucleotides in length.
RNAi involves an endonuclease complex known as the RNA induced silencing complex (RISC). An siRNA has an antisense or guide strand which enters the RISC complex and mediates cleavage of a single stranded RNA target having a sequence complementary to the antisense strand of the siRNA duplex. The other strand of the siRNA is the passenger strand. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex See, e.g., Elbashir et al., Genes & Development, 2001, Vol. 15, pp. 188-200.
As used herein, the term “sense strand” refers to a nucleotide sequence of a siRNA molecule that is partially or fully complementary to at least a portion of a corresponding antisense strand of the siRNA molecule. The sense strand of a siRNA molecule can include a nucleic acid sequence having homology with a target nucleic acid sequence.
As used herein, the term “antisense strand” refers to a nucleotide sequence of a siRNA molecule that is partially or fully complementary to at least a portion of a target nucleic acid sequence. The antisense strand of a siRNA molecule can include a nucleic acid sequence that is complementary to at least a portion of a corresponding sense strand of the siRNA molecule.
RNAi molecules can down regulate or knock down gene expression by mediating RNA interference in a sequence-specific manner. See, e.g., Zamore et al., Cell, 2000, Vol. 101, pp. 25-33; Elbashir et al., Nature, 2001, Vol. 411, pp. 494-498; Kreutzer et al., WO2000/044895; Zernicka-Goetz et al., WO2001/36646; Fire et al., WO1999/032619; Plaetinck et al., WO2000/01846; Mello et al., WO2001/029058.
As used herein, the terms “inhibit,” “down-regulate,” or “reduce” with respect to gene expression means that the expression of the gene, or the level of mRNA molecules encoding one or more proteins, or the activity of one or more of the encoded proteins is reduced below that observed in the absence of a RNAi molecule or siRNA of this invention. For example, the level of expression, level of mRNA, or level of encoded protein activity may be reduced by at least 1%, or at least 10%, or at least 20%, or at least 50%, or at least 90%, or more from that observed in the absence of a RNAi molecule or siRNA of this invention.
RNAi molecules can also be used to knock down viral gene expression, and therefore affect viral replication.
RNAi molecules can be made from separate polynucleotide strands: a sense strand or passenger strand, and an antisense strand or guide strand. The guide and passenger strands are at least partially complementary. The guide strand and passenger strand can form a duplex region having from about 15 to about 49 base pairs.
In some embodiments, the duplex region of a siRNA can have 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 25 47, 48, or 49 base pairs.
In certain embodiments, a RNAi molecule can be active in a RISC complex, with a length of duplex region active for RISC.
In additional embodiments, a RNAi molecule can be active as a Dicer substrate, to be converted to a RNAi molecule that can be active in a RISC complex.
In some aspects, a RNAi molecule can have complementary guide and passenger sequence portions at opposing ends of a long molecule, so that the molecule can form a duplex region with the complementary sequence portions, and the strands are linked at one end of the duplex region by either nucleotide or non-nucleotide linkers. For example, a hairpin arrangement, or a stem and loop arrangement. The linker interactions with the strands can be covalent bonds or non-covalent interactions.
A RNAi molecule of this disclosure may include a nucleotide, non-nucleotide, or mixed nucleotide/non-nucleotide linker that joins the sense region of the nucleic acid to the antisense region of the nucleic acid. A nucleotide linker can be a linker of ≥2 nucleotides in length, for example about 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. The nucleotide linker can be a nucleic acid aptamer. By “aptamer” or “nucleic acid aptamer” as used herein refers to a nucleic acid molecule that binds specifically to a target molecule wherein the nucleic acid molecule has sequence that includes a sequence recognized by the target molecule in its natural setting. Alternately, an aptamer can be a nucleic acid molecule that binds to a target molecule, where the target molecule does not naturally bind to a nucleic acid. For example, the aptamer can be used to bind to a ligand-binding domain of a protein, thereby preventing interaction of the naturally occurring ligand with the protein. See, e.g., Gold et al., Annu Rev Biochem, 1995, Vol. 64, pp. 763-797; Brody et al., J. Biotechnol., 2000, Vol. 74, pp. 5-13; Hermann et al., Science, 2000, Vol. 287, pp. 820-825.
Examples of a non-nucleotide linker include an abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other polymeric compounds, for example polyethylene glycols such as those having from 2 to 100 ethylene glycol units. Some examples are described in Seela et al., Nucleic Acids Research, 1987, Vol. 15, pp. 3113-3129; Cload et al., J. Am. Chem. Soc., 1991, Vol. 113, pp. 6324-6326; Jaeschke et al., Tetrahedron Lett., 1993, Vol. 34, pp. 301; Arnold et al., WO1989/002439; Usman et al., WO1995/006731; Dudycz et al., WO1995/011910, and Ferentz et al., J. Am. Chem. Soc., 1991, Vol. 113, pp. 4000-4002.
A RNAi molecule can have one or more overhangs from the duplex region. The overhangs, which are non-base-paired, single strand regions, can be from one to eight nucleotides in length, or longer. An overhang can be a 3′-end overhang, wherein the 3′-end of a strand has a single strand region of from one to eight nucleotides. An overhang can be a 5′-end overhang, wherein the 5′-end of a strand has a single strand region of from one to eight nucleotides.
The overhangs of a RNAi molecule can have the same length, or can be different lengths.
A RNAi molecule can have one or more blunt ends, in which the duplex region ends with no overhang, and the strands are base paired to the end of the duplex region.
A RNAi molecule of this disclosure can have one or more blunt ends, or can have one or more overhangs, or can have a combination of a blunt end and an overhang end.
A 5′-end of a strand of a RNAi molecule may be in a blunt end, or can be in an overhang. A 3′-end of a strand of a RNAi molecule may be in a blunt end, or can be in an overhang.
A 5′-end of a strand of a RNAi molecule may be in a blunt end, while the 3′-end is in an overhang. A 3′-end of a strand of a RNAi molecule may be in a blunt end, while the 5′-end is in an overhang.
In some embodiments, both ends of a RNAi molecule are blunt ends.
In additional embodiments, both ends of a RNAi molecule have an overhang.
The overhangs at the 5′- and 3′-ends may be of different lengths.
In certain embodiments, a RNAi molecule may have a blunt end where the 5′-end of the antisense strand and the 3′-end of the sense strand do not have any overhanging nucleotides.
In further embodiments, a RNAi molecule may have a blunt end where the 3′-end of the antisense strand and the 5′-end of the sense strand do not have any overhanging nucleotides.
A RNAi molecule may have mismatches in base pairing in the duplex region.
Any nucleotide in an overhang of a RNAi molecule can be a deoxyribonucleotide, or a ribonucleotide.
One or more deoxyribonucleotides may be at the 5′-end, where the 3′-end of the other strand of the RNAi molecule may not have an overhang, or may not have a deoxyribonucleotide overhang.
One or more deoxyribonucleotides may be at the 3′-end, where the 5′-end of the other strand of the RNAi molecule may not have an overhang, or may not have a deoxyribonucleotide overhang.
In some embodiments, one or more, or all of the overhang nucleotides of a RNAi molecule may be 2′-deoxyribonucleotides.
Dicer Substrate RNAi Molecules
In some aspects, a RNAi molecule can be of a length suitable as a Dicer substrate, which can be processed to produce a RISC active RNAi molecule. See, e.g., Rossi et al., US2005/0244858.
A double stranded RNA (dsRNA) which is a Dicer substrate can be of a length sufficient such that it is processed by Dicer to produce an active RNAi molecule, and may further include one or more of the following properties: (i) the Dicer substrate dsRNA can be asymmetric, for example, having a 3′ overhang on the antisense strand, and (ii) the Dicer substrate dsRNA can have a modified 3′ end on the sense strand to direct orientation of Dicer binding and processing of the dsRNA to an active RNAi molecule.
Methods of Use of RNAi Molecules
The nucleic acid molecules and RNAi molecules of this invention may be delivered to a cell or tissue by direct application of the molecules, or with the molecules combined with a carrier or a diluent.
The nucleic acid molecules and RNAi molecules of this invention can be delivered or administered to a cell, tissue, organ, or subject by direct application of the molecules with a carrier or diluent, or any other delivery vehicle that acts to assist, promote or facilitate entry into a cell, for example, viral sequences, viral material, or lipid or liposome formulations.
The nucleic acid molecules and RNAi molecules of this invention can be complexed with cationic lipids, packaged within liposomes, or otherwise delivered to target cells or tissues. The nucleic acid or nucleic acid complexes can be locally administered to relevant tissues ex vivo, or in vivo through direct dermal application, transdermal application, or injection.
Delivery systems may include, for example, aqueous and nonaqueous gels, creams, emulsions, microemulsions, liposomes, ointments, aqueous and nonaqueous solutions, lotions, aerosols, hydrocarbon bases and powders, and can contain excipients such as solubilizers and permeation enhancers.
A inhibitory nucleic acid molecule or composition of this invention may be administered within a pharmaceutically-acceptable diluents, carrier, or excipient, in unit dosage form. Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer the compounds to patients suffering from a disease that is caused by excessive cell proliferation. Administration may begin before the patient is symptomatic. Any appropriate route of administration may be employed, for example, administration may be parenteral, intravenous, intraarterial, subcutaneous, intratumoral, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intrahepatic, intracapsular, intrathecal, intracisternal, intraperitoneal, intranasal, aerosol, suppository, or oral administration. For example, therapeutic formulations may be in the form of liquid solutions or suspensions; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.
Compositions and methods of this disclosure can include an expression vector that includes a nucleic acid sequence encoding at least one RNAi molecule of this invention in a manner that allows expression of the nucleic acid molecule.
The nucleic acid molecules and RNAi molecules of this invention can be expressed from transcription units inserted into DNA or RNA vectors. Recombinant vectors can be DNA plasmids or viral vectors. Viral vectors can be used that provide for transient expression of nucleic acid molecules.
For example, the vector may contain sequences encoding both strands of a RNAi molecule of a duplex, or a single nucleic acid molecule that is self-complementary and thus forms a RNAi molecule. An expression vector may include a nucleic acid sequence encoding two or more nucleic acid molecules.
A nucleic acid molecule may be expressed within cells from eukaryotic promoters. Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector.
In some aspects, a viral construct can be used to introduce an expression construct into a cell, for transcription of a dsRNA construct encoded by the expression construct, where the dsRNA is active in RNA interference.
Lipid formulations can be administered to animals by intravenous, intramuscular, or intraperitoneal injection, or orally or by inhalation or other methods as are known in the art.
Pharmaceutically acceptable formulations for administering oligonucleotides are known and can be used.
In one embodiment of the above method, the inhibitory nucleic acid molecule is administered at a dosage of about 5 to 500 mg/m2/day, e.g., 5, 25, 50, 100, 125, 150, 175, 200, 225, 250, 275, or 300 mg/m2/day.
In some embodiments, the inhibitory nucleic acid molecules of this invention are administered systemically in dosages from about 1 to 100 mg/kg, e.g., 1, 5, 10, 20, 25, 50, 75, or 100 mg/kg.
In further embodiments, the dosage can range from about 25 to 500 mg/m2/day.
Methods known in the art for making formulations are found, for example, in “Remington: The Science and Practice of Pharmacy” Ed. A. R. Gennaro, Lippincourt Williams & Wilkins, Philadelphia, Pa., 2000.
Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for inhibitory nucleic acid molecules include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
The formulations can be administered to human patients in therapeutically effective amounts (e.g., amounts which prevent, eliminate, or reduce a pathological condition) to provide therapy for a neoplastic disease or condition. The preferred dosage of a nucleotide oligomer of the invention can depend on such variables as the type and extent of the disorder, the overall health status of the particular patient, the formulation of the compound excipients, and its route of administration.
All of the above methods for reducing malignant tumors may be either an in vitro method or an in vivo method. Dosage may be determined by an in vitro test using cultured cells, etc., as is known in the art. An effective amount may be an amount that reduces tumor size in KRAS associated tumors by at least 10%, at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, up to 100% of the tumor size.
A pharmaceutical composition of this invention can be effective in treating a KRAS associated disease. Examples of the diseases include a disease due to abnormal cell proliferation, a disease due to KRAS mutation, and a disease due to GST-π overexpression.
Examples of the disease due to abnormal cell proliferation include malignant tumors, hyperplasia, keloid, Cushing's syndrome, primary aldosteronism, erythroplakia, polycythemia vera, leukoplakia, hyperplastic scar, lichen planus, and lentiginosis.
Examples of the disease due to KRAS mutation include malignant tumor (also called a cancer or a malignant neoplasm).
Examples of the disease due to GST-π overexpression include malignant tumor.
Examples of cancer include sarcomas such as fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, angiosarcoma, Kaposi's sarcoma, lymphangiosarcoma, synovial sarcoma, chondrosarcoma, and osteosarcoma, carcinomas such as brain tumor, head and neck carcinoma, breast carcinoma, lung carcinoma, esophageal carcinoma, gastric carcinoma, duodenal carcinoma, appendiceal carcinoma, colon carcinoma, rectal carcinoma, liver carcinoma, kidney carcinoma, pancreatic carcinoma, gall bladder carcinoma, bile duct carcinoma, renal carcinoma, ureteral carcinoma, bladder carcinoma, prostate carcinoma, testicular carcinoma, uterine carcinoma, ovarian carcinoma, skin carcinoma, leukemia, and malignant lymphoma.
Cancer includes epithelial malignancy and non-epithelial malignancy. A cancer can be present at any site of the body.
In one embodiment of the present invention, the cancer includes cancer cells having the mutated KRAS defined above. In another embodiment, the cancer includes cancer cells that exhibit hormone- or growth factor-independent proliferation. In further embodiments, a cancer includes cancer cells exhibiting GST-π overexpression.
Additional Active Agents or Drugs for Suppressing GST-π
Examples of additional active agents for inhibiting the activity of GST-pi include, but are not limited to, substances binding to GST-pi, for example, glutathione, glutathione analogs (e.g., those described in WO95/08563, WO96/40205, WO99/54346), ketoprofen, indomethacin (see, e.g., Hall et al., Cancer Res. 1989; 49 (22): 6265-8), ethacrynic acid, piriprost (see, e.g., Tew et al., Cancer Res. 1988; 48 (13): 3622-5), anti-GST-pi antibodies, and dominant negative mutants of GST-π. These agents are either commercially available or can be appropriately produced on the basis of publicly known techniques.
Formulations with Three Components for Delivery of Agents in Malignant Tumor
As used herein, a component of a formulation, such as a “lipid,” can be a single compound, or can be a combination of one or more suitable lipid compounds. For example, “a stabilizer lipid” can refer to a single stabilizer lipid, or to a combination of one or more suitable stabilizer lipids. One skilled in the art can readily appreciate that certain combinations of the compounds described herein can be used without undue experimentation, and that various combinations of compounds are encompassed by the description of a component of a formulation.
This invention can provide a composition for use in distributing an active agent in cells, tissues or organs, organisms, and subjects, where the composition includes one or more ionizable lipid molecules of this invention.
Compositions of this invention may include one or more of the ionizable lipid molecules, along with a structural lipid, and one or more lipids for reducing immunogenicity of the nanoparticles.
An ionizable lipid molecule of this invention can be any mol % of a composition of this invention.
The ionizable lipid molecules of a composition of this invention can be from 50 mol % to 80 mol % of the lipid components of the composition. In certain embodiments, the ionizable lipid molecules of a composition can be from 55 mol % to 65 mol % of the lipid components of the composition. In further embodiments, the ionizable lipid molecules of a composition can be about 60 mol % of the lipid components of the composition.
The structural lipid of a composition of this invention can be from 20 mol % to 50 mol % of the lipid components of the composition. In certain embodiments, the structural lipid of a composition can be from 35 mol % to 45 mol % of the lipid components of the composition.
The one or more lipids for reducing immunogenicity of the nanoparticles can be from a total of 1 mol % to 8 mol % of the lipid components of the composition. In certain embodiments, the one or more lipids for reducing immunogenicity of the nanoparticles can be from a total of 1 mol % to 5 mol % of the lipid components of the composition.
In additional aspects, a composition of this invention can further include a cationic lipid, which can be from 5 mol % to 25 mol % of the lipid components of the composition. In certain embodiments, a composition of this invention can further include a cationic lipid, which can be from 5 mol % to 15 mol % of the lipid components of the composition. In these aspects, the molar ratio of the concentrations of the cationic lipid to the ionizable lipid molecules of a composition of this invention can be from 5:80 to 25:50.
In compositions of this invention, the entirety of the lipid components may include one or more of the ionizable lipid molecular components, one or more structural lipids, and one or more lipids for reducing immunogenicity of the nanoparticles.
Formulations with Four Components for Delivery of Agents in Malignant Tumor
This invention can provide a composition for use in distributing an active agent in cells, tissues or organs, organisms, and subjects, where the composition includes one or more ionizable lipid molecules of this invention.
Compositions of this invention may include one or more of the ionizable lipid molecules, along with a structural lipid, one or more stabilizer lipids, and one or more lipids for reducing immunogenicity of the nanoparticles.
An ionizable lipid molecule of this invention can be any mol % of a composition of this invention.
The ionizable lipid molecules of a composition of this invention can be from 15 mol % to 40 mol % of the lipid components of the composition. In certain embodiments, the ionizable lipid molecules of a composition can be from 20 mol % to 35 mol % of the lipid components of the composition. In further embodiments, the ionizable lipid molecules of a composition can be from 25 mol % to 30 mol % of the lipid components of the composition.
The structural lipid of a composition of this invention can be from 25 mol % to 40 mol % of the lipid components of the composition. In certain embodiments, the structural lipid of a composition can be from 30 mol % to 35 mol % of the lipid components of the composition.
The sum of the stabilizer lipids of a composition of this invention can be from 25 mol % to 40% mol % of the lipid components of the composition. In certain embodiments, the sum of the stabilizer lipids of a composition can be from 30 mol % to 40 mol % of the lipid components of the composition.
In some embodiments, a composition of this invention can include two or more stabilizer lipids, where each of the stabilizer lipids individually can be from 5 mol % to 35 mol % of the lipid components of the composition. In certain embodiments, a composition of this invention can include two or more stabilizer lipids, where each of the stabilizer lipids individually can be from 10 mol % to 30 mol % of the lipid components of the composition.
In certain embodiments, the sum of the one or more stabilizer lipids can be from 25 mol % to 40 mol % of the lipids of the composition, wherein each of the stabilizer lipids individually can be from 5 mol % to 35% mol %.
In certain embodiments, the sum of the one or more stabilizer lipids can be from 30 mol % to 40 mol % of the lipids of the composition, wherein each of the stabilizer lipids individually can be from 10 mol % to 30% mol %.
The one or more lipids for reducing immunogenicity of the nanoparticles can be from a total of 1 mol % to 8 mol % of the lipid components of the composition. In certain embodiments, the one or more lipids for reducing immunogenicity of the nanoparticles can be from a total of 1 mol % to 5 mol % of the lipid components of the composition.
In additional aspects, a composition of this invention can further include a cationic lipid, which can be from 5 mol % to 25 mol % of the lipid components of the composition. In certain embodiments, a composition of this invention can further include a cationic lipid, which can be from 5 mol % to 15 mol % of the lipid components of the composition. In these aspects, the molar ratio of the concentrations of the cationic lipid to the ionizable lipid molecules of a composition of this invention can be from 5:35 to 25:15.
In compositions of this invention, the entirety of the lipid components may include one or more of the ionizable lipid molecular components, one or more structural lipids, one or more stabilizer lipids, and one or more lipids for reducing immunogenicity of the nanoparticles.
Examples of Lipid Compositions
In some embodiments, three lipid-like components, i.e. one or more ionizable molecules, a structural lipid, and one or more lipids for reducing immunogenicity of the nanoparticles can be 100% of the lipid components of the composition. In certain embodiments, a cationic lipid can be included.
Examples of compositions of this invention are shown in Table 9.
In certain embodiments, the four lipid-like components, i.e. one or more ionizable lipid molecules, a structural lipid, one or more stabilizer lipids, and one or more lipids for reducing immunogenicity of the nanoparticles, can be 100% of the lipid components of the composition.
Examples of compositions of this invention are shown in Table 10.
Ionizable Lipid-Like Molecules
Examples of on ionizable lipid include compounds having the structure shown in Formula I
wherein R1 and R2 are
R1=CH2(CH2)nOC(═O)R4
R2=CH2(CH2)mOC(═0)R5
wherein n and m are from 1 to 2; and R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group having from zero to two double bonds;
wherein R3 is selected from
wherein
R6 is selected from H, alkyl, hydroxyalkyl, alkoxy, alkoxyalkoxy, aminoalkyl;
R7 is selected from H, alkyl, hydroxyalkyl;
Q is O or NR7; ps is from 1 to 4.
Examples of on ionizable lipid include the following compound:
which is ((2-((3S,4R)-3,4-dihydroxypyrrolidin-1-yl)acetyl)azanediyl)bis(ethane-2,1-diyl) (9Z,9′Z,12Z,12′Z)-bis(octadeca-9,12-dienoate).
Examples of on ionizable lipid include the following compound:
which is ((2-(3-(hydroxymethyl)azetidin-1-yl)acetyl)azanediyl)bis(ethane-2,1-diyl) ditetradecanoate.
Examples of on ionizable lipid include the following compound:
which is ((2-(4-(2-hydroxyethyl)piperazin-1-yl)acetyl)azanediyl)bis(ethane-2,1-diyl) (9Z,9′Z,12Z,12′Z)-bis(octadeca-9,12-dienoate).
Examples of on ionizable lipid include the following compound:
which is ((2-(4-(2-hydroxyethyl)piperazin-1-yl)acetyl)azanediyl)bis(ethane-2,1-diyl) (9Z,9′Z,12Z,12′Z)-bis(octadeca-9,12-dienoate).
Examples of on ionizable lipid include compounds having the structure shown in Formula IV
wherein R1 and R2 are
R1=C(═O)OR4
R2=C(═O)OR5
wherein R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group having from zero to two double bonds;
wherein R3 is selected from
wherein
R6 is selected from H, alkyl, hydroxyalkyl, alkoxy, alkoxyalkoxy, aminoalkyl;
R7 is selected from H, alkyl, hydroxyalkyl;
Q is O or NR7;
p is from 1 to 4.
Examples of on ionizable lipid include the following compound:
which is 2-((1-(((9Z,12Z)-heptadeca-9,12-dien-1-yl)oxy)-5-(((9Z,12Z)-octadeca-9,12-dien-1-yl)oxy)-1,5-dioxopentan-3-yl)amino)-N,N,N-trimethyl-2-oxoethan-1-aminium.
Examples of on ionizable lipid include compounds having the structure shown in Formula VI
wherein R1 is
R1=OC(═O)R4
wherein R2 and R4 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group having from zero to two double bonds;
wherein R3 is selected from aminoalkyl, quaternary aminoalkyl.
Examples of on ionizable lipid include the following compound:
which is 2-((9Z,12Z)—N-(3-(dimethylamino)propyl)octadeca-9,12-dienamido)ethyl (9Z,12Z)-octadeca-9,12-dienoate.
Examples of on ionizable lipid include the following compound:
which is N,N,N-trimethyl-3-((9Z,12Z)—N-(2-(((9Z,12Z)octadeca-9,12-dienoyl)oxy)ethyl)octadeca-9,12-dienamido)propan-1-aminium.
Examples of on ionizable lipid include compounds having the structure shown in Formula IX
wherein R1 and R2 are
R1=C(═O)OR4
R2=NHC(═O)R5
wherein R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group having from zero to two double bonds;
wherein r is from 1 to 4;
wherein R3 is selected from
wherein
R6 is selected from H, alkyl, hydroxyalkyl, alkoxy, alkoxyalkoxy, aminoalkyl;
R7 is selected from H, alkyl, hydroxyalkyl;
Q is O or NR7.
Examples of on ionizable lipid include the following compound:
which is N,N,N-trimethyl-2-(((S)-3-(((9Z,12Z)-octadeca-9,12-dien-1-yl)oxy)-2-((9Z,12Z)-octadeca-9,12-dienamido)-3-oxopropyl)amino)-2-oxoethan-1-aminium.
Examples of on ionizable lipid molecule include compounds having the structure shown in Formula III
wherein R1 and R2 are
R1=CH2(CH2)nOC(═O)R4
R2=CH2(CH2)mOC(═O)R5
wherein n and m are from 1 to 2; and R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group;
wherein R3 is selected from alkyl, hydroxyalkyl, alkoxyalkoxy, and carboxyalkyl;
wherein R6 is selected from NR72, N+HR72 and N+R73;
wherein R7 is selected from H, alkyl, hydroxyalkyl.
Examples of on ionizable lipid molecule include compounds having the structure shown in Formula IV-B
wherein R1 and R2 are
R1=C(═O)OR4
R2=C(═O)OR5
wherein R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group;
wherein Z is S or O;
wherein R3 is selected from
wherein
each R6 is independently selected from H, alkyl, hydroxyalkyl, alkoxy, alkoxyalkoxy, aminoalkyl;
R7 is selected from H, alkyl, hydroxyalkyl;
p is from 1 to 4.
Examples of on ionizable lipid molecule include compounds having the structure shown in Formula V
wherein R1 and R2 are
R1=NHC(═O)R4
R2=C(═O)OR5
wherein R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group;
wherein p is from 1 to 4;
wherein R3 is selected from
wherein
each R6 is independently selected from H, alkyl, hydroxyalkyl, alkoxy, alkoxyalkoxy, aminoalkyl;
R7 is selected from H, alkyl, hydroxyalkyl;
Q is O or NR7.
Examples of on ionizable lipid molecule include compounds having the structure shown in Formula VII
wherein R1 and R2 are
R1=CH2(CH2)nOC(═O)R4
R2=CH2(CH2)mOC(═O)R5
wherein n and m are from 1 to 2; and R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group;
wherein R3 is selected from aminoalkyl, quaternary aminoalkyl, alkoxyalkyl, alkoxyalkoxyalkyl.
Examples of on ionizable lipid molecule include compounds having the structure shown in Formula VIII
wherein R1 and R2 are
R1=OC(═O)R4
R2=C(═O)ZR5
wherein Z is NH or O,
wherein R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group;
wherein R3 is selected from
NHC(═O)(CH2)pR8;
NHC(═O)SR9;
wherein R8 is selected from
wherein R9 is selected from
Examples of on ionizable lipid molecule include compounds having the structure shown in Formula VIII-B
wherein R1 and R2 are
R1=CH2(CH2)nOC(═O)R4
R2=CH2(CH2)mOC(═O)R5
wherein n and m are from 1 to 2;
R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group;
wherein Z is N, O;
wherein R3 is selected from
wherein
each R6 is independently selected from H, alkyl, hydroxyalkyl, alkoxy, alkoxyalkoxy, aminoalkyl;
R7 is selected from H, alkyl, hydroxyalkyl;
p is from 1 to 4.
Examples of on ionizable lipid molecule include compounds having the structure shown in Formula X
wherein R1 and R2 are
R1=C(═O)OR4
R2=NHC(═O)R5
wherein R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group;
wherein R3 is selected from
Examples of on ionizable lipid molecule include compounds having the structure shown in Formula XI
wherein R1 and R2 are
R1=C(═O)R4
R2=C(═O)OR5
wherein R4 and R5 are independently for each occurrence a C(12-20) alkyl group, or a C(12-20) alkenyl group;
wherein p is from 1 to 4;
wherein R3 is selected from
wherein
each R6 is independently selected from H, alkyl, hydroxyalkyl, alkoxy, alkoxyalkoxy, aminoalkyl;
R7 is selected from H, alkyl;
Q is O or NR7.
Structural Lipids
Examples of structural lipids include cholesterols, sterols, and steroids.
Examples of structural lipids include cholanes, cholestanes, ergostanes, campestanes, poriferastanes, stigmastanes, gorgostanes, lanostanes, gonanes, estranes, androstans, pregnanes, and cycloartanes.
Examples of structural lipids include sterols and zoosterols such as cholesterol, lanosterol, zymosterol, zymostenol, desmosterol, stigmastanol, dihydrolanosterol, and 7-dehydrocholesterol.
Examples of structural lipids include pegylated cholesterols, and cholestane 3-oxo-(C1-22)acyl compounds, for example, cholesteryl acetate, cholesteryl arachidonate, cholesteryl butyrate, cholesteryl hexanoate, cholesteryl myristate, cholesteryl palmitate, cholesteryl behenate, cholesteryl stearate, cholesteryl caprylate, cholesteryl n-decanoate, cholesteryl dodecanoate, cholesteryl nervonate, cholesteryl pelargonate, cholesteryl n-valerate, cholesteryl oleate, cholesteryl elaidate, cholesteryl erucate, cholesteryl heptanoate, cholesteryl linolelaidate, and cholesteryl linoleate.
Examples of structural lipids include sterols such as phytosterols, beta-sitosterol, campesterol, ergosterol, brassicasterol, delta-7-stigmasterol, and delta-7-avenasterol.
Stabilizer Lipids
Examples of stabilizer lipids include zwitterionic lipids.
Examples of stabilizer lipids include compounds such as phospholipids.
Examples of phospholipids include phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine and ordilinoleoylphosphatidylcholine.
Examples of stabilizer lipids include phosphatidyl ethanolamine compounds and phosphatidyl choline compounds.
Examples of stabilizer lipids include 1,2-Dioleoyl-sn-Glycero-3-Phosphocholine (DOPC).
Examples of stabilizer lipids include diphytanoyl phosphatidyl ethanolamine (DPhPE) and 1,2-Diphytanoyl-sn-Glycero-3-Phosphocholine (DPhPC).
Examples of stabilizer lipids include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).
Examples of stabilizer lipids include 1,2-dilauroyl-sn-glycerol (DLG); 1,2-dimyristoyl-sn-glycerol (DMG); 1,2-dipalmitoyl-sn-glycerol (DPG); 1,2-distearoyl-sn-glycerol (DSG); 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DAPC); 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC); 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC); 1,2-dipalmitoyl-sn-glycero-O-ethyl-3-phosphocholine (DPePC); 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE); 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE); 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE); 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphocholine; 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC); 1-palmitoyl-2-lyso-sn-glycero-3-phosphocholine (P-Lyso-PC); and 1-Stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-Lyso-PC).
Lipids for Reducing Immunogenicity
Examples of lipids for reducing immunogenicity include polymeric compounds and polymer-lipid conjugates.
Examples of lipids for reducing immunogenicity include pegylated lipids having polyethyleneglycol (PEG) regions. The PEG regions can be of any molecular mass. In some embodiments, a PEG region can have a molecular mass of 200, 300, 350, 400, 500, 550, 750, 1000, 1500, 2000, 3000, 3500, 4000 or 5000 Da.
Examples of lipids for reducing immunogenicity include compounds having a methoxypolyethyleneglycol region.
Examples of lipids for reducing immunogenicity include compounds having a carbonyl-methoxypolyethyleneglycol region.
Examples of lipids for reducing immunogenicity include compounds having a multi-branched PEG region.
Examples of lipids for reducing immunogenicity include compounds having a polyglycerine region.
Examples of lipids for reducing immunogenicity include polymeric lipids such as DSPE-mPEG, DMPE-mPEG, DPPE-mPEG, and DOPE-mPEG.
Examples of lipids for reducing immunogenicity include PEG-phospholipids and PEG-ceramides.
Cationic Lipids
Examples of cationic lipids include cationic HEDC compounds as described in US 2013/0330401 A1. Some examples of cationic lipids are given in US 2013/0115274 A1. Additional examples of cationic lipids are known in the art.
Lipid Compositions
In some embodiments, a composition can contain the ionizable lipid compound 81, the structural lipid cholesterol, the stabilizer lipids DOPC and DOPE, and the lipid for reducing immunogenicity DPPE-mPEG. In certain embodiments, compound 81 can be 15 to 25 mol % of the composition; the cholesterol, DOPC, and DOPE combined can be 75 to 85 mol % of the composition; and DPPE-mPEG can be 5 mol % of the composition.
In one embodiment, compound 81 can be 25 mol % of the composition; cholesterol can be 30 mol % of the composition, DOPC can be 20 mol % of the composition, DOPE can be 20 mol % of the composition; and DPPE-mPEG(2000) can be 5 mol % of the composition.
Nanoparticles
Embodiments of this invention can provide liposome nanoparticle compositions. The ionizable molecules of this invention can be used to form liposome compositions, which can have a bilayer of lipid-like molecules.
A nanoparticle composition can have one or more of the ionizable molecules of this invention in a liposomal structure, a bilayer structure, a micelle, a lamellar structure, or a mixture thereof.
In some embodiments, a composition can include one or more liquid vehicle components. A liquid vehicle suitable for delivery of active agents of this invention can be a pharmaceutically acceptable liquid vehicle. A liquid vehicle can include an organic solvent, or a combination of water and an organic solvent.
Embodiments of this invention can provide lipid nanoparticles having a size of from 10 to 1000 nm. In some embodiments, the liposome nanoparticles can have a size of from 10 to 150 nm.
In certain embodiments, the liposome nanoparticles of this invention can encapsulate the RNAi molecule and retain at least 80% of the encapsulated RNAi molecules after 1 hour exposure to human serum.
Pharmaceutical Compositions
This invention further contemplates methods for distributing an active agent to an organ of a subject for treating malignant tumor by administering to the subject a composition of this invention. Organs that can be treated include lung, liver, pancreas, kidney, colon, bone, skin, and intestine.
In some embodiments, this invention provides methods for treating a lung malignant tumor disease by administering to the subject a composition of this invention.
In further aspects, this invention provides a range of pharmaceutical formulations.
A pharmaceutical formulation herein can include an active agent, as well as a drug carrier, or a lipid of this invention, along with a pharmaceutically acceptable carrier or diluent. In general, active agents of this description include any active agents for malignant tumor, including any inhibitory nucleic acid molecules and any small molecular drugs. Examples of inhibitory nucleic acid molecules include ribozymes, anti-sense nucleic acids, and RNA interference molecules (RNAi molecules).
Examples of anti-malignant tumor and anti-cancer drugs include oncogenes-related factors, tumor angiogenesis factor, metastatic related factors, cytokines such as TGF-Beta, growth factor, proteinase such as MMP, caspase, and immunization suppression factor.
A drug carrier may target a composition to reach stellate cells. A drug carrier may include a drug in its interior, or be attached to the exterior of a drug-containing substance, or be mixed with a drug so long as a retinoid derivative and/or vitamin A analogue is included in the drug carrier, and is at least partially exposed on the exterior of the preparation. The composition or preparation may be covered with an appropriate material, such as, for example, an enteric coating or a material that disintegrates over time, or may be incorporated into an appropriate drug release system.
A pharmaceutical formulation of this invention may contain one or more of each of the following: a surface active agent, a diluent, an excipient, a preservative, a stabilizer, a dye, and a suspension agent.
Some pharmaceutical carriers, diluents and components for a pharmaceutical formulation, as well as methods for formulating and administering the compounds and compositions of this invention are described in Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Pa. (1990).
Examples of preservatives include sodium benzoate, ascorbic acid, and esters of p-hydroxybenzoic acid.
Examples of surface active agents include alcohols, esters, sulfated aliphatic alcohols.
Examples of excipients include sucrose, glucose, lactose, starch, crystallized cellulose, mannitol, light anhydrous silicate, magnesium aluminate, magnesium metasilicate aluminate, synthetic aluminum silicate, calcium carbonate, sodium acid carbonate, calcium hydrogen phosphate, and calcium carboxymethyl cellulose.
Examples of suspension agents include coconut oil, olive oil, sesame oil, peanut oil, soya, cellulose acetate phthalate, methylacetate-methacrylate copolymer, and ester phthalates.
A therapeutic formulation of this invention for the delivery of one or more molecules active for gene silencing can be administered to a mammal in need thereof. A therapeutically effective amount of the formulation and active agent, which may be encapsulated in a liposome, can be administered to a mammal for preventing or treating malignant tumor.
The route of administration may be local or systemic.
A therapeutically-effective formulation of this invention can be administered by various routes, including intravenous, intraperitoneal, intramuscular, subcutaneous, and oral.
Routes of administration may include, for example, parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, as well as intrathecal, direct intraventricular, intraperitoneal, intranasal, or intraocular injections.
The formulation can also be administered in sustained or controlled release dosage forms, including depot injections, osmotic pumps, and the like, for prolonged and/or timed, pulsed administration at a predetermined rate.
The composition of the present invention may be administered via various routes including both oral and parenteral routes, and examples thereof include, but are not limited to, oral, intravenous, intramuscular, subcutaneous, local, intrapulmonary, intra-airway, intratracheal, intrabronchial, nasal, rectal, intraarterial, intraportal, intraventricular, intramedullar, intra-lymph-node, intralymphatic, intrabrain, intrathecal, intracerebroventricular, transmucosal, percutaneous, intranasal, intraperitoneal, and intrauterine routes, and it may be formulated into a dosage form suitable for each administration route. Such a dosage form and formulation method may be selected as appropriate from any known dosage forms and methods. See e.g. Hyojun Yakuzaigaku, Standard Pharmaceutics, Ed. by Yoshiteru Watanabe et al., Nankodo, 2003.
Examples of dosage forms suitable for oral administration include, but are not limited to, powder, granule, tablet, capsule, liquid, suspension, emulsion, gel, and syrup, and examples of the dosage form suitable for parenteral administration include injections such as an injectable solution, an injectable suspension, an injectable emulsion, and a ready-to-use injection. Formulations for parenteral administration may be a form such as an aqueous or nonaqueous isotonic sterile solution or suspension.
Pharmaceutical formulations for parenteral administration, e.g., by bolus injection or continuous infusion, include aqueous solutions of the active formulation in water-soluble form. Suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The formulations may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulary agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
In addition to the preparations described previously, the formulations may also be formulated as a depot preparation. Such long acting formulations may be administered by intramuscular injection. Thus, for example, the formulation may be formulated with suitable polymeric or hydrophobic materials, for example as an emulsion in an acceptable oil, or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
Compositions and formulations of this invention may also be formulated for topical delivery and may be applied to the subject's skin using any suitable process for application of topical delivery vehicle. For example, the formulation may be applied manually, using an applicator, or by a process that involves both. Following application, the formulation may be worked into the subject's skin, e.g., by rubbing. Application may be performed multiple times daily or on a once-daily basis. For example, the formulation may be applied to a subject's skin once a day, twice a day, or multiple times a day, or may be applied once every two days, once every three days, or about once every week, once every two weeks, or once every several weeks.
The formulations or pharmaceutical compositions described herein may be administered to the subject by any suitable means. Examples of methods of administration include, among others, (a) administration via injection, subcutaneously, intraperitoneally, intravenously, intramuscularly, intradermally, intraorbitally, intracapsularly, intraspinally, intrasternally, or the like, including infusion pump delivery; (b) administration locally such as by injection directly in the renal or cardiac area, e.g., by depot implantation; as well as deemed appropriate by those of skill in the art for bringing the active compound into contact with living tissue.
The exact formulation, route of administration and dosage for the pharmaceutical compositions can be chosen by the individual physician in view of the patient's condition. See, e.g., Goodman & Gilman's The Pharmacological Basis of Therapeutics, 12th Ed., Sec. 1, 2011. Typically, the dose range of the composition administered to the patient can be from about 0.5 to about 1000 mg/kg of the patient's body weight. The dosage may be a single one or a series of two or more given in the course of one or more days, as is needed by the patient. In instances where human dosages for compounds have been established for at least some condition, the dosages will be about the same, or dosages that are about 0.1% to about 500%, more preferably about 25% to about 250% of the established human dosage. Where no human dosage is established, as will be the case for newly-discovered pharmaceutical compositions, a suitable human dosage can be inferred from ED50 or ID50 values, or other appropriate values derived from in vitro or in vivo studies, as qualified by toxicity studies and efficacy studies in animals.
Methods for Preventing or Treating Malignant Tumor
The present invention further relates to a method for controlling the activity or growth of malignant tumors, the method including administering an effective amount of the composition to a subject in need thereof. The effective amount referred to here is, in a method for treating malignant tumor, alleviates its symptoms, or delays or stops its progression, and is preferably an amount that prevents the onset or recurrence of malignant tumor, or cures it. It is also preferably an amount that does not cause an adverse effect that exceeds the benefit from administration. Such an amount may be determined as appropriate by an in vitro test using cultured cells or by a test in a model animal or mammal such as a mouse, a rat, a dog, or a pig, and such test methods are well known to a person skilled in the art. Moreover, the dose of the active agents in the carrier and the dose of the active agents used in the method of the present invention are known to a person skilled in the art, or may be determined as appropriate by the above-mentioned tests.
The frequency of administration depends on the properties of the composition used and the above-mentioned conditions of the subject, and may be a plurality of times per day (that is, 2, 3, 4, 5, or more times per day), once a day, every few days (that is, every 2, 3, 4, 5, 6, or 7 days, etc.), a few times per week (e.g. 2, 3, 4 times, etc. per week), every other week, or every few weeks (that is, every 2, 3, 4 weeks, etc.).
In some embodiments, he present invention also relates to a method for delivering a drug to a malignant tumor cell, by utilizing the above carrier. This method includes a step of administering or adding the carrier having the substance to be delivered carried thereon to a living being or a medium, for example a culture medium, containing an extracellular matrix-producing cell in the lung. These steps may be achieved as appropriate in accordance with any known method or a method described in this invention. Moreover, the above method includes a mode carried out in vitro and a mode in which a malignant tumor cell in the lung inside the body is targeted.
A therapeutically-effective formulation of this invention can be administered by systemic delivery that can provide a broad biodistribution of the active agent.
Embodiments of this invention can provide a therapeutic formulation, which includes an inventive therapeutic molecule and a pharmaceutically-acceptable carrier.
An effective dose of a formulation of this invention may be administered from 1 to 12 times per day, or once per week. The duration of administration can be 1, 2, 3, 4, 5, 6 or 7 days, or can be 1, 2, 3, 4, 5, 6, 8, 10 or 12 weeks.
A composition for use in distributing an active agent for a treating malignant tumor in a subject, the composition comprising an ionizable lipid, a structural lipid, and a lipid for reducing immunogenicity of the nanoparticles. The malignant tumor can be located in the lung, colon, kidney or pancreas. The malignant tumor can be located in the liver, bone, skin, or intestine. The ionizable lipid can be from 50 mol % to 80 mol % of the lipids of the composition, or from 55 mol % to 65 mol % of the lipids of the composition. The structural lipid can be from 20 mol % to 50 mol % of the lipids of the composition, or from 35 mol % to 55 mol % of the lipids of the composition. The structural lipid can be a cholesterol, sterol, or steroid. The lipid for reducing immunogenicity of the nanoparticles can be from 1 mol % to 8 mol % of the lipids of the composition. The lipid for reducing immunogenicity of the nanoparticles may have a polyethyleneglycol (PEG) region having a molecular mass from 200 to 5000 Da. The lipid for reducing immunogenicity of the nanoparticles can be DPPE-mPEG, DSPE-mPEG, DMPE-mPEG, or DOPE-mPEG.
This invention further contemplates a composition for use in distributing an active agent for a treating malignant tumor in a subject, the composition comprising an ionizable lipid, a structural lipid, one or more stabilizer lipids, and a lipid for reducing immunogenicity of the nanoparticles. The ionizable lipid can be from 15 mol % to 40 mol % of the lipids of the composition, or from 20 mol % to 35 mol % of the lipids of the composition. The structural lipid can be from 25 mol % to 40 mol % of the lipids of the composition, or from 30 mol % to 35 mol % of the lipids of the composition.
The sum of the one or more stabilizer lipids can be from 25 mol % to 40 mol % of the lipids of the composition, wherein each of the stabilizer lipids individually is from 5 mol % to 35% mol %. The one or more stabilizer lipids can be phosphatidyl ethanolamine compounds or phosphatidyl choline compounds.
The composition can be (compound 81/cholesterol/DOPC/DOPE/DPPE-PEG-2000) in one of the following combinations, wherein the numerals refer to the mol % concentration of the component: (25/30/30/10/5), (25/30/25/15/5), (25/30/20/20/5), (25/30/15/25/5), (25/30/10/30/5), (25/35/15/20/5), (25/35/20/15/5), (30/30/15/20/5), (30/30/20/15/5), (35/30/15/15/5). In some embodiments, the ionizable lipid can be compound 81, the structural lipid can be cholesterol, the stabilizer lipids can be DOPC and DOPE, and the lipid for reducing immunogenicity of the nanoparticles can be DSPE-mPEG-2000, wherein compound 81 comprises 15 to 25 mol % of the composition, wherein cholesterol, DOPC, and DOPE combined comprise 75 to 85 mol % of the composition, wherein the DSPE-mPEG-2000 comprises from 1 to 5 mol % of the composition, and wherein compound 81, cholesterol, DOPC, DOPE, and the DSPE-mPEG-2000 combined comprise substantially 100 mol % of the lipids of the composition.
The active agent can be RNAi molecules targeted to GST-π and RNAi molecules targeted to p21. In some embodiments, the active agent comprises RNAi molecules targeted to GST-π and RNAi molecules targeted to p21, and the composition comprises liposome nanoparticles that encapsulate the RNAi molecules. In certain embodiments, the active agent comprises RNAi molecules targeted to GST-π and RNAi molecules targeted to p21, and the composition comprises liposome nanoparticles that encapsulate the RNAi molecules and retain at least 80% of the encapsulated RNAi molecules after 1 hour exposure to human serum.
This invention also contemplates pharmaceutical compositions comprising a lipid composition and an active agent. The active agent can be one or more RNAi molecules. The RNAi molecules for treating malignant tumor can include RNAi molecules targeted to GST-π and RNAi molecules targeted to p21. The RNAi molecules for treating malignant tumor can be, for example, siRNAs, shRNAs, or micro-RNAs, as well as DNA-directed RNAs (ddRNA), Piwi-interacting RNAs (piRNA), and repeat associated siRNAs (rasiRNA).
In certain embodiments, this invention provides a pharmaceutical composition containing RNAi molecules for treating malignant tumor that are RNAi molecules targeted to only GST-π.
Embodiments of this invention further include methods for distributing an active agent to an organ of a subject for treating malignant, by administering to the subject a composition of this invention. The malignant tumor can be located in the lung, colon, kidney or pancreas. The malignant tumor can be located in the liver, bone, skin, or intestine. The malignant tumor can be located in an anatomical region selected from the group consisting of head and neck, brain, breast, esophagus, stomach, intestine, duodenum, liver, gallbladder, bile duct, kidney, urethra, bladder, prostate, testis, uterus, ovary, skin, bone, bone marrow, blood, skin, and epithelial layer.
The administration can be a dose of from 0.01 to 2 mg/kg of the RNAi molecules at least once per day for a period up to twelve weeks. The administration can provide a mean AUC(0-last) of from 1 to 1000 ug*min/mL and a mean Cmax of from 0.1 to 50 ug/mL for the GST-π RNAi molecule. The administration can provide a mean plasma AUC(0-last) of from 1 to 1000 ug*min/mL and a mean plasma Cmax of from 0.1 to 50 ug/mL for the p21 RNAi molecule.
This invention provides methods for preventing, treating or ameliorating one or more symptoms of a malignant tumor in a mammal in need thereof, or any animal, the method comprising administering to the mammal a therapeutically effective amount of a composition comprising RNAi molecules, wherein a portion of the RNAi molecules are active in reducing expression of GST-π and a portion of the RNAi molecules are active in reducing expression of p21. In some embodiments, the malignant tumor is associated with KRAS mutation in the mammal, the method further comprising identifying a tumor cell in the mammal, the tumor cell comprising at least one of: (i) a mutation of the KRAS gene, and (ii) an aberrant expression level of KRAS protein.
The methods of this invention can be applicable to any animal, including humans.
The mammal can be a human, the GST-π can be a human GST-π, and the p21 can be a human p21. In some embodiments, the malignant tumor overexpresses GST-π, and if the expression of GST-π is downregulated, then the level of p21may be upregulated. The RNAi molecules can decrease expression of GST-π and p21 in the mammal. The administration can decrease expression of GST-π and p21 in the mammal by at least 5% for at least 5 days. The method can reduce one or more symptoms of the malignant tumor, or delays or terminates the progression of the malignant tumor, or reduce growth of malignant tumor cells in the subject. The tumor cells may comprise increased levels of expression of wild type KRAS protein as compared to that in a normal cell. The tumor cells may overexpress wild-type GST-π RNA or protein, and if expression of GST-π is suppressed, the level of p21 RNA or protein may be elevated.
In some embodiments, the tumor cells can comprise mutations in the KRAS protein at one or more of residues 12, 13 and 61. In certain embodiments, the tumor cells can comprise mutations in the KRAS protein and the tumor is a cancer selected from colon cancer, pancreatic cancer and lung cancer. The tumor can be a sarcoma selected from the group consisting of lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas and colorectal carcinoma. The malignant tumor can be a sarcoma selected from the group of lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas, colorectal carcinoma, breast cancer, and fibrosarcoma. The malignant tumor can be located in any anatomical region, which in some embodiments can be selected from the group of lung, liver, pancreas, colon, kidney, bone, skin, intestine, and any combination thereof.
In another aspect, this invention relates to the surprising discovery that malignant tumor size can be reduced in vivo by treatment with siRNA inhibitors of GST-π and p21. In addition, this invention provides the unexpectedly advantageous result that tumor cell apoptosis can be increased to a level of synthetic lethality to provide methods and compositions for preventing or treating malignant tumors.
This invention relates to methods and compositions incorporating nucleic acid based therapeutic compounds for use in delivery to various organs for preventing, treating, or ameliorating conditions and diseases of malignant tumor. In some embodiments, this invention provides compositions of RNA interference molecules (RNAi molecules) for gene silencing of various targets related to malignant tumors.
This invention can provide compositions for delivery of therapeutic molecules, as well as methods of use thereof. Various RNA-based and drug compositions of this invention can be used in methods for preventing or treating malignant tumors.
In some embodiments, malignant tumors containing a KRAS mutation or displaying aberrant KRAS expression levels can be reduced by treatment with siRNA agents that modulate expression of GST-π and p21 to a level that creates synthetic lethality for tumor cells.
This invention relates to methods and compositions for nucleic acid based therapeutic compounds against malignant tumors. In some embodiments, this invention provides RNAi molecules, structures and compositions that can silence expression of GST-π and p21. The structures and compositions of this disclosure can be used in preventing, treating or reducing the size of malignant tumors.
This invention provides compositions and methods that may be used for treating a neoplasia in a subject. In particular, this invention provides therapeutic compositions that can decrease the expression of a GST-π nucleic acid molecule or polypeptide, as well as a p21 nucleic acid molecule or polypeptide for treating a KRAS-associated neoplasia.
In some aspects, this invention includes an inhibitory nucleic acid molecule that corresponds to, or is complementary to at least a fragment of a GST-π nucleic acid molecule, and that decreases GST-π expression in a cell. In further aspects, this invention includes an inhibitory nucleic acid molecule that corresponds to, or is complementary to at least a fragment of a p21 nucleic acid molecule, and that decreases p21 expression in a cell.
In certain embodiments, this invention provides double-stranded nucleic acid molecules that are RNAi molecules such as siRNAs or shRNAs, as well as DNA-directed RNAs (ddRNA), Piwi-interacting RNAs (piRNA), and repeat associated siRNAs (rasiRNA) for suppressing GST-π and p21.
The methods of this invention can be applicable to any animal, including humans.
In some aspects, this invention includes one or more vectors encoding the inhibitory nucleic acid molecules described above. A vector can be a retroviral, adenoviral, adeno-associated viral, or lentiviral vector. In further embodiments, a vector can contain a promoter suitable for expression in a mammalian cell. Additional embodiments include cancer cells containing a KRAS mutation or displaying aberrant KRAS expression levels, which can also contain the vector, or an inhibitory nucleic acid molecule of any one of the above aspects. In further embodiments, the cells can be neoplastic cells in vivo.
In some embodiments, this invention includes methods for decreasing GST-π and p21 expression in a malignant tumor cell containing a KRAS mutation or displaying aberrant KRAS expression. Methods can include contacting the cell with an effective amount of the inhibitory nucleic acid molecules, where the inhibitory nucleic acid molecules inhibit expression of a GST-π polypeptide and a p21 polypeptide, thereby decreasing GST-π and p21 expression in the cell.
In additional embodiments, methods of this invention can decrease GST-π and p21 transcription or translation in malignant tumors.
In particular embodiments, this invention includes methods for decreasing GST-π and p21 expression in a malignant tumor cell, where the cell can be a human cell, a neoplastic cell, a cell in vivo, or a cell in vitro.
Embodiments of this invention can also provide methods for treating a subject having a neoplasm, where neoplasm cancer cells contain a KRAS mutation or display aberrant KRAS expression levels. Methods can involve administering to the subject an effective amount of two or more inhibitory nucleic acid molecules, where the inhibitory nucleic acid molecules reduce GST-π and p21 expression, thereby treating the neoplasm. In some embodiments, methods of this invention can decrease the size of a neoplasm, relative to the size of the neoplasm prior to treatment or without treatment.
In various embodiments, an inhibitory nucleic acid molecule can be delivered in a liposome, a polymer, a microsphere, a nanoparticle, a gene therapy vector, or a naked DNA vector.
In further aspects, this invention features methods for treating a subject, e.g. a human patient, having a neoplasm in which the neoplasm cancer cells contain a KRAS mutation or display aberrant KRAS expression levels. In certain embodiments, the methods can include administering to the subject an effective amount of inhibitory nucleic acid molecules, where the inhibitory nucleic acid molecules are antisense nucleic acid molecules, siRNAs, dsRNAs that are active for RNA interference, or a combination thereof, which inhibit expression of a GST-π polypeptide and a p21 polypeptide.
In particular embodiments, a cell of the neoplasm overexpresses GST-π, and if GST-π is suppressed, the level of p21 can be elevated.
In certain embodiments, the neoplasm can be a malignant tumor, or lung cancer, kidney cancer or pancreatic cancer.
Structures of Lipid Tails
A lipid-like compound of this invention may have one or more lipophilic tails that contain one or more alkyl or alkenyl groups. Examples of lipophilic tails include C(14:1 (5))alkenyl, C(14:1(9))alkenyl, C(16:1(7))alkenyl, C(16:1(9))alkenyl, C(18:1(3))alkenyl, C(18:1(5))alkenyl, C(18:1(7))alkenyl, C(18:1(9))alkenyl, C(18:1(11))alkenyl, C(18:1(12))alkenyl, C(18:2(9,12))alkenyl, C(18:2(9,11))alkenyl, C(18:3(9,12,15))alkenyl, C(18:3(6,9,12))alkenyl, C(18:3(9,11,13))alkenyl, C(18:4(6,9,12,15))alkenyl, C(18:4(9,11,13,15))alkenyl, C(20:1(9))alkenyl, C(20:1(11))alkenyl, C(20:2 (8,11))alkenyl, C(20:2(5,8))alkenyl, C(20:2(11,14))alkenyl, C(20:3(5,8,11))alkenyl, C(20:4(5,8,11,14))alkenyl, C(20:4(7,10,13,16))alkenyl, C(20:5(5,8,11,14,17))alkenyl, C(20:6(4,7,10,13,16,19))alkenyl, C(22:1(9))alkenyl, C(22:1(13))alkenyl, and C(24:1(9))alkenyl.
Chemical Definitions
The term “alkyl” as used herein refers to a hydrocarbyl radical of a saturated aliphatic group, which can be of any length. An alkyl group can be a branched or unbranched, substituted or unsubstituted aliphatic group containing from 1 to 22 carbon atoms. This definition also applies to the alkyl portion of other groups such as, for example, cycloalkyl, alkoxy, alkanoyl, and aralkyl, for example.
As used herein, a term such as “C(1-5)alkyl” includes C(1)alkyl, C(2)alkyl, C(3)alkyl, C(4)alkyl, and C(5)alkyl. Likewise, for example, the term “C(3-22)alkyl” includes C(1)alkyl, C(2)alkyl, C(3)alkyl, C(4)alkyl, C(5)alkyl, C(6)alkyl, C(7)alkyl, C(8)alkyl, C(9)alkyl, C(10)alkyl, C(11)alkyl, C(12)alkyl, C(13)alkyl, C(14)alkyl, C(15)alkyl, C(16)alkyl, C(17)alkyl, C(18)alkyl, C(19)alkyl, C(20)alkyl, C(21)alkyl, and C(22)alkyl.
As used herein, an alkyl group may be designated by a term such as Me (methyl), Et (ethyl), Pr (any propyl group), nPr (n-Pr, n-propyl), iPr (i-Pr, isopropyl), Bu (any butyl group), nBu (n-Bu, n-butyl), iBu (i-Bu, isobutyl), sBu (s-Bu, sec-butyl), and tBu (t-Bu, tert-butyl).
The term “alkenyl” as used herein refers to hydrocarbyl radical having at least one carbon-carbon double bond. An alkenyl group can be branched or unbranched, substituted or unsubstituted hydrocarbyl radical having 2 to 22 carbon atoms and at least one carbon-carbon double bond.
The term “substituted” as used herein refers to an atom having one or more substitutions or substituents which can be the same or different and may include a hydrogen substituent. Thus, the terms alkyl, cycloalkyl, alkenyl, alkoxy, alkanoyl, and aryl, for example, refer to groups which can include substituted variations. Substituted variations include linear, branched, and cyclic variations, and groups having a substituent or substituents replacing one or more hydrogens attached to any carbon atom of the group.
In general, a compound may contain one or more chiral centers. Compounds containing one or more chiral centers may include those described as an “isomer,” a “stereoisomer,” a “diastereomer,” an “enantiomer,” an “optical isomer,” or as a “racemic mixture.” Conventions for stereochemical nomenclature, for example the stereoisomer naming rules of Cahn, Ingold and Prelog, as well as methods for the determination of stereochemistry and the separation of stereoisomers are known in the art. See, for example, Michael B. Smith and Jerry March, March's Advanced Organic Chemistry, 5th edition, 2001. The compounds and structures of this disclosure are meant to encompass all possible isomers, stereoisomers, diastereomers, enantiomers, and/or optical isomers that would be understood to exist for the specified compound or structure, including any mixture, racemic or otherwise, thereof.
This invention encompasses any and all tautomeric, solvated or unsolvated, hydrated or unhydrated forms, as well as any atom isotope forms of the compounds and compositions disclosed herein.
This invention encompasses any and all crystalline polymorphs or different crystalline forms of the compounds and compositions disclosed herein.
Example Protocol for In Vitro Knockdown
One day before the transfection, cells were plated in a 96-well plate at 2×103 cells per well with 100 μl of DMEM (HyClone Cat. # SH30243.01) containing 10% FBS and culture in a 37° C. incubator containing a humidified atmosphere of 5% CO2 in air. Before transfection, medium was changed to 90 μl of Opti-MEM I Reduced Serum Medium (Life Technologies Cat. #31985-070) containing 2% FBS. Then, 0.2 μl of Lipofectamine RNAiMax (Life Technologies Cat. #13778-100) was mixed with 4.8 μl of Opti-MEM I for 5 minutes at room temperature. Next, 1 μl of siRNA was mixed with 4 μl of Opti-MEM I and combined with the LF2000 solution, and mixed gently, without vortex. After 5 minutes at room temperature, the mixture was incubated for an additional 10 minutes at room temperature to allow the RNA-RNAiMax complexes to form. Further, the 10 μl of RNA-RNAiMax complexes was added to a well, and the plate was shaken gently by hand. The cells were incubated in a 37° C. incubator containing a humidified atmosphere of 5% CO2 in air for 2 hours. The medium was changed to fresh Opti-MEM I Reduced Serum Medium containing 2% FBS. 24 hours after transfection, the cells were washed with ice-cold PBS once. The cells were lysed with 50 μl of Cell-to-Ct Lysis Buffer (Life Technologies Cat. #4391851 C) for 5-30 minutes at room temperature. 5 μl of Stop Solution was added, and it was incubated for 2 minutes at room temperature. The mRNA level was measured by RT-qPCR with TAQMAN immediately. Samples could be frozen at −80° C. and assayed at a later time.
Example Protocol for Serum Stability
0.2 mg/ml siRNA was incubated with 10% human serum at 37° C. At certain time points (0, 5, 15 and 30 min), 200 μl of sample was aliquoted and extracted with 200 μl extraction solvent (Chloroform:phenol:Isoamyl alcohol-24: 25:1). The sample was vortexed and centrifuged at 13,000 rpm for 10 min at RT, then the top layer solution was transferred and filtered it with 0.45 μm filter. The filtrate was transferred into a 300 μl HPLC injection vial. For LCMS, the Mobile phase was MPA: 100 mM HFIP+7 mM TEA in H2O, MPB: 50% Methanol+50% Acetonitrile. The Column: Waters Acquity OST 2.1×50 mm, 1.7 μm.
The formulation of GST-π and p21 siRNAs of this invention exhibited profound reduction of cancer xenograft tumors in vivo. The GST-π and p21 siRNAs provided gene knockdown potency in vivo when administered in a liposomal formulation to the cancer xenograft tumors.
The formulation of GST-π and p21 siRNAs showed significant and unexpectedly advantageous tumor inhibition efficacy within a few days after administration. After 30 days, the GST-π and p21 siRNAs showed markedly advantageous tumor inhibition efficacy, with tumor volume reduced by greater than 2-fold as compared to control.
The GST-π siRNA was administered in four injections (day 1, 8, 15 and 22) of a liposomal formulation having the composition (Ionizable lipid: Cholesterol: DOPE:DOPC: DPPE-PEG-2K) (25:30:20:20:5).
For the cancer xenograft model, an A549 cell line was obtained from ATCC. The cells were maintained in culture medium supplemented with 10% Fetal Bovine Serum and 100 U/ml penicillin and 100 μg/ml streptomycin. Cells were split 48 hrs before inoculation so that cells were in log phase growth when harvested. Cells were lightly trypsinized with trypsin-EDTA and harvested from tissue culture. The number of viable cells was counted and determined in a hemocytometer in the presence of trypan blue (only viable cells are counted). The cells were resuspended to a concentration of 5×107/ml in media without serum. Then the cell suspension was mixed well with ice thawed BD matrigel at 1:1 ratio for injection.
Mice were Charles River Laboratory Athymic Nude (nu/nu) Female Mice, immuno-compromised, 6-8 weeks old, 7-8 mice per group.
For tumor model preparation, each mouse was inoculated subcutaneously in the right flank with 0.1 ml an inoculum of 2.5×106 of A549 cells using a 25 G needle and syringe, one inoculum per mouse. Mice were not anesthetized for inoculation.
For tumor volume measurements and randomization, tumor size was measured to the nearest 0.1 mm. Tumor volumes were calculated using the formula: Tumor volume=length×width/2. Once the established tumors reached approximately 120-175 mm3, average tumor volume was about 150 mm3, the mice were assigned into the various vehicle control and treatment groups such that the mean tumor volumes in the treated groups were within 10% of the mean tumor volume in the vehicle control group, ideally, the CV % of tumor volume was less than 25%. On the same day, test articles and control vehicle were administered according to the dosing regimen. Tumor volumes were monitored three times for week 1, twice for the rest of weeks, including the day of study termination.
For dosage administration, on the dosing day, the test articles were taken out from −80° C. freezer and thawed on ice. Before applied to syringes, the bottle containing formulation was reverted by hands for a few times. All test articles were dosed by IV, at 10 ml/kg.
For body weight, mice were weighed to the nearest 0.1 g. Body weights were monitored and recorded daily within 7 days post dosing for first dose. Body weights were monitored and recorded twice for weeks, for the rest of weeks, including the day of study termination.
For tumors collection, on 28 days post first dosing, tumor volume was measured, and tumor was dissected for weight measurement, and stored for PD biomarker study. Tumor weight was recorded.
The formulation of GST-π and p21 siRNAs of this invention exhibited profound reduction of cancer xenograft tumors in vivo. The GST-π and p21 siRNAs provided gene knockdown potency in vivo when administered in a liposomal formulation to the cancer xenograft tumors.
The formulation of GST-π and p21 siRNAs showed significant and unexpectedly advantageous tumor inhibition efficacy within a few days after administration. After 30 days, the GST-π and p21 siRNAs showed markedly advantageous tumor inhibition efficacy, with tumor volume reduced by 1.7-fold as compared to control.
The formulations of GST-π and p21 siRNAs of this invention demonstrated increased cancer cell death by apoptosis of cancer cells in vitro. Apoptosis of cancer cells in vitro was monitored by observing upregulation of PUMA, a biomarker for apoptosis, which is associated with loss in cell viability.
The formulations of GST-π and p21 siRNAs provided unexpectedly increased apoptosis of cancer cells.
As shown in
These data show that the formulations of GST-π and p21 siRNAs of this invention provided unexpectedly increased apoptosis of cancer cells.
The protocol for the PUMA biomarker was as follows. One day before transfection, cells were plated in a 96-well plate at 2×103 cells per well with 100 μl of DMEM (HyClone Cat. # SH30243.01) containing 10% FBS and cultured in a 37° C. incubator containing a humidified atmosphere of 5% CO2 in air. Next day, before transfection the medium was replaced with 90 μl of Opti-MEM I Reduced Serum Medium (Life Technologies Cat. #31985-070) containing 2% FBS. Then, 0.2 μl of Lipofectamine RNAiMAX (Life Technologies Cat. #13778-100) were mixed with 4.8 μl of Opti-MEM I for 5 minutes at room temperature. 1 μl of the siRNAs (stock conc. 1 μM) was mixed with 4 μl of Opti-MEM I and combined with the RNAiMAX solution and then mixed gently. The mixture was incubated for 10 minutes at room temperature to allow the RNA-RNAiMAX complexes to form. 10 μl of RNA-RNAiMAX complexes were added per well, to final concentration of the siRNA 10 nM. The cells were incubated for 2 hours and medium changed to fresh Opti-MEM I Reduced Serum Medium containing 2% FBS. For 1, 2, 3, 4, and 6 days post transfection, the cells were washed with ice-cold PBS once and then lysed with 50 μl of Cell-to-Ct Lysis Buffer (Life Technologies Cat. #4391851 C) for 5-30 minutes at room temperature. 5 μl of Stop Solution was added and incubated for 2 minutes at room temperature. PUMA (BBC3, Cat# Hs00248075, Life Technologies) mRNA levels were measured by qPCR with TAQMAN.
A double knockdown in vitro study of siRNAs targeted to GST-π and p21 showed that the combination was highly active for suppressing the mRNA levels of both proteins. As shown in Table 11, the knockdown level for each of GST-π and p21 was high for concentrations of 2, 10 and 50 nM.
Protocol: Transfect with P21 siRNA at 2, 10, and 50 nM. After 1, 2, 3, or 4 days transfect with GST-π siRNA at 10 nM. 1 day later analyze by RT-PCR for P21 mRNA and GST-π mRNA levels.
The GST-π siRNAs of this invention can exhibit profound reduction of orthotopic lung cancer tumors in vivo. In this example, a GST-π siRNA provided gene knockdown potency in vivo when administered in a liposomal formulation to the orthotopic lung cancer tumors in athymic nude mice.
In general, an orthotopic tumor model can exhibit direct clinical relevance for drug efficacy and potency, as well as improved predictive ability. In the orthotopic tumor model, tumor cells are implanted directly into the same kind of organ from which the cells originated.
The anti-tumor efficacy of the siRNA formulation against human lung cancer A549 was evaluated by comparing the final primary tumor weights measured at necropsy for the treatment group and the vehicle control group.
The GST-π siRNA showed significant and unexpectedly advantageous lung tumor inhibition efficacy in this six-week study. As shown in
For this study, male NCr nu/nu mice, 5-6 weeks old, were used. The experimental animals were maintained in a HEPA filtered environment during the experimental period. The siRNA formulations were stored at 4° C. before use, and warmed to room temperature 10 minutes prior to injection in mouse.
For this A549 human lung cancer orthotopic model, on the day of surgical orthotopic implantation (SOI), the stock tumors were harvested from the subcutaneous site of animals bearing A549 tumor xenograft and placed in RPMI1640 medium. Necrotic tissues were removed and viable tissues were cut into 1.5-2 mm3 pieces. The animals were anesthetized with isoflurane inhalation and the surgical area was sterilized with iodine and alcohol. A transverse incision approximately 1.5 cm long was made in the left chest wall of the mouse using a pair of surgical scissors. An intercostal incision was made between the third and the fourth rib and the left lung was exposed. One A549 tumor fragment was transplanted to the surface of the lung with an 8-0 surgical suture (nylon). The chest wall was closed with a 6-0 surgical suture (silk). The lung was re-inflated by intrathoracic puncture using a 3 cc syringe with a 25 G×1½ needle to draw out the remaining air in the chest cavity. The chest wall was closed with a 6-0 surgical silk suture. All procedures of the operation described above were performed with a 7× magnification microscope under HEPA filtered laminar flow hoods.
Three days after tumor implantation, the model tumor-bearing mice were randomly divided into groups of ten mice per group. For the group of interest, treatment of the ten mice was initiated three days after tumor implantation.
For the group of interest, the formulation was (Ionizable lipid: cholesterol:DOPE:DOPC:DPPE-PEG-2K:DSPE-PEG-2K), a liposomal composition. The liposomes encapsulated the GST-π siRNA.
For the study endpoint, the experimental mice were sacrificed forty-two days after treatment initiation. Primary tumors were excised and weighed on an electronic balance for subsequent analysis.
For an estimation of compound toxicity, the mean body weight of the mice in the treated and control groups was maintained within the normal range during the entire experimental period. Other symptoms of toxicity were not observed in the mice.
The GST-π siRNAs of this invention exhibited profound reduction of cancer xenograft tumors in vivo. The GST-π siRNAs provided gene knockdown potency in vivo when administered in a liposomal formulation to the cancer xenograft tumors.
The GST-π siRNA showed significant and unexpectedly advantageous tumor inhibition efficacy within a few days after administration. After 36 days, the GST-π siRNA showed markedly advantageous tumor inhibition efficacy, with tumor volume reduced by 2-fold as compared to control.
As shown in
The GST-π siRNA was administered in two injections (day 1 and 15) of a liposomal formulation having the composition (Ionizable lipid:Cholesterol:DOPE:DOPC:DPPE-PEG-2K) (25:30:20:20:5).
For the cancer xenograft model, an A549 cell line was obtained from ATCC. The cells were maintained in culture medium supplemented with 10% Fetal Bovine Serum and 100 U/ml penicillin and 100 μg/ml streptomycin. Cells were split 48 hrs before inoculation so that cells were in log phase growth when harvested. Cells were lightly trypsinized with trypsin-EDTA and harvested from tissue culture. The number of viable cells was counted and determined in a hemocytometer in the presence of trypan blue (only viable cells are counted). The cells were resuspended to a concentration of 5×107/ml in media without serum. Then the cell suspension was mixed well with ice thawed BD matrigel at 1:1 ratio for injection.
Mice were Charles River Laboratory Athymic Nude (nu/nu) Female Mice, immuno-compromised, 6-8 weeks old, 7-8 mice per group.
For tumor model preparation, each mouse was inoculated subcutaneously in the right flank with 0.1 ml an inoculum of 2.5×106 of A549 cells using a 25 G needle and syringe, one inoculum per mouse. Mice were not anesthetized for inoculation.
For tumor volume measurements and randomization, tumor size was measured to the nearest 0.1 mm. Tumor volumes were calculated using the formula: Tumor volume=length×width2/2. Once the established tumors reached approximately 120-175 mm3, average tumor volume was about 150 mm3, the mice were assigned into the various vehicle control and treatment groups such that the mean tumor volumes in the treated groups were within 10% of the mean tumor volume in the vehicle control group, ideally, the CV % of tumor volume was less than 25%. On the same day, test articles and control vehicle were administered according to the dosing regimen. Tumor volumes were monitored three times for week 1, twice for the rest of weeks, including the day of study termination.
For dosage administration, on the dosing day, the test articles were taken out from −80° C. freezer and thawed on ice. Before applied to syringes, the bottle containing formulation was reverted by hands for a few times. All test articles were dosed at 0.75 mg/kg by IV, q2w×2, at 10 ml/kg.
For body weight, mice were weighed to the nearest 0.1 g. Body weights were monitored and recorded daily within 7 days post dosing for first dose. Body weights were monitored and recorded twice for weeks, for the rest of weeks, including the day of study termination.
For tumors collection, on 28 days post first dosing, tumor volume was measured, and tumor was dissected for weight measurement, and stored for PD biomarker study. Tumor weight was recorded.
The GST-π siRNAs of this invention demonstrated increased cancer cell death by apoptosis of cancer cells in vitro. The GST-π siRNAs provided GST-π knockdown, which resulted in upregulation of PUMA, a biomarker for apoptosis and associated with loss in cell viability.
GST-π siRNA SEQ ID NOs:156 and 182, which contained a combination of deoxynucleotides in the seed region, a 2′-F substituted deoxynucleotide, and 2′-OMe substituted ribonucleotides, provided unexpectedly increased apoptosis of cancer cells.
The level of expression of PUMA for GST-π siRNA SEQ ID NOs:156 and 182 was measured as shown in
These data show that the structure of GST-π siRNAs containing a combination of deoxynucleotides in the seed region, a 2′-F substituted deoxynucleotide, and 2′-OMe substituted ribonucleotides provided unexpectedly increased apoptosis of cancer cells.
The protocol for the PUMA biomarker was as follows. One day before transfection, cells were plated in a 96-well plate at 2×103 cells per well with 100 μl of DMEM (HyClone Cat. # SH30243.01) containing 10% FBS and cultured in a 37° C. incubator containing a humidified atmosphere of 5% CO2 in air. Next day, before transfection the medium was replaced with 90 μl of Opti-MEM I Reduced Serum Medium (Life Technologies Cat. #31985-070) containing 2% FBS. Then, 0.2 μl of Lipofectamine RNAiMAX (Life Technologies Cat. #13778-100) were mixed with 4.8 μl of Opti-MEM I for 5 minutes at room temperature. 1 μl of the GST-π siRNA (stock conc. 1 μM) was mixed with 4 μl of Opti-MEM I and combined with the RNAiMAX solution and then mixed gently. The mixture was incubated for 10 minutes at room temperature to allow the RNA-RNAiMAX complexes to form. 10 μl of RNA-RNAiMAX complexes were added per well, to final concentration of the siRNA 10 nM. The cells were incubated for 2 hours and medium changed to fresh Opti-MEM I Reduced Serum Medium containing 2% FBS. For 1, 2, 3, 4, and 6 days post transfection, the cells were washed with ice-cold PBS once and then lysed with 50 μl of Cell-to-Ct Lysis Buffer (Life Technologies Cat. #4391851 C) for 5-30 minutes at room temperature. 5 μl of Stop Solution was added and incubated for 2 minutes at room temperature. PUMA (BBC3, Cat#Hs00248075, Life Technologies) mRNA levels were measured by qPCR with TAQMAN.
The GST-π siRNAs of this invention can exhibit profound reduction of cancer xenograft tumors in vivo. The GST-π siRNAs can provide gene knockdown potency in vivo when administered in a liposomal formulation to the cancer xenograft tumors.
The GST-π siRNA showed significant and unexpectedly advantageous tumor inhibition efficacy within a few days after administration. As shown in
The p21 siRNA was administered in a single injection of 10 mL/kg of a liposomal formulation having the composition (Ionizable lipid:Cholesterol:DOPE:DOPC:DPPE-PEG2K) (25:30:20:20:5).
For the cancer xenograft model, an A549 cell line was obtained from ATCC. The cells were maintained in RPMI1640 supplemented with 10% Fetal Bovine Serum and 100 U/ml penicillin and 100 μg/ml streptomycin. Cells were split 48 hrs before inoculation so that cells were in log phase growth when harvested. Cells were lightly trypsinized with trypsin-EDTA and harvested from tissue culture. The number of viable cells was counted and determined in a hemocytometer in the presence of trypan blue (only viable cells are counted). The cells were resuspended to a concentration of 4×107/ml in RPMI media without serum. Then the cell suspension was mixed well with ice thawed BD matrigel at 1:1 ratio for injection.
Mice were Charles River Laboratory Athymic Nude (nu/nu) Female Mice, immuno-compromised, 6-8 weeks old, 3 mice per group.
For tumor model preparation, each mouse was inoculated subcutaneously in the right flank with 0.1 ml an inoculum of 2×106 of A549 cells using a 25 G needle and syringe, one inoculum per mouse. Mice were not anesthetized for inoculation.
For tumor volume measurements and randomization, tumor size was measured to the nearest 0.1 mm. Tumor volumes were calculated using the formula: Tumor volume=length×width2/2. Tumor volumes were monitored twice a week. Once the established tumors reached approximately 350-600 mm3, the mice were assigned into groups with varied time points. On the same day, test articles were administered according to the dosing regimen.
For dosage administration, on the day when the established tumors reached approximately 350-600 mm3, the test articles were taken out from 4° C. fridge. Before being applied to syringes, the bottle containing formulation was reverted by hand for a few times to make a homogeneous solution.
For body weight, mice were weighed to the nearest 0.1 g. Body weights were monitored and recorded twice for weeks, for the rest of weeks, including the day of study termination.
For tumors collection, animals were sacrificed by overdosed CO2 and tumors were dissected at 0, 24, 48, 72, 96 (optional), and 168 hours following the dosing. Tumors were first wet weighted, and then separated into three parts for KD, distribution and biomarker analysis. The samples were snap frozen in liquid nitrogen and stored at −80° C. until ready to be processed.
The embodiments described herein are not limiting and one skilled in the art can readily appreciate that specific combinations of the modifications described herein can be tested without undue experimentation toward identifying nucleic acid molecules with improved RNAi activity.
All publications, patents and literature specifically mentioned herein are incorporated by reference in their entirety for all purposes.
It is understood that this invention is not limited to the particular methodology, protocols, materials, and reagents described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. It will be readily apparent to one skilled in the art that varying substitutions and modifications can be made to the description disclosed herein without departing from the scope and spirit of the description, and that those embodiments are within the scope of this description and the appended claims.
It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. As well, the terms “a” (or “an”), “one or more” and “at least one” can be used interchangeably herein. It is also to be noted that the terms “comprises,” “comprising”, “containing,” “including”, and “having” can be used interchangeably, and shall be read expansively and without limitation.
Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For Markush groups, those skilled in the art will recognize that this description includes the individual members, as well as subgroups of the members of the Markush group.
Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.
All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2014-266198 | Dec 2014 | JP | national |
| Number | Name | Date | Kind |
|---|---|---|---|
| 5204241 | Pero | Apr 1993 | A |
| 5968737 | Ali-Osman | Oct 1999 | A |
| 8067390 | Merritt | Nov 2011 | B2 |
| 8367628 | Goodwin | Feb 2013 | B2 |
| 8664376 | Niitsu | Mar 2014 | B2 |
| 8686052 | Niitsu | Apr 2014 | B2 |
| 8710209 | Jin | Apr 2014 | B2 |
| 8741867 | Niitsu | Jun 2014 | B2 |
| 8895717 | Sood | Nov 2014 | B2 |
| 9151758 | Zetter | Oct 2015 | B2 |
| 9206424 | Jin | Dec 2015 | B2 |
| 20030144236 | Weiss | Jul 2003 | A1 |
| 20030165843 | Shoshan | Sep 2003 | A1 |
| 20040029275 | Brown | Feb 2004 | A1 |
| 20040219600 | Williams | Nov 2004 | A1 |
| 20050142596 | Krolewski | Jun 2005 | A1 |
| 20050233998 | Jadhav | Oct 2005 | A1 |
| 20050255487 | Khvorova | Nov 2005 | A1 |
| 20070083334 | Mintz | Apr 2007 | A1 |
| 20070083945 | Byrum | Apr 2007 | A1 |
| 20090181379 | Corrales Izquierdo | Jul 2009 | A1 |
| 20090220956 | Nuyten | Sep 2009 | A1 |
| 20100196482 | Radovic-Moreno | Aug 2010 | A1 |
| 20110269819 | Jones | Nov 2011 | A1 |
| 20120142754 | Niitsu | Jun 2012 | A1 |
| 20120276209 | Cullis | Nov 2012 | A1 |
| 20130004494 | Heber-Katz | Jan 2013 | A1 |
| 20130028885 | Zetter | Jan 2013 | A1 |
| 20130052160 | Zitvogel | Feb 2013 | A1 |
| 20130052169 | Zitvogel | Feb 2013 | A1 |
| 20130053270 | Gill | Feb 2013 | A1 |
| 20130196434 | Maier et al. | Aug 2013 | A1 |
| 20130330401 | Payne et al. | Dec 2013 | A1 |
| 20130345286 | Gollob | Dec 2013 | A1 |
| 20140005134 | Saus et al. | Jan 2014 | A1 |
| 20140017780 | Bentwich et al. | Jan 2014 | A1 |
| 20140134158 | Bardelli | May 2014 | A1 |
| 20140303237 | Shapiro et al. | Oct 2014 | A1 |
| 20140315975 | Niitsu | Oct 2014 | A1 |
| 20140315976 | Brahmbhatt et al. | Oct 2014 | A1 |
| 20140356413 | Niitsu et al. | Dec 2014 | A1 |
| 20150328248 | Niitsu et al. | Nov 2015 | A1 |
| Number | Date | Country |
|---|---|---|
| 103695421 | Apr 2014 | CN |
| 103695421 | Apr 2014 | CN |
| 2724729 | Jun 2011 | EP |
| 3238745 | Nov 2017 | EP |
| 2009-513151 | Apr 2009 | JP |
| 201440788 | Nov 2014 | TW |
| 9821359 | May 1998 | WO |
| WO 1998021359 | May 1998 | WO |
| 2004094636 | Nov 2004 | WO |
| WO 2004094636 | Nov 2004 | WO |
| WO 2007051303 | May 2007 | WO |
| WO 2007061922 | May 2007 | WO |
| 2009033284 | Mar 2009 | WO |
| WO 2009033284 | Mar 2009 | WO |
| 2012170952 | Dec 2012 | WO |
| 2012176282 | Dec 2012 | WO |
| WO 2012170952 | Dec 2012 | WO |
| WO 2012176282 | Dec 2012 | WO |
| 2013192364 | Dec 2013 | WO |
| WO 2013192364 | Dec 2013 | WO |
| WO 2014006020 | Jan 2014 | WO |
| 2014022739 | Feb 2014 | WO |
| WO 2014022739 | Feb 2014 | WO |
| 2014098210 | Jun 2014 | WO |
| WO 2014098210 | Jun 2014 | WO |
| 2014136086 | Sep 2014 | WO |
| WO 2014136086 | Sep 2014 | WO |
| Entry |
|---|
| Adler et al, Regulation of JNK signaling by GSTp, EMBO J, 1999, 18, 1321-1334. |
| Ashley, Deliverty of small interfering RNA by peptide-targeted mesoporous silica nanparticle-supported lipid bilayers, ACS Nano, Author Manuscript, 2012, 6, 1-28. |
| Ban, Transfection of glutathione S-transferase (GST)-pi antisense complementary DNA increase the sensitivity of a colon cancer cell line to Adriamycin, cisplatin, melphalan, and etoposide, Cancer Research, 1996, vol. 56, pp. 3577-3582. |
| Cho, Pirfenidone: An anti-fibrotic and cytoprotective agent as therapy for progressive kidney disease, Expert Opin Investig Drugs, Author Manuscript, 2011, 19, 1-13. |
| Gupta, Synergistic tumor suppression by combined inhibition of telomerase and CDKN1A6, PNAS, 2014, E3062-E3071. |
| Hida, Serum glutathione S-transferase-pi as a tumor marker for non-small cell lung cancer, Cancer, 1994, vol. 73(5), pp. 1377-1382. |
| Hirata, Significance of glutathione S-transferase-pi as a tumor marker in patients with oral cancer, Cancer, 1992, vol. 70(10), pp. 2381-2387. |
| Hokaiwado et al., Glutathione S-transferase pi mediates proliferation of androgen-independent prostate cancer cells, Carcinogenesis, 2008, 29(6), 1134-8. |
| Krizhanovsky, Senescence of activated stellate cells limits liver fibrosis, Cell, 2008, 134, 657-667. |
| Love, Lipid-like materials for low-dose, in vivo gene silencing, PNAS USA, 2010, vol. 107(5), pp. 1864-1869. |
| Matsunaga, C(H)OP) refractory chronic lumphocytic leukemia patients in whom salvage chemotherapy chose by evaluating multiple chemotherapeutic drug-resistant factors was remarkably effective, Int J Clin Oncol, 2003, vol. 8, pp. 326-331. |
| Morgan, Tumor efficacy and bone marrow-sparing properties of TER286, a cytotoxin activated by glutathione S-transferase, Cancer Research 1998, vol. 58, pp. 2568-2575. |
| Nakajima et al., Reverasal of multiple drug resistance in cholangiocarcinoma by the glutathione S-transferase-pi-specific inhibitor O1-hexadecyl-gamma-glutamyl-S-benzylcysteinyl-D-phenylglycine ethylester, J Pharmacol Exp Ther. 2003, 2006(3), 861-9. |
| Niitsu, Serum glutathione-S-transferase-rr as a tumor marker for gastrointestinal malignancies, Cancer, 1989, vol. 63, pp. 317-323. |
| Niitsu, A proof of glutathione S-transferase-pi-related multidrug resistance by transfer of antisense gene to cancer cells and sense gene to bone marrow stem cell, Chemico-Biological Interactions, 1998, vols. 111-112, pp. 325-332. |
| Nishita et al., Regulation of autophagy and MAPK signaling by glutathione S-transferase pi in KRAS mutated cancer cells, AACR 102nd Annual Meeting, Abstract No. 1065, 2011. |
| Ruan, Analysis of EGFR signaling pathway in nasopharyngeal carcinoma cells by quantitative phosphoproteomics, Proteome Science, 2011, 9, 1-11. |
| Sato, Resolution of liver cirrhosis using vitamin A-coupled liposomes to deliver siRNA against a collagen-specific chaperone, Nature Biotechnology, 2008, 26, 431-442. |
| Sawers, Glutathione S-transferase P1 (GSTP1) directely influences platinum drug chemosensitivity in ovarian tumour cell lines, British Journal of Cancer, 2014, 111, 1150-1158. |
| Singhal, 1,3-Bis(3,5-dichlorophenyl) urea compound COH-SR4 inhibits proliferation and activates apoptosis in melanoma, Biochemical Pharmacology, 2012, 84(11), 1419-1427. |
| Takahashi et al., Gan to Kagaku Ryoho, 1994, 21(7), 945-51, English summary pp. 951. |
| Townsend et al., Novel role for glutathione S-transferase pi regulator of protein S-glutathionylation following oxidative and nitrosative stress, J Biol Chem, 2009, 284, 436-445. |
| Vaishnaw, Review a status report on RNAi therapeutics, Silence, 2010, 1, 14-26. |
| Xu, Enhancing tumor cell response to chemotherapy through nanopartlcle-mediated codelivery of siRNA and cisplatin prodrug, PNAS USA, 2013, vol. 110(46), pp. 18638-18643. |
| Xue, Small RNA combination therapy for lung cancer, PNAS USA, 2014, vol. 111 (34), pp. E3553-E3561. |
| Yin et al., Glutathione S-transferase p elicits protection against H2O2-induced cell death via coordinated regulation of stress kinases, Cancer Res, 2000, 60, 4053-4057. |
| Yoshimoto, Obesity-induced gut microbial metabolite promotes liver cancer through senescence secretome, Nature 2013, 1-7. |
| AC114115, GenBank Accession No. AC114155, Rattus norvegicus clone CH230-2808, Working Draft Sequence, 6 unordered pieces, May 13, 2003 [online). [Retrieved on Apr. 30, 2016). Retrieved form the internet <URL: http://www.ncbi.nlm.nih.gov/nuccore/AC114115>. |
| AC230574, GenBank Accession No. AC230574, Bos taurus clone CH240-504M17, Jul. 10, 2008 [online]. (Retrieved on May 1, 2016). Retrieved form the internet <URL: http://www.ncbi.nlm.nih.gov/nuccore/AC230574>. |
| AC230665, GenBank Accession No. AC230665, Bos taurus clone CH240-502B15, Jul. 10, 2008 [online]. (Retrieved on May 1, 2016). Retrieved form the internet <URL: http://www.ncbi.nlm.nih.gov/nuccore/AC230665>. |
| AW374759, GenBank Accession No. AW374759, MR1-CT005B-291199-003-a05 CT0058 Homo sapiens cDNA. mRNA sequence, Jan. 9, 2011 [online]. (Retrieved on May 1, 2016). Retrieved form the internet <URL: http://www.ncbi.nlm.nih.gov/nuccore/6B79413/>. |
| BV207757, GenBank Accession No. BV207757, sqnm2244B3 Human DNA (Sequenom) Homo sapiens STS genomic, Oct. 17, 2009 [online]. (Retrieved on May 1, 2016). Retrieved form the internet <URL: http://www.ncbi.nlm.nih.gov/nuccore/BV207757>. |
| G0761423, GenBank Accession No. G0761423, 0010260TNA004657HT OTNA Ovis aries cDNA 5-, mRNA sequence, May 8, 2009 [online]. [Retrieved on Apr. 30, 2016]. Retrieved from the internet <URL: http://www.ncbi.nlm.nih.gov/nucest/G0761423>. |
| G0786145, GenBank Accession No. G0786145, 009200TNA002813HT OTNA Ovis aries cDNA 5-, mRNA sequence, May 8, 2009 [online]. [Retrieved on Apr. 30, 2016]. Retrieved from the internet <URL: http://www.ncbi.nlm.nih.gov/nucest/G0786145>. |
| JU528664, GenBank Accession No. JU528663, TSA: Ctenomys sociabilis 330326. Ctso mRNA sequence, Oct. 10, 2012 [online]. [Retrieved on Apr. 30, 2016). Retrieved from the internet <URL: http://www.ncbi.nlm.nih.gov/nuccore/JU528663>. |
| Fujiwara et al., “Pivotal Rile of the Cyclin-dependent Kinase Inhibitor p21WAF1/CIP1 in Apoptosis and Authophagy” Journal of Biological Chemistry, vol. 283, No. 1, Jan. 4, 2008. |
| Muller et al., “Thiazolides inhibit growth and induce glutathione-S-transferase Pi (GSTP1)-dependent cell death in human colon cancer cells”, Int. J. Cancer: 123, 1797-1806 (2008). |
| Nagaprashantha et al., “2′-Hydroxyflavanone inhibits proliferation, tumor vascularization and promotes normal differentiation in VHL-mutant renal cell carcinoma”, Carcinogenesis vol. 32, No. 4, pp. 568-575, 2011. |
| Noguchi et al., “PI3k-AKT Network Roles in Infection Diseases”, Division of Cancer Biology, Institute for Genetic Medicine, Hokkaido University, vol. 82:161-167, 2008. |
| Shi et al., “Combined silencing of K-ras and Akt2 oncogenes achieves synergistic effects in inhibiting pancreatic cancer cell growth in vitro and in vivo”, Cancer Gene Therapy 2009: 227-236. |
| Tripathi et al., “Reactive nitrogen species regulate autophagy through ATM-AMPK-TSC2-medicated suppression of mTORC1”, PNAS, EP2950-EP2957, Jul. 22, 2013. |
| Xia et al., “Cytoplasmic p21 is a potential predictor for cisplatin sensitivity in ovarian cancer”,I BMC 2011, 11: 1-9. |
| Zhang et al., “Reversal of multidrug resistance by small interfering double-stranded RNAs in ovarian cancer cells”, Gynecologic Oncology 2005: 97, 501-507. |
| Office Action issued in CN application No. 201580071233.3, dated Jul. 23, 2019. |
| Office Action issued in JP application No. 2015-247725, dated Oct. 15, 2019. |
| Office Action issued in JP application No. 2017-534294, dated Dec. 10, 2019. |
| Office Action issued in JP application No. 2017-534294, dated Sep. 10, 2019. |
| Search Report issued in EP application No. 15874366.6, dated Jul. 6, 2018. |
| Ui-Tei, Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect, Nucleic Acids Res., 2008, vol. 36(7), pp. 2136-2151. |
| Miyanishi, Glutathione S-Transferase-pi Overexpression Is Closely Associated With K-ras Mutation During Human Colon Carcinogenesis, Gastroenterology, 2001, vol. 121, pp. 865-874. |
| Hayashi, Suppressive effect of sulindac on branch duct-intraductal papillary mucinous neoplasms, J Gastroenterol, 2009, vol. 44, pp. 964-975. |
| Morse, The role of glutathione S-transferase P1-1 in colorectal cancer: friend or foe?, Gastroenterology, 2001, vol. 121(4), pp. 1010-1013. |
| Steckel, Determination of synthetic lethal interactions in KRAS oncogene-dependent cancer cells reveals novel therapeutic targeting strategies, Cell Res., 2012, vol. 22(8), pp. 1227-1245. |
| Collins, KRAS as a key oncogene and therapeutic target in pancreatic cancer, Front Physiol., 2013, vol. 4, Article 407, pp. 1-8. |
| Futreal, A Census of Human Cancer Genes, Nature Reviews Cancer 2004, vol. 4, pp. 177-183. |
| Ban et al., Cancer Res. 1996; 56 (15): 3577-82, Transfection of Glutathione S-Transferase (GST)-n′ Antisense complementary DNA Increases the Sensitivity of a Colon Cancer Cell Line to Adriamycin, Cisplatin, Melphalan, and Etoposide. |
| Nakajima et al., J Pharmacol Exp Ther. 2003; 306 (3): 861-9, Reversal of Multiple Drug Resistance in aholangiocarcinoma by the Glutathione S-Transferase-Pi-Specific Inhibitor O1-Hexadecyl-gamma-glutamyl-S-benzylcysteinyl-D-phenylglycine Ethylester. |
| Hokaiwado et al., Carcinogenesis. 2008; 29 (6): 1134-8, Glutathione S-transferase Pi mediates proliferation of androgen-independent prostate cancer cells. |
| JU528663, GenBank Accession No. JU528663, TSA: Ctenomys sociabilis 330326.Ctso mRNA sequence, Oct. 10, 2012 [online]. [Retrieved on Apr. 30, 2016). Retrieved from the Internet <URL: http://www.ncbi.nlm.nih.gov/nuccore/JU528663>. |
| Hokaiwado, Glutathione S-transferase Pi mediates proliferation of androgen-independent prostate cancer cells, Carcinogenesis, Jun. 1, 2008, vol. 29, pp. 1134-1138. |
| Tsao et al., Adenovirus-mediated p21 (WAF1 /SDI I/CIP1) gene transfer induces apoptosis of human cervical cancer cell lines, 1999, Journal of Virology, vol. 73, pp. 4983-4990. |
| Wu et al., Transcriptional regulation during p21 WAF1/CIP-induced apoptosis in human ovarian cancer cells, 2002, JBC, vol. 277, pp. 36329-36337. |
| Fan et al., An antisense oligodeoxynucleotide to p21 Waf1 /Cip1 causes apoptosis in human breast cancer cells, 2003, Molecular Cancer Therapeutics, vol. 2, pp. 773-782. |
| Zhang et al., Up-regulation of p21WAF1/CIP1 by small activating RNA inhibits the in vitro and in vivo growth of pancreatic cancer cells, 2012, Tumori, vol. 98, pp. 804-811. |
| Wagner, In Situ Evidence of KRAS Amplification and Association With Increased p21 Levels in Non-Small Cell Lung Carcinoma, 2009, Am J Clin Pathol, vol. 132, pp. 500-505. |
| https://cansar.icr.ac.uk/cansar/cell-lines/A549/mutations/ retrieved from the web on Jun. 20, 2016. |
| Valtorta, KRAS gene amplification in colorectal cancer and impact on response to EGFR-targeted therapy, 2013, Int. J. Cancer, vol. 133, pp. 1259-1266. |
| Birkeland, KRAS gene amplification and overexpression but not mutation associates with aggressive and metastatic endometrial cancer, 2012, British Journal of Cancer, vol. 107, pp. 1997-2004. |
| Number | Date | Country | |
|---|---|---|---|
| 62266661 | Dec 2015 | US | |
| 62184241 | Jun 2015 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 14979566 | Dec 2015 | US |
| Child | 16576102 | US |
